Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 34-42, 50-52, 54, 56-59, 62-64 are pending.
Claims 51-52, 54, 56-59, 62-64 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention.
Claims 34-42, 50 are examined herein to the extent that they read on the elected species.
Effective Filing Date
In light of Applicant’s amendment of the claims to replace “repetitive sequence” with “non-essential DNA sequence”, the effective filing date of the instant claims is 31 July 2020.
The objections to claims 36-37 and 41 for minor informalities are withdrawn in light of Applicant’s amendment of the claims.
The rejection of claims 35 and 50 on the basis that it contains an improper Markush grouping of alternatives has been withdrawn in light of the PTAB board’s designation of Ex Parte Chowdhury as an informative decision on the issue of Markush groupings. In that decision, the Board held that a series of distinct miRNAs which shared no meaningful structural similarities were none-the-less a proper Markush grouping because they served a common function in the claimed method. Following this rationale, Examiner has withdrawn the improper Markush grouping rejection because in the instant case the recited transgenic loci share the common function of serving as a target for modification and all the loci appear to comprise the required non-essential DNA sequences, i.e. Agrobacterium borders and selectable marker genes.
The rejection of claims 35, and 39-41 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention is withdrawn in light of Applicant’s amendment of the claims.
The rejection of claims 34-42, and 50 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement withdrawn in light of Applicant’s amendment of the claims.
Claim interpretation
In light of Applicant’s amendment of the claims to limit the claims to method of modifying a transgenic locus “to generate a modified transgenic locus” and to limit the modification to modifications wherein “the remainer of the modified transgenic locus is unmodified in comparison to the original locus” Examiner has included the following claim interpretation for clarity of the record. Examiner notes that this interpretation is consistent with the interpretation of the claims set forth in the previous and current 35 U.S.C. 103 rejection.
Claim 34 is drawn to a method of modifying an original transgenic locus in a plant by deleting at least one copy a non-essential DNA sequence in the original transgenic locus with genome editing molecules to generate a modified transgenic locus, wherein the non-essential DNA sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof and wherein the remainder of the modified transgenic locus is unmodified in comparison to the original transgenic locus. Examiner interprets this method to read on a method of deleting an entire transgenic insert from a plant comprising an original transgenic locus. This interpretation is explained below.
As “comprising” is open language, the limitation encompasses deletion of a segment that must include Agrobacterium right and/or left border sequences or portions thereof, but it is not limited to a deletion which only includes Agrobacterium right and/or left border sequence or portions thereof. Therefore, the limitation would be met by a deletion of an entire transgenic insert, such as DAS44406-06, which would inherently comprise Agrobacterium right and/or left border sequences as well as other elements, such as a selectable marker gene.
Regarding the limitation “wherein the original approved transgenic locus remains present in modified form in the elite crop plant”, Applicant has provided the following definitions that are relevant to interpreting this limitation:
[0048] As used herein, an "event," "a transgenic event," "a transgenic locus" and related phrases refer to an insertion of one or more transgenes at a unique site in the genome of a plant as well as to DNA fragments, plant cells, plants, and plant parts (e.g., a seed, leaf, tuber, stem, root, or boll) comprising genomic DNA containing the transgene insertion. Such events typically comprise both a 5' and a 3' DNA junction polynucleotide and confer one or more useful traits including herbicide tolerance, insect resistance, male sterility, and the like.
[0044] As used herein, the phrases "DNA junction polynucleotide" and "junction polynucleotide" refers to a polynucleotide of about 18 to about 500 base pairs in length comprised of both endogenous chromosomal DNA of the plant genome and heterologous transgenic DNA which is inserted in the plant genome. A junction polynucleotide can thus comprise about 8, 10, 20, 50, 100, 200, or 250 base pairs of endogenous chromosomal DNA of the plant genome and about 8, 10, 20, 50, 100, 200, or 250 base pairs of heterologous transgenic DNA which span the one end of the transgene insertion site in the plant chromosomal DNA. Transgene insertion sites in chromosomes will typically contain both a 5' junction polynucleotide and a 3' junction polynucleotide. In embodiments set forth herein in SEQ ID NO: 1-34, the 5' junction polynucleotide is located at the 5' end of the sequence and the 3' junction polynucleotide is located at the 3' end of the sequence.
Taken together, Applicant’s definition of a transgenic locus encompasses junction sequences, which comprise both a portion of the transgene insert and endogenous genomic sequence, which is consistent with the art recognized definition of a transgenic event (i.e. an event comprises both a transgenic insert and a specific location within the genome). Therefore, the deletion of an entire transgene insert would result in a modified transgenic locus remaining present in modified form in the elite plant as long as some portion of the junction sequence was left behind.
For these reasons, the broadest reasonable interpretation of the method of claim 34 includes any method in which an entire transgene insert has been deleted but some of the endogenous junction sequence remains.
The dependent claims do not recite any limitations that narrow this interpretation for the same reasons as set forth above. While these claims require that the modified transgenic locus is DAS4406-6 or that the deleted segment further comprises a selectable marker gene, as explained above these claims encompass a method which deletes the transgenic insert from transgenic locus DAS4406-6.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 34-42, 50 remain rejected under 35 U.S.C. 103 as being unpatentable over Cui et al (Cui et al (US Patent No.: 9540655; 10 Jan 2017) taken with the evidence of Food Standards Australia New Zealand Application A1073 (21 June 2013; foodstandards.gov.au/food-standards-code/applications/a1073; accessed 10 January 2026), Russel et al (US Patent No.: 9,695,432 B2) and Applicant’s own disclosure. This rejection has been modified from the rejection set forth in the previous Office action in light of Applicant’s amendment of the claims. Applicant’s arguments have been full considered but are not found persuasive.
The claims are drawn to a method of modifying an original transgenic locus in a plant by deleting at least one copy of a non-essential DNA in the original transgenic locus with genome editing molecules and to generate a modified transgenic locus, wherein the non-essential DNA sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof (claim 34) and wherein the remainder of the modified transgenic locus is unmodified in comparison to the original transgenic locus; wherein the transgenic locus is DAS44406-6 (claim 35 and 50); or wherein the method comprises contacting a transgenic plant genome with one or more gene editing molecules which introduce one or more single or double-stranded breaks providing for excision of a segment of the transgenic locus comprising an Agrobacterium right and/or left border sequence or a portion thereof and wherein the contacting comprises introducing one or more compositions comprising or encoding the gene editing molecules (claim 36) and selecting pants comprising the modified transgenic locus (claim 37); or wherein a selectable marker gene is also removed with genome editing molecules (claim 38) and wherein the method comprises contacting a transgenic plant genome with one or more gene editing molecules which introduce one or more single or double-stranded breaks providing for excision of a segment comprising a selectable marker gene and selecting a plant where the selectable marker gene and the non-essential DNA sequence comprising an Agrobacterium right and/or left border sequence or a portion thereof are deleted; or wherein the selectable marker gene and the Agrobacterium right and/or left border sequence or a portion thereof are on the same segment (claim 40) or different segments (claim 41); or wherein the gene editing molecule is a zinc finger nuclease or nickase (claim 42).
Cui et al teaches transgenic soybean plants comprising event pDAB8264.44.06.1 (Abstract, column 3, lines 56-65, and generally throughout). Soybean event pDAB8264.44.06.1 is also known in the art as DAS44406-6 (instant specification, page 23, Table 2, footnote 5). Cui et teaches that event pDAB8264.44.06.1 comprises a selectable marker gene, pat (column 28, lines 8-16; Figure 1). One of ordinary skill in the art would understand that event pDAB8264.44.06.1 inherently comprises Agrobacterium left and/or right border sequences, as the presence of these sequences is a feature of Agrobacterium mediated transformation.
Cui et al teaches excision of a portion of the transgenic insert or the entire transgenic insert and/or flanking sequences of event pDAB8264.44.06.1 (column 4, lines 58-64; column 7, lines 59-63). Cui teaches that selectable markers can be excised and replaced (column 16, lines 1-8; lines 17-34). Cui et al teaches that after excision another insert can be targeted to the location of event pDAB8264.44.06.1 and that the insert of event pDAB8264.44.06.1 can be replaced in this manner (column 4, lines 58-64; column 7, lines 59-63). Cui et al teaches that transgenic excision can be accomplished with the use of zinc finger nucleases (column 16, lines 1-15). One of ordinary skill in the art would understand that zinc finger nucleases are gene editing molecules which introduce one or more double-stranded breaks in a genome providing for excision of a segment of DNA (see Russel et al, column 3, lines 22-55).
Cui et al teaches SEQ ID NO: 13, which is the sequence of pDAB8264 without the Agrobacterium T-DNA border sequences included and is 10256 nucleotides in length (see Cui et al, column 11, lines 1-7 and Table 1). Cui et al teaches that the border between the 5’ endogenous flanking sequence and the DAS44406-6 event transgenic insertion occurs between nucleotides 1494 and 1495 and that the border between the 3’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 11774 and 11775 (see example 7, columns 44-45).
Application A1073 teaches the entire structure of the T-DNA of pDAB8264 (pages 9-10, Table 1).
Applicant teaches instant SEQ ID NO: 11, which comprises the entire DAS44406-6 event, including 5’ and 3’ endogenous genomic flanking sequences (see instant specification, page 23, Table 2).
Alignment of instant SEQ ID NO: 11 and Cui et al SEQ ID NO: 13 indicates that the final 3’ nucleotide of SEQ ID NO: 13 aligns to nucleotide 11724 of instant SEQ ID NO: 11. A portion of this alignment is below:
Qy 11574 TCATTGATGCTTGGTAATAATTGTCATTAGATTGTTTTTATGCATAGATGCACTCGAAAT 11633
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10106 TCATTGATGCTTGGTAATAATTGTCATTAGATTGTTTTTATGCATAGATGCACTCGAAAT 10165
Qy 11634 CAGCCAATTTTAGACAAGTATCAAACGGATGTGACTTCAGTACATTAAAAACGTCCGCAA 11693
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10166 CAGCCAATTTTAGACAAGTATCAAACGGATGTGACTTCAGTACATTAAAAACGTCCGCAA 10225
Qy 11694 TGTGTTATTAAGTTGTCTAAGCGTCAATTTG 11724
|||||||||||||||||||||||||||||||
Db 10226 TGTGTTATTAAGTTGTCTAAGCGTCAATTTG 10256
Given that Cui et al SEQ ID NO: 13 does not include T-DNA border sequences, and taken with the evidence provided in Application A1073 that Border B comprises the first 24 nucleotides of the full length T-DNA of pDAB8264, it appears that the 3’ end of Cui et al SEQ ID NO: 13 corresponds to intervening sequence from Ti plasmid C58 (10256 + 24= 10,280; see Application A1073 Table 1, last row on page 9). Further given that the that the border between the 3’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 11774 and 11775 relative to the number of instant SEQ ID NO: 11, there are an additional 50 nucleotides in the transgenic insert of event DAS44406-6 that are not included in Cui et al SEQ ID NO: 13 (11774-11724=50). Using Table 1 provided in the Application A1073, this sequence appears to correspond to a first copy of Border A (Right border; 24 nucleotides), intervening sequence (from Ti plasmid C58, 19 nucleotides) and 7 nucleotides from another copy of Border A (Table 1, page 10, first three columns).
Thus, absent any evidence to the contrary, the totality of the evidence set forth above indicates that transgenic insert of event DAS44406-6 inherently comprises Agrobacterium right and/or left border sequence or a portion thereof.
Excising the entire insert of event DAS44406-6, as taught by Cui et al, would thus inherently delete at least one copy of a repetitive sequence in the event, wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof as well as the selectable marker gene, which in this case is pat. Such a deletion would not remove the endogenous junction sequence and would thus result in a modified transgenic locus wherein the remainder of the transgenic locus is unmodified in comparison to the original transgenic locus.
Cui et al does not teach selecting plants with a modified transgenic locus.
At the time of filing, it would be obvious to excise the DAS44406-6 transgenic event from a soybean plant comprising said DAS44406-6 transgenic event, thus obtaining a plant containing a modified transgenic locus wherein the remainder of the transgenic locus is unmodified in comparison to the original transgenic locus. One would be motivated to do so given the explicit teachings of Cui et al that plants comprising event DAS44406-6 can be modified by excising the entire insert. It would be obvious to excise said insert by contacting the genome with a gene editing molecule that introduces double-stranded breaks, such as a zing finger nuclease, give the explicit teachings of Cui et al that that transgenic excision can be accomplished with the use of zinc finger nucleases. It would be further obvious to select plants containing said modified transgenic locus, given that selecting modified or gene-edited plants after performing modification or gene-editing is routine and standard practice in the art. One would have a reasonable expectation of success given the guidance provided by Cui et al, the high skill level of a person having ordinary skill in the art, and the routine nature of editing plant genomes in the art.
Regarding the limitations drawn to the deletion of repetitive sequence in the event with genome editing molecules and wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof, either alone or as part of a deletion also comprising a selectable marker gene, as explained above excising the entire insert of event DAS44406-6, as taught by Cui et al, would inherently delete a non-essential DNA sequence comprising an Agrobacterium right and/or left border sequence or a portion thereof, as well as the selectable marker gene, which in this case is pat.
Regarding the limitations drawn to whether the selectable marker gene and the Agrobacterium right and/or left border sequence, or a portion thereof, are on the same segment or different segments, excising the entire insert of event DAS44406-6 would result in the selectable marker gene and the Agrobacterium right and/or left border sequence, or a portion thereof, occurring on the same deleted segment. Excising the marker gene and the Agrobacterium right and/or left border sequence as two different segments would be a matter of design choice. Absent any evidence to the contrary, it appears that there would be no practical effect on the outcome of the method if the elements were removed as a single segment or two different segments.
Response to Applicant’s Remarks filed 4 May 2026
Applicant argues that Examiner has failed to make a prima facie case of obviousness because the cited references fail to teach or suggest that each element of the claims, in particular the selective deletion of non-essential DNA sequences comprising Agrobacterium border sequences in a pre-existing transgenic locus, wherein the remainder of the transgenic locus is retained in a modified form (Remarks, page 19). Applicant argues that Examiner mischaracterizes the teachings of Cui et al and does not understand the scope of claim 34 because Cui et al does not teach or suggest selectively deleting a non-essential DNA sequence from within a pre-existing transgenic locus but rather teaches the wholesale excision of a transgenic insert for the purpose of replacing or retargeting the site with a different locus and because claim 34 requires modifying a transgenic event by deleting at least one copy of a non-essential DNA sequence (Remarks, page 21). Applicant continues by arguing Cui et al does not teach or suggest identifying non-essential DNA sequences and selectively targeting such sequences (Remarks, page 22). Applicant argues that the secondary references do not remedy these deficiencies because Russel does not teach or suggest selective deleting non-essential DNA sequences comprising Agrobacterium border sequences in a pre-existing transgenic locus, wherein the remainder of the transgenic locus is retained in a modified form (Remarks, page 22).
This is not found persuasive.
Regarding the scope of the claims, as set forth above in the Claim Interpretation section and the 103 rejection, when the claims are construed under the broadest reasonable interpretation they are not limited to the “selective deletion” of a non-essential DNA sequence, but rather encompass the deletion of an entire transgenic insert. Furthermore, in light of Applicant’s own definition of “transgenic locus” such a deletion that resulted in the removal of only the transgenic insert but not the endogenous junction sequence, as taught by Cui et al, would result in a modified transgenic locus wherein the non-essential DNA is deleted and the remainder of the modified transgenic locus is unmodified in comparison to the original transgenic locus. The claims as currently drafted do not require any selective identification and deletion of non-essential DNA sequences, but merely that the deletion comprises such sequences. A deletion, as taught by the cited prior art references, would meet these limitations, as well as the other required limitations, as explained in the 35 U.S.C. 103 rejection above.
Regarding the teachings of Cui et al drawn to replacement of the transgenic insert, it is not clear to the examiner how this diminishes the teachings drawn to the deletion of the insert. Cui et al provides explicit teachings drawn to the deletion of the transgenic insert by using zinc finger nucleases, which, as explained above, makes obvious the instantly claimed methods. Furthermore, even if one was motivated to do so for the purpose of replacing the insert with a different transgene in a further downstream step, it would not render irrelevant the teachings drawn to deleting the existing insert. The motivation to practice or combine the teachings of a prior art reference do not need to be same as Applicant’s motivations.
Regarding the teachings of Russel et al and Application A1073, these are not secondary references but rather evidentiary references which are relied upon to support Examiner’s assertions regarding action of zinc finger nucleases and the structure of event DAS44406-6, respectively.
For these reasons, the rejection is maintained.
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEKSANDAR RADOSAVLJEVIC whose telephone number is (571)272-8330. The examiner can normally be reached Monday--Friday 8-5:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALEKSANDAR RADOSAVLJEVIC/ Examiner, Art Unit 1662
/BRENT T PAGE/ Primary Examiner, Art Unit 1663