Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 34-42, 50-52, 54, 56-59, 62-64 are pending.
Election/Restrictions
Applicant’s election without traverse of the invention of Group 1 (claims 34-42, and 50) and the species “Agrobacterium right and/or left border” and “Das44406-6” in the reply filed on 2 September 2025 is acknowledged.
Although Applicant has elected without traverse, Applicant notes, that in light of Applicant’s amendment of the claims to limit the claimed subject matter to the species “Agrobacterium right and/or left border”, Examiner’s grounds of rejection (i.e. the teachings of De Buck et al, 2001) are no longer sufficient to support a finding of lack of unity (see Remarks filed 2 September 2025, pages 8-9, bridging paragraph). Examiner finds these arguments persuasive, however the Requirement for Restriction/Election is maintained in view of the teachings of Cui et al (Cui et al (US Patent No.: 9540655; 10 Jan 2017) taken with the evidence of Food Standards Australia New Zealand Application A1073 (21 June 2013; foodstandards.gov.au/food-standards-code/applications/a1073; accessed 10 January 2026) and Applicant’s own disclosure.
This application contains the following inventions or groups of inventions which are not so linked as to form a single general inventive concept under PCT Rule 13.1.
Group 1, claims 34-42 and 50, drawn to a method of modifying a transgenic event in a plant by deleting at least one copy of a repetitive sequence in the event with genome editing molecules, wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof.
Group 2, claims 51-52, 54, 56-59, 62-64, drawn to a transgenic plant comprising a modified transgenic event comprising a deletion of at least one copy of a repetitive sequence in the event, wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof.
The groups of inventions listed above do not relate to a single general inventive concept under PCT Rule 13.1 because, under PCT Rule 13.2, they lack the same or corresponding special technical features for the following reasons:
The groups lack unity of invention because even though the inventions of these groups require the technical feature of a transgenic plant comprising a modified transgenic event wherein the modification comprises deletion of a repetitive sequence wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof, this technical feature is not a special technical feature as it does not make a contribution over the prior art in view of Cui et al (Cui et al (US Patent No.: 9540655; 10 Jan 2017) taken with the evidence of Food Standards Australia New Zealand Application A1073 (21 June 2013; foodstandards.gov.au/food-standards-code/applications/a1073; accessed 10 January 2026; hereafter referred as Application A1073) and Applicant’s own disclosure.
Cui et al teaches transgenic soybean plants comprising event pDAB8264.44.06.1 (Abstract, column 3, lines 56-65, and generally throughout). Soybean event pDAB8264.44.06.1 is also known in the art as DAS44406-6 (instant specification, page 23, Table 2, footnote 5).
Cui et al teaches excision of a portion of the transgenic insert or the entire transgenic insert and/or flanking sequences of event pDAB8264.44.06.1 (column 4, lines 58-64; column 7, lines 59-63).
Cui et al teaches SEQ ID NO: 13, which is the sequence of pDAB8264 without the Agrobacterium T-DNA border sequences included and is 10256 nucleotides in length (see Cui et al, column 11, lines 1-7 and Table 1). Cui et al teaches that the border between the 5’ endogenous flanking sequence and the DAS44406-6 event transgenic insertion occurs between nucleotides 1494 and 1495 and that the border between the 3’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 11774 and 11775 (see example 7, columns 44-45).
Application A1073 teaches the entire structure of the T-DNA of pDAB8264 (pages 9-10, Table 1).
Applicant teaches instant SEQ ID NO: 11, which comprises the entire DAS44406-6 event, including 5’ and 3’ endogenous genomic flanking sequences (see instant specification, page 23, Table 2).
Alignment of instant SEQ ID NO: 11 and Cui et al SEQ ID NO: 13 indicates that the final 3’ nucleotide of SEQ ID NO: 13 aligns to nucleotide 11724 of instant SEQ ID NO: 11. A portion of this alignment is below:
Qy 11574 TCATTGATGCTTGGTAATAATTGTCATTAGATTGTTTTTATGCATAGATGCACTCGAAAT 11633
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10106 TCATTGATGCTTGGTAATAATTGTCATTAGATTGTTTTTATGCATAGATGCACTCGAAAT 10165
Qy 11634 CAGCCAATTTTAGACAAGTATCAAACGGATGTGACTTCAGTACATTAAAAACGTCCGCAA 11693
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10166 CAGCCAATTTTAGACAAGTATCAAACGGATGTGACTTCAGTACATTAAAAACGTCCGCAA 10225
Qy 11694 TGTGTTATTAAGTTGTCTAAGCGTCAATTTG 11724
|||||||||||||||||||||||||||||||
Db 10226 TGTGTTATTAAGTTGTCTAAGCGTCAATTTG 10256
Given that Cui et al SEQ ID NO: 13 does not include T-DNA border sequences, and taken with the evidence provided in Application A1073 that Border B comprises the first 24 nucleotides of the full length T-DNA of pDAB8264, it appears that the 3’ end of Cui et al SEQ ID NO: 13 corresponds to intervening sequence from Ti plasmid C58 (10256 + 24= 10,280; see Application A1073 Table 1, last row on page 9). Further given that the that the border between the 3’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 11774 and 11775 relative to the number of instant SEQ ID NO: 11, there are an additional 50 nucleotides in the transgenic insert of event DAS44406-6 that are not included in Cui et al SEQ ID NO: 13 (11774-11724=50). Using Table 1 provided in the Application A1073, this sequence appears to correspond to a first copy of Border A (Right border; 24 nucleotides), intervening sequence (from Ti plasmid c58, 19 nucleotides) and 7 nucleotides from another copy of Border A (Table 1, page 10, first three columns).
Thus, absent any evidence to the contrary, the totality of the evidence set forth above indicates that transgenic event DAS44406-6 inherently comprises a repetitive sequence consisting of an Agrobacterium border sequence and a portion thereof from positions 11725-11774, relative to the numbering of instant SEQ ID NO: 11.
Excising the entire insert of event DAS44406-6, as taught by Cui et al, would thus inherently delete at least one copy of a repetitive sequence in the event, wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof.
As such, the technical feature that links the groups is not special and unity of invention is lacking.
For these reasons, Requirement for Restriction/Election is maintained.
Claims 51-52, 54, 56-59, 62-64 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention.
Claims 34-42, 50 are examined herein to the extent that they read on the elected species.
Effective Filing Date
The effective filing date of the instant claims is 27 January 2023.
While the instant application (18/007,187) is a 371 of PCT/US2021/043187 (filed 26 July 2021) and claims benefit of provisional applications 63/059,813 (filed 31 July 2020), 63/059,916 (filed 31 July 2020), 63/059,963 (filed 31 July 2020), 63/199,930 (filed 3 February 2021), 63/199,949 (filed 4 February 2021), 63/199,951 (filed 4 February 2021), 63/201,029 (filed 9 April 2021), 63/201,030 (filed 9 April 2021), 63/202,569 (filed 16 June 2021), and 63/203,179 (filed 9 July 2021), none of the previously filed applications discloses a method of modifying a transgenic event in a plant by deleting at least one copy of a repetitive sequence in the event with genome editing molecules, wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof.
Therefore, the effective filing date of the instant claims is the filing date of application 18/007,187.
Claim Objections
Claim 36 objected to because of the following informalities: the claim recites a step (a) but no step (b), making the inclusion of “(a)” unnecessary.
Claim 37 objected to because of the following informalities: the claim recites a step (b) but no step (a), making the inclusion of “(b)” unnecessary.
Claim 41 objected to because of the following informalities: the claim appears to be missing a recitation of “wherein” following “The method of claim 34” in line 1.
Appropriate correction is required.
Improper Markush Grouping Rejection
Claims 35 and 50 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of the claims is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use
Claim 35 recites the Markush grouping of DP-4114, 1507, MIR604 and DAS44406-6.
Claim 50 recites the Markush grouping of: Bt11, DAS-59122-7, DP-4114, GA21, MON810, MON87411, MON87427, MON88017, MON89034, MIR604, NK603, SYN-E3272-5, 5307, DAS-40278, DP-32138, DP-33121, HCEM485, LY038, MON863, MON87403, MON832, MON87419, MON87460, MZHG0JG, MZIR098, VCO-Ø1981-5, 98140, and TC1507 (maize transgenic events); and A5547-127, DAS44406-6, DAS68416-4, DAS81419-2, GTS 40- 3-2, MON87701, MON87708, MON89788, MST-FGØ72-3, and SYHT0H2 (soybean transgenic events).
The Markush groupings of claims 34 and 50 recite alternative transgenic events. Not only do these transgenic events comprise different trait expression cassettes conferring different herbicide tolerances and/or insect resistances in different plants(see Tables 1 and 2, instant specification) but they are also located at different locations within the respective genomes. Thus, these alternatives do not share both a single structural similarity and a common use.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 35, and 39-41 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 35 recites the limitation "the approved transgenic locus" in lines 2, 3, 4 and 5. There is insufficient antecedent basis for this limitation in the claim. Claim 34, from which claim 35 depends, does not contain any limitation drawn to an “approved transgenic locus”. Thus, it is not clear to which “approved transgenic locus” claim 35 refers.
Claim 39 recites the limitation "in step (b)" in line 5. There is insufficient antecedent basis for this limitation in the claim. Claim 39 does not recite a step (a), and neither do claims 34 or 38, from which claim 39 depends. Thus, it is not clear what steps are performed before “step (b)” of claim 39.
Claim 39 recites the limitation " the segment comprising, consisting essentially of or consisting of the Agrobacterium right and/or left border sequence or portion thereof” in lines 6-8”. There is insufficient antecedent basis for this limitation in the claim. Claim 39 depends from claim 38 and, ultimately, claim 34. Neither claim 34 nor claim 38 not recite any limitations drawn to “a segment comprising, consisting essentially of or consisting of the Agrobacterium right and/or left border sequence or portion thereof”. Thus, it is not clear to which “segment” claim 39 refers.
Claim 40 recites the limitation " the segment comprising the Agrobacterium right and/or left border sequence or portion thereof" in lines 1-3 and “the segment comprising, consisting essentially of or consisting of the selectable marker gene” on lines 3-4. There is insufficient antecedent basis for this limitation in the claim. Claim 40 depends from claim 34. Claim 34 does not recite any limitations drawn to “a segment comprising the Agrobacterium right and/or left border sequence or portion thereof” nor does it recite any limitations drawn to “a segment comprising, consisting essentially of or consisting of the selectable marker gene” or any “selectable marker gene”. Thus, it is not clear to which “segments” and which “selectable marker genes” claim 40 refers.
Claim 41 recites the limitation “the segment comprising, consisting essentially of or consisting of the selectable marker gene” on lines 3-4. There is insufficient antecedent basis for this limitation in the claim. Claim 41 depends from claim 34. Claim 34 does not recite any limitations drawn to “a segment comprising, consisting essentially of or consisting of the selectable marker gene” or any “selectable marker gene”. Thus, it is not clear to which “segments” and which “selectable marker genes” claim 41 refers.
New Matter
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 34-42, and 50 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Applicant’s amendment of the claims filed 17 August 2023 added the following new limitation to independent claim 34: “comprises a fragment of a transgene, a fragment of a transgene element and/or an Agrobacterium right and/or left border sequence”. Applicant’s amendment of the claims filed 2 September 2025 narrowed the scope of the claims to recite the limitation “comprises an Agrobacterium right and/or left border sequence or a portion thereof”.
This limitation is New Matter because the instant specification fails to provide sufficient written description to support it.
Applicant describes methods of transgene modification which comprise deleting a repetitive sequence wherein the repetitive sequence is a duplicated promoter sequence, an additional copy of a transgene sequence within a transgenic event (¶0008),a cry1F fragment, incomplete sequences from the pat gene, the maize ubiquitin promoter, the mannopine synthase terminator from Agrobacterium, fragments of chloroplast DNA, sequences with similarity to retrotransposons present in the border region of the insert, and NOS terminators (¶0091). However, nowhere does applicant describe a method of modifying a transgenic event in a plant by deleting at least one copy of a repetitive sequence in the event with genome editing molecules, wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof.
The added limitation, therefore, constitutes New Matter.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 34-42, 50 are rejected under 35 U.S.C. 103 as being unpatentable over Cui et al (Cui et al (US Patent No.: 9540655; 10 Jan 2017) taken with the evidence of Food Standards Australia New Zealand Application A1073 (21 June 2013; foodstandards.gov.au/food-standards-code/applications/a1073; accessed 10 January 2026), Russel et al (US Patent No.: 9,695,432 B2) and Applicant’s own disclosure.
The claims are drawn to a method of modifying a transgenic event in a plant by deleting at least one copy of a repetitive sequence in the event with genome editing molecules and wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof (claim 34); wherein the transgenic locus is DAS44406-6 (claim 35 and 50); or wherein the method comprises contacting a transgenic plant genome with one or more gene editing molecules which introduce one or more single or double-stranded breaks providing for excision of a segment of the transgenic locus comprising an Agrobacterium right and/or left border sequence or a portion thereof and wherein the contacting comprises introducing one or more compositions comprising or encoding the gene editing molecules (claim 36) and selecting pants comprising the modified transgenic locus (claim 37); or wherein a selectable marker gene is also removed with genome editing molecules (claim 38) and wherein the method comprises contacting a transgenic plant genome with one or more gene editing molecules which introduce one or more single or double-stranded breaks providing for excision of a segment comprising a selectable marker gene and selecting a plant where the selectable marker gene and a segment comprising an Agrobacterium right and/or left border sequence or a portion thereof are deleted; or wherein the selectable marker gene and the Agrobacterium right and/or left border sequence or a portion thereof are on the same segment (claim 40) or different segments (claim 41); or wherein the gene editing molecule is a zinc finger nuclease or nickase (claim 42).
Cui et al teaches transgenic soybean plants comprising event pDAB8264.44.06.1 (Abstract, column 3, lines 56-65, and generally throughout). Soybean event pDAB8264.44.06.1 is also known in the art as DAS44406-6 (instant specification, page 23, Table 2, footnote 5). Cui et teaches that event pDAB8264.44.06.1 comprises a selectable marker gene, pat (column 28, lines 8-16; Figure 1). One of ordinary skill in the art would understand that event pDAB8264.44.06.1 inherently comprises Agrobacterium left and/or right border sequences, as the presence of these sequences is a feature of Agrobacterium mediated transformation.
Cui et al teaches excision of a portion of the transgenic insert or the entire transgenic insert and/or flanking sequences of event pDAB8264.44.06.1 (column 4, lines 58-64; column 7, lines 59-63). Cui teaches that selectable markers can be excised and replaced (column 16, lines 1-8; lines 17-34). Cui et al teaches that after excision another insert can be targeted to the location of event pDAB8264.44.06.1 and that the insert of event pDAB8264.44.06.1 can be replaced in this manner (column 4, lines 58-64; column 7, lines 59-63). Cui et al teaches that transgenic excision can be accomplished with the use of zinc finger nucleases (column 16, lines 1-15). One of ordinary skill in the art would understand that zinc finger nucleases are gene editing molecules which introduce one or more double-stranded breaks in a genome providing for excision of a segment of DNA (see Russel et al, column 3, lines 22-55).
Cui et al teaches SEQ ID NO: 13, which is the sequence of pDAB8264 without the Agrobacterium T-DNA border sequences included and is 10256 nucleotides in length (see Cui et al, column 11, lines 1-7 and Table 1). Cui et al teaches that the border between the 5’ endogenous flanking sequence and the DAS44406-6 event transgenic insertion occurs between nucleotides 1494 and 1495 and that the border between the 3’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 11774 and 11775 (see example 7, columns 44-45).
Application A1073 teaches the entire structure of the T-DNA of pDAB8264 (pages 9-10, Table 1).
Applicant teaches instant SEQ ID NO: 11, which comprises the entire DAS44406-6 event, including 5’ and 3’ endogenous genomic flanking sequences (see instant specification, page 23, Table 2).
Alignment of instant SEQ ID NO: 11 and Cui et al SEQ ID NO: 13 indicates that the final 3’ nucleotide of SEQ ID NO: 13 aligns to nucleotide 11724 of instant SEQ ID NO: 11. A portion of this alignment is below:
Qy 11574 TCATTGATGCTTGGTAATAATTGTCATTAGATTGTTTTTATGCATAGATGCACTCGAAAT 11633
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10106 TCATTGATGCTTGGTAATAATTGTCATTAGATTGTTTTTATGCATAGATGCACTCGAAAT 10165
Qy 11634 CAGCCAATTTTAGACAAGTATCAAACGGATGTGACTTCAGTACATTAAAAACGTCCGCAA 11693
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 10166 CAGCCAATTTTAGACAAGTATCAAACGGATGTGACTTCAGTACATTAAAAACGTCCGCAA 10225
Qy 11694 TGTGTTATTAAGTTGTCTAAGCGTCAATTTG 11724
|||||||||||||||||||||||||||||||
Db 10226 TGTGTTATTAAGTTGTCTAAGCGTCAATTTG 10256
Given that Cui et al SEQ ID NO: 13 does not include T-DNA border sequences, and taken with the evidence provided in Application A1073 that Border B comprises the first 24 nucleotides of the full length T-DNA of pDAB8264, it appears that the 3’ end of Cui et al SEQ ID NO: 13 corresponds to intervening sequence from Ti plasmid C58 (10256 + 24= 10,280; see Application A1073 Table 1, last row on page 9). Further given that the that the border between the 3’ endogenous flanking sequence and the transgenic insertion occurs between nucleotides 11774 and 11775 relative to the number of instant SEQ ID NO: 11, there are an additional 50 nucleotides in the transgenic insert of event DAS44406-6 that are not included in Cui et al SEQ ID NO: 13 (11774-11724=50). Using Table 1 provided in the Application A1073, this sequence appears to correspond to a first copy of Border A (Right border; 24 nucleotides), intervening sequence (from Ti plasmid C58, 19 nucleotides) and 7 nucleotides from another copy of Border A (Table 1, page 10, first three columns).
Thus, absent any evidence to the contrary, the totality of the evidence set forth above indicates that transgenic event DAS44406-6 inherently comprises a repetitive sequence consisting of an Agrobacterium border sequence and a portion thereof from positions 11725-11774, relative to the numbering of instant SEQ ID NO: 11.
Excising the entire insert of event DAS44406-6, as taught by Cui et al, would thus inherently delete at least one copy of a repetitive sequence in the event, wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof as well as the selectable marker gene, which in this case is pat.
Cui et al does not teach selecting plants with a modified transgenic locus.
At the time of filing, it would be obvious to excise the DAS44406-6 transgenic event from a soybean plant comprising said DAS44406-6 transgenic event, thus obtaining a plant containing a modified transgenic locus. One would be motivated to do so given the explicit teachings of Cui et al that plants comprising event DAS44406-6 can be modified by excising the entire insert. It would be obvious to excise said insert by contacting the genome with a gene editing molecule that introduces double-stranded breaks, such as a zing finger nuclease, give the explicit teachings of Cui et al that that transgenic excision can be accomplished with the use of zinc finger nucleases. It would be further obvious to select plants containing said modified transgenic locus, given that selecting modified or gene-edited plants after performing modification or gene-editing is routine and standard practice in the art. One would have a reasonable expectation of success given the guidance provided by Cui et al, the high skill level of a person having ordinary skill in the art, and the routine nature of editing plant genomes in the art.
Regarding the limitations drawn to the deletion of repetitive sequence in the event with genome editing molecules and wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof, either alone or as part of a deletion also comprising a selectable marker gene, as explained above excising the entire insert of event DAS44406-6, as taught by Cui et al, would inherently delete at least one copy of a repetitive sequence in the event, wherein the repetitive sequence comprises an Agrobacterium right and/or left border sequence or a portion thereof, as well as the selectable marker gene, which in this case is pat.
Regarding the limitations drawn to whether the selectable marker gene and the Agrobacterium right and/or left border sequence, or a portion thereof, are on the same segment or different segments, excising the entire insert of event DAS44406-6 would result in the selectable marker gene and the Agrobacterium right and/or left border sequence, or a portion thereof, occurring on the same deleted segment. Excising the marker gene and the Agrobacterium right and/or left border sequence as two different segments would be a matter of design choice. Absent any evidence to the contrary, it appears that there would be no practical effect on the outcome of the method if the elements were removed as a single segment or two different segments.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEKSANDAR RADOSAVLJEVIC whose telephone number is (571)272-8330. The examiner can normally be reached Monday--Friday 8-5:30.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALEKSANDAR RADOSAVLJEVIC/Examiner, Art Unit 1662
/BRENT T PAGE/Primary Examiner, Art Unit 1663