Prosecution Insights
Last updated: April 19, 2026
Application No. 18/007,164

GENOME EDITING OF TRANSGENIC CROP PLANTS WITH MODIFIED TRANSGENIC LOCI

Non-Final OA §102§103§DP
Filed
Jan 27, 2023
Examiner
RADOSAVLJEVIC, ALEKSANDAR
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Inari Agriculture Technology Inc.
OA Round
1 (Non-Final)
82%
Grant Probability
Favorable
1-2
OA Rounds
2y 11m
To Grant
89%
With Interview

Examiner Intelligence

Grants 82% — above average
82%
Career Allow Rate
87 granted / 106 resolved
+22.1% vs TC avg
Moderate +7% lift
Without
With
+7.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
25 currently pending
Career history
131
Total Applications
across all art units

Statute-Specific Performance

§101
8.9%
-31.1% vs TC avg
§103
20.6%
-19.4% vs TC avg
§102
15.3%
-24.7% vs TC avg
§112
42.4%
+2.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 106 resolved cases

Office Action

§102 §103 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 79-81, 83-84, 86-91, and 101-107 are pending. Election/Restrictions Applicant’s election without traverse of the species “Agrobacterium right and/or left border” and “DAS44406-6”, in the reply filed on 20 August 2025 is acknowledged. In the reply to the Requirement for Election/Restriction, Applicant has not indicated the claims readable on the elected species. Examiner has determined that the claims which read on the elected species are claims 79, 84, 86, 91, 101-105, and 107 Claims 80-81, 83, 87-90, and 106 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Claims 79, 84, 86, 91, 101-105, and 107 are examined to the extent that they read on the elected species. Claim Objections Claim 101 is objected to because of the following informalities: on the first line, it appears that the article “A” is missing from the beginning of the claim. Appropriate correction is required. Claim Interpretation Claim 79 is drawn to an elite crop comprising a modification of an original approved transgenic locus, wherein the modification comprises a deletion of a segment comprising, consisting essentially of, or consisting of Agrobacterium right and/or left border sequences. Examiner interprets this claim to read on any elite plant crop which does not comprise a transgene or a transgenic plant from which an entire transgene insert has been deleted. This interpretation is explained below. As “comprising, consisting essentially of, or consisting of” are listed in the alternative, “consisting essentially of” and “consisting of” are not required limitations. Further, as “comprising” is open language, the limitation encompasses deletion of a segment that must include Agrobacterium right and/or left borders but it is not limited to a deletion which only includes Agrobacterium right and/or left border sequences. Therefore, the limitation would be met by a deletion of an entire transgenic insert, such as DAS44406-06, which would inherently comprise Agrobacterium right and/or left border sequences as well as other elements, such as a selectable marker gene. Furthermore, while the claim recites the limitations of “comprising a modification of an original approved transgenic locus, wherein the modification comprises a deletion”, these limitations constitute a ”product by process”. Any product claimed in a product by process that is the same as, or obvious from, a product of the prior art is unpatentable unless the manufacturing process steps would be expected to impart distinctive structural characteristics to the final product (see MPEP 2113). Absent any evidence to the contrary, there would be no structural differences between an elite crop plant which has never comprised a transgenic locus and an elite crop plant from which a transgenic locus has been deleted. Applicant defines “elite crop plant” as a plant which has undergone breeding to provide one or more trait improvements (instant specification ¶0045). For these reasons, the broadest reasonable interpretation of the plant of claim 79 includes any elite plant crop which does not comprise a transgene or a transgenic plant from which an entire transgene insert has been deleted. Claims 84, 86 and 91, which depend from claim 79 do not recite any limitations that narrow this interpretation for the same reasons as set forth above. While these claims require that the modified transgenic locus is DAS4406-6, that the deletion is an Agrobacterium is a left border sequence, and that the deleted segment further comprises a selectable marker gene, as explained above these claims encompass a plant from which transgenic locus DAS4406-6 has been deleted and/or a plant which has never comprised transgenic locus DAS4406-6. Thus, these claims also read on an elite crop plant which has never comprised a transgenic locus a transgenic plant from which an entire transgene insert has been deleted. Improper Markush Grouping Rejection Claims 79, 84, 101,103-105,and 107 are rejected on the basis that they contain an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush groupings of “a duplication of a transgene; a duplication of a transgene element; Agrobacterium right and/or left border sequences; and/or a fragment of a transgene” (claim 79); “a synthetic cloning site sequence; a duplication of a transgene sequence; a fragment of a transgene sequence; agrobacterium right and/or left border sequences; and/or a segment of DNA that is non-essential for a primary functionality of the transgenic locus “ (claim 101, 105); “the synthetic cloning site sequence, the duplication of a transgene sequence, the fragment of a transgene sequence, and/or Agrobacterium right/and or left border sequences” (claims 103-104); and “A5547-127, DAS44406-6, DAS68416-4, DAS81419-2, GTS 40- 3-2, MON87701, MON87708, MON89788, MST-FG072-3, or SYHTOH2” (claims 84 and 107) are improper because the alternatives defined by the Markush groupings do not share both a single structural similarity and a common use. The Markush groupings of claims 79 101, and 103-105 are drawn to different portions or elements of a transgenic locus. The recited alternatives do not share any structural similarity beyond the fact that they are all nucleotide sequences and do not have a common use or function. The Markush grouping of claims 84 and 107 recite alternative transgenic events. Not only do these transgenic events comprise different trait expression cassettes conferring different herbicide tolerances and/or insect resistances (see Table 2, instant specification) but they are also located at different locations within the soybean genome. Thus, these alternatives do not share both a single structural similarity and a common use. To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 79, 84, 86 and 91 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Boerman et al (US Patent No.: 8,304,616 B2; 6 November 2012). As explained above in the “Claim Interpretation” section, the plants of claims 79, 84, 86 and 91 encompass any elite crop plant which has never comprised a transgenic locus. Boerman et al teaches conventional soybean variety G00-3209 (i.e. has never comprised a transgenic locus and thus does not comprise Agrobacterium right and/or left border sequences or a selectable marker gene) which has 19% higher yield than comparison soybean variety Benning and 14% higher yield than comparison soybean variety Haskell-RR (i.e. is an elite crop plant; Boerman et al, column 4, lines 11-25; instant specification, ¶0045). Thus, Boerman et al anticipates all the limitations of claims 79, 84, 86 and 91. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 101-105, and 107 are rejected under 35 U.S.C. 103 as being unpatentable over Cui et al (US Patent No.: 9540655; 10 Jan 2017) taken with the evidence of Pore et al (US Patent No.: 10,793,872 B2) and Russel et al (US Patent No.: 9,695,432 B2). The claims are drawn to a method of editing a transgenic plant genome to obtain a plant cell, plant part or plant containing a modification of an original transgenic locus, the method comprising contacting a transgenic plant genome with one or more gene editing molecules which introduce one or more single or double-stranded breaks providing for excision of a segment of the original transgenic locus, said segment comprising Agrobacterium right and/or left border sequences; and selecting a plant cell, plant part of plant containing a modified transgenic locus wherein a segment comprising Agrobacterium right and/or left border sequences has been deleted from the transgenic locus (claim 101). The claims are further drawn to the method of claim 101 wherein the method further comprises excising DNA comprising a selectable marker gene (claim 102); wherein the segment comprising Agrobacterium right and/or left border sequences further comprises a selectable marker gene (claim 103); or wherein the modification comprises modification of a DAS44406-6 original transgenic locus in a transgenic soybean plant. Claims 104 and 105 are drawn to the method of claim 101, further comprising contacting the genome with one or more gene editing molecules which introduce one or more single or double-stranded breaks providing for excision of a selectable marker gene, wherein the segment comprising Agrobacterium right and/or left border sequences is deleted (claim 104) and selecting a plant cell, plant part or plant containing a modification of an original transgenic locus wherein a selectable marker gene and the segment comprising Agrobacterium right and/or left border sequences have been deleted. Cui et al teaches transgenic soybean plants comprising event pDAB8264.44.06.1 (Abstract, column 3, lines 56-65, and generally throughout). Cui et teaches that event pDAB8264.44.06.1 comprises a selectable marker gene, pat (column 28, lines 8-16; Figure 1). One of ordinary skill in the art would understand that event pDAB8264.44.06.1 inherently comprises Agrobacterium left and/or right border sequences, as the presence of these sequences is a feature of Agrobacterium mediated transformation. Soybean event pDAB8264.44.06.1 is also known in the art as DAS44406-6 (see, for example, Pore et al, column 27, lines 6-8). Cui et al teaches excision of a portion of the transgenic insert or the entire transgenic insert and/or flanking sequences of event pDAB8264.44.06.1 (column 4, lines 58-64; column 7, lines 59-63). Cui teaches that selectable markers can be excised and replaced (column 16, lines 1-8; lines 17-34). Cui et al teaches that after excision another insert can be targeted to the location of event pDAB8264.44.06.1 and that the insert of event pDAB8264.44.06.1 can be replaced in this manner (column 4, lines 58-64; column 7, lines 59-63). Cui et al teaches that transgenic excision can be accomplished with the use of zinc finger nucleases (column 16, lines 1-15). Excising the entire insert of event pDAB8264.44.06.1 would inherently delete the Agrobacterium left and/or right borders, as well as the selectable marker gene, which in this case is pat. One of ordinary skill in the art would understand that zinc finger nucleases are gene editing molecules which introduce one or more double-stranded breaks in a genome providing for excision of a segment of DNA (see Russel et al, column 3, lines 22-55). Cui et al does not teach selecting plants with a modified transgenic locus. At the time of filing, it would be obvious to excise the DAS44406-6 transgenic event from a soybean plant comprising said DAS44406-6 transgenic event, thus obtaining a plant containing a modified transgenic locus. One would be motivated to do so given the explicit teachings of Cui et al that plants comprising event DAS44406-6 can be modified by excising the entire insert. It would be obvious to excise said insert by contacting the genome with a gene editing molecule that introduces double-stranded breaks, such as a zing finger nuclease, give the explicit teachings of Cui et al that that transgenic excision can be accomplished with the use of zinc finger nucleases. It would be further obvious to select plants containing said modified transgenic locus, given that selecting modified or gene-edited plants after performing modification or gene-editing is routine and standard practice in the art. One would have a reasonable expectation of success given the guidance provided by Cui et al, the high skill level of a person having ordinary skill in the art, and the routine nature of editing plant genomes in the art. Regarding the limitations drawn to the deletion of Agrobacterium left and/or right borders, either alone or as part of a deletion also comprising a selectable marker gene, as explained above excising the entire DAS44406-6 transgenic event would inherently result in the deletion of Agrobacterium left and/or right borders and the selectable marker gene, pat. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 79, 84, 86, 91, and 101-105 and 107 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 34-42, 50-52, 54, 56-59, and 62-64 of copending Application No. 18/007,187 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other. The instant claims are drawn to an elite crop comprising a modification of an original approved transgenic locus, wherein the modification comprises a deletion of a segment comprising, consisting essentially of, or consisting of Agrobacterium right and/or left border sequences; wherein the modified transgenic locus is DAS4406-6, wherein the deletion is an Agrobacterium is a left border sequence, and further wherein the deleted segment further comprises a selectable marker gene. The claims are also drawn to a method of editing a transgenic plant genome to obtain a plant cell, plant part or plant containing a modification of an original transgenic locus, the method comprising contacting a transgenic plant genome with one or more gene editing molecules which introduce one or more single or double-stranded breaks providing for excision of a segment of the original transgenic locus, said segment comprising Agrobacterium right and/or left border sequences; and selecting a plant cell, plant part of plant containing a modified transgenic locus wherein a segment comprising Agrobacterium right and/or left border sequences has been deleted from the transgenic locus; wherein the method further comprises excising DNA comprising a selectable marker gene; wherein the segment comprising Agrobacterium right and/or left border sequences further comprises a selectable marker gene; or wherein the modification comprises modification of a DAS44406-6 original transgenic locus in a transgenic soybean plant. The claims are further drawn to said method comprising contacting the genome with one or more gene editing molecules which introduce one or more single or double-stranded breaks providing for excision of a selectable marker gene, wherein the segment comprising Agrobacterium right and/or left border sequences is deleted; and selecting a plant cell, plant part or plant containing a modification of an original transgenic locus wherein a selectable marker gene and the segment comprising Agrobacterium right and/or left border sequences have been deleted. The reference application claims are drawn to the same methods and plants, however, the reference application requires the additional limitations that the deleted segment is a “repetitive sequence”, that the selectable marker gene and Agrobacterium left and/or right border sequences are on different segments, that the repetitive sequence is flanked by operably linked PAM sites which are recognized by an RNA dependent DNA endonuclease, and that the gene editing molecule is selected from a group comprising RNA dependent DNA endonucleases and guide RNAs, RNA dependent nickases and guide RNAs, Zinc Finger nucleases or nickases, and TALE nucleases or nickases. Thus, the plants and methods of the reference application are species which anticipate the genus of plants and methods encompassed by the instant claims. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 79, 84, 86, 101, and 107 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 14-31 of copending Application No. 18/040,110(reference application). Although the claims at issue are not identical, they are not patentably distinct from each other. The instant claims are drawn to an elite crop comprising a modification of an original approved transgenic locus, wherein the modification comprises a deletion of a segment comprising, consisting essentially of, or consisting of Agrobacterium right and/or left border sequences; wherein the modified transgenic locus is DAS4406-6, wherein the deletion is an Agrobacterium is a left border sequence. The claims are also drawn to a method of editing a transgenic plant genome to obtain a plant cell, plant part or plant containing a modification of an original transgenic locus, the method comprising contacting a transgenic plant genome with one or more gene editing molecules which introduce one or more single or double-stranded breaks providing for excision of a segment of the original transgenic locus, said segment comprising Agrobacterium right and/or left border sequences; and selecting a plant cell, plant part of plant containing a modified transgenic locus wherein a segment comprising Agrobacterium right and/or left border sequences has been deleted from the transgenic locus; or wherein the modification comprises modification of a DAS44406-6 original transgenic locus in a transgenic soybean plant. The reference claims are drawn to a method of modifying a transgenic plant comprising DAS44406-6 (reference SEQ ID NO: 1; Figures 1A-D; ¶ 0010; Example 1, ¶00106-00109) by excising a portion of the 3’ junction sequence of DAS44406-6 with genome editing molecules and selecting plants comprising the modification; said method where the genome editing molecule is a type V Cas nuclease (which introduces double-stranded breaks), further wherein the genome editing molecule comprises a Cas12a protein; and plants obtained by said methods. As explained in the reference specification, the entire junction sequence is eliminated by combining the guide RNAs of SEQ ID NO: 4 and 8 (see reference claim 14 and paragraphs ¶00106-00109). The junction sequences of transgenic events which are introduced by Agrobacterium mediated transformation, such as DAS44406-6, inherently comprises Agrobacterium left and/or right border sequences, thus deleting a junction sequence would delete these border sequences. Thus, the plants and methods of the reference application are species which anticipate the genus of plants and methods encompassed by the instant claims. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 79 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 27, and 29-31 of copending Application No. 18/452,225 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other. Instant claim 79 is drawn to an elite crop comprising a modification of an original approved transgenic locus, wherein the modification comprises a deletion of a segment comprising, consisting essentially of, or consisting of Agrobacterium right and/or left border sequences. Reference claims 27, and 29-31 are drawn to a transgenic maize plant cell comprising a modified 5307 transgenic locus comprising a deletion of part or all of the 5’ junction polynucleotide sequence set forth in SEQ ID NO: 6; and plant and plant parts comprising said cell. The reference specification teaches SEQ ID NO: 7, which is the endogenous genomic region flanking the 5307 transgenic locus. Alignment of SEQ ID NO: 7 and SEQ ID NO: 6 shows that the first half of SEQ ID NO: 6 aligns with the final 30 nucleotides of SEQ ID NO: 7. Nucleotides 31-60 do not and thus appear to constitute the 5’ end of the 5307 transgene insert. These nucleotides would inherently comprise an Agrobacterium border sequence. Therefore, the plant of the reference application is a species which anticipates the genus of plants encompassed by the instant claims. Alignment of reference SEQ ID NO: 7 and SEQ ID NO: 6: Query Match 2.2%; Score 30; DB 1; Length 60; Best Local Similarity 100.0%; Matches 30; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1319 TCCGGTGTGCCTCTAAAATTCAACTCACGA 1348 |||||||||||||||||||||||||||||| Db 1 TCCGGTGTGCCTCTAAAATTCAACTCACGA 30 This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim 79 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 22 and 24-26 of copending Application No. 18/452,330 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other. Instant claim 79 is drawn to an elite crop comprising a modification of an original approved transgenic locus, wherein the modification comprises a deletion of a segment comprising, consisting essentially of, or consisting of Agrobacterium right and/or left border sequences. Reference claims 22 and 24-26 are drawn to a transgenic maize plant cell comprising a modified DAS59122-7 transgenic locus comprising a deletion of part or all of the 5’ junction polynucleotide sequence set forth in SEQ ID NO: 19; and plant and plant parts comprising said cell. The reference specification teaches SEQ ID NO: 20, which is the endogenous genomic region flanking the DAS59122-7 transgenic locus. Alignment of SEQ ID NO: 20 and SEQ ID NO: 19 shows that the first half of SEQ ID NO: 19 aligns with the final 20 nucleotides of SEQ ID NO: 20. Nucleotides 21-40 do not and thus appear to constitute the 5’ end of the DAS59122-7 transgene insert. These nucleotides would inherently comprise an Agrobacterium border sequence. Therefore, the plant of the reference application is a species which anticipates the genus of plants encompassed by the instant claims. Alignment of reference SEQ ID NO: 20 and SEQ ID NO: 19: Query Match 0.8%; Score 20; DB 1; Length 40; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2574 GGATAAGCAAGTAAAAGCGC 2593 |||||||||||||||||||| Db 1 GGATAAGCAAGTAAAAGCGC 20 This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim 79 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 20 and 22-24 of copending Application No. 18/481,069 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other. Instant claim 79 is drawn to an elite crop comprising a modification of an original approved transgenic locus, wherein the modification comprises a deletion of a segment comprising, consisting essentially of, or consisting of Agrobacterium right and/or left border sequences. Reference claims 20 and 22-24 are drawn to a transgenic soybean plant cell comprising a modified DAS81419-2 transgenic locus set forth in SEQ ID NO:2 comprising a deletion of part or all of the 3’ junction polynucleotide sequence set forth in SEQ ID NO: 21; and plant and plant parts comprising said cell. The reference specification teaches SEQ ID NO: 2, which has been modified from the original DAS81419-2 transgenic locus (SEQ ID NO: 1) by the deletion of 7 nucleotides in positions 13890-13896 relative to the numbering of SEQ ID NO: 1 (alignment below). The reference specification teaches that the DAS81419 transgenic insert spans nucleotides 1401-13896 of SEQ ID NO: 1 and that the 3’ flanking DNA spans nucleotides 13897-15294 of SEQ ID NO: 1 (reference specification, page 13, Table 1). Thus, it appears that a plant comprising SEQ ID NO: 2 comprises a deletion comprising an Agrobacterium border sequence. Further, Alignment of SEQ ID NO: 21 and SEQ ID NO: 1 shows that the junction sequence of SEQ ID NO: 21 spans the border of the transgene insert and the endogenous flanking DNA (alignment below). These nucleotides would inherently comprise an Agrobacterium border sequence. Therefore, the plant of the reference application is a species which anticipates the genus of plants encompassed by the instant claims. Portion of the alignment of reference SEQ ID NO: 1 and reference SEQ ID NO: 2: Qy 13861 CTTCAGTACATTAAAAACGTCCGCAATATGATATTCATTAATTTTATATTATCTAAAAGA 13920 ||||||||||||||||||||||||||||| |||||||||||||||||||||||| Db 13861 CTTCAGTACATTAAAAACGTCCGCAATAT-------ATTAATTTTATATTATCTAAAAGA 13913 Alignment of reference SEQ ID NO: 1 and reference SEQ ID NO: 21: Query Match 0.1%; Score 20; DB 1; Length 20; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 13887 TATGATATTCATTAATTTTA 13906 |||||||||||||||||||| Db 1 TATGATATTCATTAATTTTA 20 This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claim 79 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 3-4 and 6 of copending Application No. 18/462,778 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other. Instant claim 79 is drawn to an elite crop comprising a modification of an original approved transgenic locus, wherein the modification comprises a deletion of a segment comprising, consisting essentially of, or consisting of Agrobacterium right and/or left border sequences. Reference claims 3-4 and 6 are drawn to a modification of a MON89788 transgenic soybean locus in a plant cell, wherein the modification comprises a deletion of a DNA in a 5’ or 3’ DNA junction polynucleotide, wherein the deletion in a 5’ junction polynucleotide comprises a deletion of one or more nucleotides corresponding to nucleotides 1-204 of SEQ ID NO: 2 or wherein the deletion in a 3’ junction polynucleotide comprises a deletion of one or more nucleotides corresponding to nucleotides 5397-5416 of SEQ ID NO: 1; or wherein the wherein the deletion in a 5’ junction polynucleotide comprises a deletion of one or more nucleotides corresponding to nucleotides 1094 to 1113 of SEQ ID NO: 1. Examiner notes that the reference claims encompass deletions of all of the nucleotides present in the segments defined by nucleotides 1-204 of SEQ ID NO: 2, nucleotides 5397-5416 of SEQ ID NO: 1, or nucleotides 1094 to 1113 of SEQ ID NO: 1. The MON89766 transgenic locus in described in Malven et al (US 2006/0282915 A1; published 14 Dec 2006). Malven et al discloses that the border between the 5’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 1103 and 1104 and that the border between the 3’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 5406 and 5407 (see Table 3, pages 8-9). The reference application teaches SEQ ID NO: 1, which is the full length sequence of MON89766 as disclosed in Malven et al (see reference specification, ¶0005), and SEQ ID NO: 2, which is polynucleotide spanning the junction region of the 5’ endogenous flanking region and beginning of the transgenic insertion (reference specification, ¶0060). Alignment of reference SEQ ID NO: 1 and SEQ ID NO: 2 (shown below) shows that SEQ ID NO: 2 spans the border between the 5’ endogenous flanking sequence and the transgenic insertion. Given the evidence provided by Malven et al, a deletion of the segments defined by nucleotides 1-204 of SEQ ID NO: 2, nucleotides 5397-5416 of SEQ ID NO: 1, or nucleotides 1094 to 1113 of SEQ ID NO: 1 would inherently comprise deletion of an Agrobacterium right and/or left border sequence. Alignment of reference SEQ ID NO: 1 to reference SEQ ID NO: 2: RESULT 1 US-18-462-778-1 Query Match 100.0%; Score 204; DB 1; Length 6466; Best Local Similarity 100.0%; Matches 204; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TGACAACTCTTTAACTTATCCTCTAACATCAGGTTTTCCATACTTGATTTGTCCCTCTTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 919 TGACAACTCTTTAACTTATCCTCTAACATCAGGTTTTCCATACTTGATTTGTCCCTCTTG 978 Qy 61 GCTTTTCTAAGTTTGAGCTCGTTACTGCTGCCCCACAAAGCCCCTCGAAACTTGTTCCTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 979 GCTTTTCTAAGTTTGAGCTCGTTACTGCTGCCCCACAAAGCCCCTCGAAACTTGTTCCTG 1038 Qy 121 CTCCACTCTTCCTTTTGGGCTTTTTTGTTTCCCGCTCTAGCGCTTCAATCGTGGTTATCA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1039 CTCCACTCTTCCTTTTGGGCTTTTTTGTTTCCCGCTCTAGCGCTTCAATCGTGGTTATCA 1098 Qy 181 AGCTCCAAACACTGATAGTTTAAA 204 |||||||||||||||||||||||| Db 1099 AGCTCCAAACACTGATAGTTTAAA 1122 Therefore, the plant cell of the reference application is a species which anticipates the genus of plants encompassed by the instant claims. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 79,84 and 86 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7-10 of copending Application No. 18/799,936 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other. Instant claims 79, 84 and 86 is drawn to an elite crop comprising a modification of an original approved transgenic locus, wherein the modification comprises a deletion of a segment comprising, consisting essentially of, or consisting of Agrobacterium right and/or left border sequences; wherein the transgenic locus is DAS44406-6; and wherein the left border sequence is deleted. One of ordinary skill in the art would understand that the left Agrobacterium border sequence occurs at the end of the 3’ region of the transgenic insert, at the border between the transgenic inset and the 3’ endogenous genome flanking sequence. Reference claims 7-10 are drawn to soybean plants cells, plant parts and plants comprising a DNA molecule comprising SEQ ID NO: 69. The reference application teaches that SEQ ID NO: 69 is a modification of the transgenic event locus DAS44406-6 (reference SEQ ID NO: 1, ¶0010) comprising a 114 nucleotide deletion of the 3’ junction sequence (¶0014). The DAS44406-6 transgenic event locus in described in Cui et al (US Patent No.: 9540655; 10 Jan 2017). Cui et al discloses that the border between the 5’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 1494 and 1495 and that the border between the 3’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 11774 and 11775 (see Table 7, columns 44-45). Alignment of reference SEQ ID NO: 1 and reference SEQ ID NO: 69; showing a deletion spanning 114 nucleotides from position 11727 to 11841 (relative to the numbering of SEQ ID NO: 1), which includes the border between the 3’ end of the transgenic insert and the endogenous genomic flanking sequence: Qy 11701 TTAAGTTGTCTAAGCGTCAATTTGATTTACAATTGAATATATCCTGCCCCAGCCAGCCAA 11760 ||||||||||||||||||||||||||| Db 11701 TTAAGTTGTCTAAGCGTCAATTTGATT--------------------------------- 11727 Qy 11761 CAGCTCGATTTACAGAGAACGAATGTCGTGTGATATGTGGAACAAGGCAACGACAACAAC 11820 Db 11728 ------------------------------------------------------------ 11727 Qy 11821 ATACATGAATCTCACAATAGAGTCGGGGTCGCCGAGTTGTGATGTAATCCATGGCATGGA 11880 ||||||||||||||||||||||||||||||||||||||| Db 11728 ---------------------GTCGGGGTCGCCGAGTTGTGATGTAATCCATGGCATGGA 11766 Therefore, the plant cells, parts and plants of the reference application are species which anticipate the genus of plants encompassed by the instant claims This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEKSANDAR RADOSAVLJEVIC whose telephone number is (571)272-8330. The examiner can normally be reached Monday--Friday 8-5:30. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ALEKSANDAR RADOSAVLJEVIC/Examiner, Art Unit 1662 /BRENT T PAGE/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Jan 27, 2023
Application Filed
Jan 23, 2026
Non-Final Rejection — §102, §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600977
PLANTS AND METHODS FOR PRODUCING 2-PYRONE-4, 6-DICARBOXYLIC ACID (PDC)
2y 5m to grant Granted Apr 14, 2026
Patent 12599079
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010446
2y 5m to grant Granted Apr 14, 2026
Patent 12599088
SOYBEAN CULTIVAR 24180206
2y 5m to grant Granted Apr 14, 2026
Patent 12599103
Tomato Hybrid SVTM9041 and Parents Thereof
2y 5m to grant Granted Apr 14, 2026
Patent 12588681
COMPOSITIONS, KITS AND METHODS FOR WEED CONTROL
2y 5m to grant Granted Mar 31, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
82%
Grant Probability
89%
With Interview (+7.0%)
2y 11m
Median Time to Grant
Low
PTA Risk
Based on 106 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month