DETAILED CORRESPONDENCE
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This action is in response to the papers filed September 3, 2025. Currently, claims 1-19 are pending. Claims 6-7, 10-16, 18-19 have been withdrawn as drawn to non-elected subject matter.
Election/Restrictions
Applicant's election of Group I, claims 1-5, 8-9, 17 and SEQ ID NO: 1 in the paper filed September 3, 2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.03(a)).
Claims 1-19 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim.
The requirement is still deemed proper and is therefore made FINAL.
Priority
This application is a 371 of PCT/EP2021/071143, filed July 28, 2021 and claims priority to EPO 20188751.0, filed July 30, 2020.
Drawings
The drawings are acceptable.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609 A(1) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Pages 24-25 contains a list of references.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-4, 8-9, 17 are rejected under 35 U.S.C. 101 because the claimed invention is not directed to patent eligible subject matter. Based upon an analysis with respect to the claim as a whole, the rejected claim(s) do not recite something significantly different than a judicial exception. The rationale for this determination is explained below:
Briefly, Claims 1-4, 8-9, 17 are rejected because these claims are drawn to a nucleic acid molecule comprising SEQ ID NO: 1 or a functional fragment thereof.
Claims 1-4, 8-9, 17 are directed to nucleic acid fragments from foxo6os in the human genome, i.e. known naturally occurring nucleic acids. Such isolated nucleic acid molecules, that are identical to fragments of naturally occurring nucleic acid molecules are not patent eligible subject matter, i.e. they are judicial exceptions to patentable subject matter.
Claims 3 and 4 are directed to RNA and DNA respectively. RNA and DNA are naturally occurring nucleic acids.
Claims 8-9 are directed to nucleic acid and a pharmaceutically acceptable carrier. The inclusion of a buffer does not add any markedly different properties.
MPEP 2106.04(b)(II) discusses products of nature. The MPEP specifically discusses DNA, primers and probes. The isolated DNA of Myriad and the primers of Ambry Genetics were described as products of nature by the courts. Ass’n for Molecular Pathology v. Myriad Genetics, Inc., 133 S. Ct. 2107, 2116-17, 106 USPQ2d 1972, 1979 (2013); University of Utah Research Foundation v. Ambry Genetics, 774 F.3d 755, 758-59, 113 USPQ2d 1241, 1243 (Fed. Cir. 2014). The MPEP further states the “product of nature exceptions include both naturally occurring products and non-naturally occurring products that lack markedly different characteristics from any naturally occurring counterpart. See, e.g., Ambry Genetics, 774 F.3d at 760, 113 USPQ2d at 1244 ("Contrary to Myriad's argument, it makes no difference that the identified gene sequences are synthetically replicated. As the Supreme Court made clear, neither naturally occurring compositions of matter, nor synthetically created compositions that are structurally identical to the naturally occurring compositions, are patent eligible.").” The Federal Circuit in Ambry Genetics reviewed “[t]he Supreme Court held ineligible claims directed to segments as short as 15 nucleotides, the same length as the primer claims at issue here, suggesting that even short strands identical to those found in nature are not patent eligible. Compare ’492 patent col. 170 ll. 32–38, with ’282 patent col. 153 ll. 66–67.”
In the instant case, the claims, embrace fragments, probes and primers that are identical to naturally occurring gene fragments and clearly read on nature-based products that themselves do not exhibit markedly different characteristics from the naturally occurring gene. See e.g. Myriad in which one claim at issue was drawn to “[a]n isolated DNA having at least 15 nucleotides [an isolated DNA coding for a BRCA1 polypeptide having the amino acid sequence of SEQ ID NO: 2] (Myriad at 2113). The Court recognized that this claim, if valid, would have given Myriad exclusive right to isolate any strand of 15 or more nucleotides of an individual’s BRCA1 gene (paragraph bridging 2113 and 2114). This is directly analogous to the instant situation wherein Applicant’s claims cover probe and primer molecules that are fragments of a naturally occurring human genome sequence. The specification teaches SEQ ID NO: 1 is within AC093151.3 and ENST00000425554, naturally occurring sequences.
The Court held that “[a] naturally occurring DNA segment is a product of nature and not patent eligible merely because it has been isolated”, and that “Myriad’s claims are not saved by the fact that isolating DNA from the human genome severs the chemical bonds that bind gene molecules together” (page 2118). The Court found that while Myriad had located and sequenced an important gene, Myriad had not created anything, and that “separating that gene from its surrounding genetic material is not an act of invention” (page 2118). Consistent with the findings of the Court in Myriad, the Office finds that the primers and probe molecules embraced by the instant clams are not patent eligible compositions of matter regardless of whether or not they are isolated from the genome. The Guidelines indicate that a change in biological function or activity maybe a characteristic of an isolated product that can provide a marked difference sufficient to distinguish over a naturally occurring product. However, in this case, as in the Ambry case, the function of the nucleic acids is the same function as the relevant portion of the naturally occurring sequence. Just as in nature, primers and probes utilize the innate ability of DNA to bind to itself.
Having established that the claims include a naturally occurring product that is a judicial exception, it must now be determined whether or not the claims recite an element or combination of elements that amount to significantly more than that exception, and whether those additional elements also amount to significantly more for the other claimed exception(s), which ensures that the claim does not have a preemptive effect with respect to any of the recited exceptions. To determine whether a claim that includes a nature-based product limitation recites a “product of nature” exception, an analysis is performed in which it is first determined if a claim includes a nature-based product that has markedly different characteristics from the corresponding naturally occurring product, and if it does not, then it is determined whether or not other elements of the claim are sufficient to ensure that the claim as a whole amounts to significantly more than the exception itself (see the Interim Guidance on Patent Subject Matter Eligibility published 12/16/2014 in the Federal Register at pages 74618-74633). In order to be markedly different the claimed product must possess at least one characteristic that is different from that of the counterpart.
In the instant case, only claims 8-9 recite any additional element, i.e. buffers, reaction tubes, contains, vials. None of these limitations provides any significant addition to the judicial exceptions already claimed that would prevent the claims from having a pre-emptive effect on the use of the judicial exception. The presence of a “tube" in a composition comprising a nucleic acid is entirely conventional and does not represent a modification that amounts to something significantly more than the judicial exception.
The fact that these natural products are organized into a kit with an intended use adds nothing to the judicial exceptions that would distinguish them from the naturally occurring material.
Therefore, the claims are properly rejected under 35 USC 101 as being drawn to patent-ineligible subject matter.
Claim Rejections - 35 USC § 112-Description
The following is a quotation of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
Claims 1-5, 8-9, 17 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are broadly drawn a nucleic acid molecule comprising SEQ ID NO: 1 or a functional fragment thereof wherein a functional fragment of SEQ ID NO: 1 increases viability and/or proliferation of cardiomyocytes.
Relevant to the lack of particular structural limitations in the rejected claims drawn to nucleic acids, MPEP 2163 states:
The claimed invention as a whole may not be adequately described if the claims require an essential or critical feature which is not adequately described in the specification and which is not conventional in the art or known to one of ordinary skill in the art.
Ariad Pharmaceuticals Inc. v. Eli Lilly & Co., 94 USPQ 2d 1161 (Fed. Cir. 2010) recently re-affirmed the written description requirement. Ariad reiterates that “the hallmark of written description is disclosure" and “possession as shown in the disclosure” is a more complete formulation of the test for written description. Ariad considers situations of genus claims and states that the written description requirement ensure that "when a patent claims a genus by its function or result, the specification recites sufficient materials to accomplish that function."
Vas-Cath Inc. V. Mahurkar, 19 USPQ2b 1111, clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed”. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 USC 112 is severable from its enablement provision. In The Regents of the University of California v. Eli Lilly (43 USPQ2b 1398-1412), the court held that a generic statement which defines a genus of nucleic acids by only their functional activity does not provide an adequate written description of the genus. The court indicated that while Applicants are not required to disclose every species encompassed by a genus, the description of a genus is achieved by the recitation of a representative number of DNA molecules, usually defined by a nucleotide sequence, falling within the scope of the claimed genus. At section B(1), the court states that “An adequate written description of a DNA…’ required a precise definition, such as by structure, formula, chemical name, or physical properties’, not a mere wish or plan for obtaining the claimed chemical invention”.
In the case of the instant claims, the functionality of fragments of SEQ ID NO: 1 is a critical feature of the claimed methods. The claim requires the functional fragment of SEQ ID NO: 1 increases viability and/or proliferation of cardiomyocytes.
The specification does not teach any fragment of SEQ ID NO: 1 that increases viability and/or proliferation of cardiomyocytes. There is no guidance how many nucleotides may be removed and the fragment increases viability and/or proliferation of cardiomyocytes. There specification does not teach the regions of SEQ ID NO: 1 that are critical to the function or which sequences should be maintained to provide a function.
The general knowledge and level of skill in the art do not supplement the omitted description because specific, not general guidance is what is needed. Since the disclosure fails to describe the common attributes or characteristics that identify members of the genus, functional fragments of SEQ ID NO: 1 alone is insufficient to describe the genus. One of skill in the art would conclude that applicant was not in possession of the claimed genus because there is no description of functional fragments of SEQ ID NO: 1 increases viability and/or proliferation of cardiomyocytes.
Thus, considering the breadth of the polynucleotides required by the claimed methods, their specific required functionalities, and the teachings of the instant specification, it is the conclusion that the specification does not provide an adequate written description of the broadly claimed subject matter.
Claim Rejections - 35 USC § 112- Second Paragraph
The following is a quotation of 35 U.S.C. 112(b):
(B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1-5, 8-9, 17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claims 1-5, 8-9, 17 require the phrase "at least about". “At least about” is indefinite because the metes and bounds of the invention are not clear. As the CAFC noted, and affirmed, regarding the district court determination of this phrase in Amgen Inc. v. Chugai Pharmaceutical Co. Ltd. (CA FC) 18 USPQ2d 1016 at page 1031 "the court held the "at least about" claims to be invalid for indefiniteness." Here too, the situation is that there is close prior art, applied as a 102(b) for a lower limit value, and the claim is indefinite with regard to the values encompassed.
Regarding claim 4, the phrase "e.g" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
Claim(s) 1-5, 8-9, 17 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Firat et al. (US 2021/0189491, June 24, 2021).
Claim(s) 1-5, 8-9, 17 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Firat et al. (US 11,667,974, June 6, 2023).
Claim(s) 1-5, 8-9, 17 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Firat et al. (WO 2018/229046, December 20, 2018).
A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim.
Firat teaches diagnostic, prognostic and therapeutic uses for long noncoding RNAs for pathologies and toxicities inducing heart disorders. Firat teaches SEQ ID NO: 1320 which is 100% identical to SEQ ID NO: 1 of the instant application.
Query Match 100.0%; Score 623; Length 623;
Best Local Similarity 100.0%;
Matches 623; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCCTGCCGACCCGGGTCCGGGGGCCCAGTTGGCGCCCGGACCAGCTCTCCGGTCTGCGTC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GCCTGCCGACCCGGGTCCGGGGGCCCAGTTGGCGCCCGGACCAGCTCTCCGGTCTGCGTC 60
Qy 61 CTGTAGATGGGAAAACTGAGGCCTGAGAGGGCGCGAGGGCGGGGACGAGGCCGAGGACTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 CTGTAGATGGGAAAACTGAGGCCTGAGAGGGCGCGAGGGCGGGGACGAGGCCGAGGACTC 120
Qy 121 GGGTTCGAATCTCGAGGACGCCAGTAGCCCGCTCTGAGGCCGCGTGGGGCTGGTGGAGGA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 GGGTTCGAATCTCGAGGACGCCAGTAGCCCGCTCTGAGGCCGCGTGGGGCTGGTGGAGGA 180
Qy 181 GCCACCGGTCGGGCCCCCAAGACCGGCTGACGTGGGCCTCGCCTCGGGCGACTCCCGCCG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GCCACCGGTCGGGCCCCCAAGACCGGCTGACGTGGGCCTCGCCTCGGGCGACTCCCGCCG 240
Qy 241 GGCTAGTGGCTGGCCGTGTGGTGACCTTGGGCGAGTTACTTCGCACAGCCACCCAGGGGC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 GGCTAGTGGCTGGCCGTGTGGTGACCTTGGGCGAGTTACTTCGCACAGCCACCCAGGGGC 300
Qy 301 CTCTTCTCCAACACGATAGCACTGCACCCGGAGGGCCTTCAGACCTGAGCTGAAATCTAC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 CTCTTCTCCAACACGATAGCACTGCACCCGGAGGGCCTTCAGACCTGAGCTGAAATCTAC 360
Qy 361 ACCACCGGCTCTCTGACTATCAGGCTTTGGACTATACTTTGGGCTTTCCTGGGTCTCTTA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 ACCACCGGCTCTCTGACTATCAGGCTTTGGACTATACTTTGGGCTTTCCTGGGTCTCTTA 420
Qy 421 CCTGGCAGACAGCAGATTTTGGAACTTTTCAGCCTCCATAATCATTTCCCAGAAGAACCA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 CCTGGCAGACAGCAGATTTTGGAACTTTTCAGCCTCCATAATCATTTCCCAGAAGAACCA 480
Qy 481 CAAAGCATAAATTTCCCCAAAAGGGGAATTTTGTTGATGGCTTTAGTCTATTCCCTCCTA 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 CAAAGCATAAATTTCCCCAAAAGGGGAATTTTGTTGATGGCTTTAGTCTATTCCCTCCTA 540
Qy 541 AAAGACCAGCTACAACCAAATGAAGTGAACATAACCTCAAGGGTGTATTGTCTTCATAAT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 AAAGACCAGCTACAACCAAATGAAGTGAACATAACCTCAAGGGTGTATTGTCTTCATAAT 600
Qy 601 AAAAGATGAAGCTTAGAACTGGA 623
|||||||||||||||||||||||
Db 601 AAAAGATGAAGCTTAGAACTGGA 623
With respect to Claims 3-4, Firat teaches the sequences may be RNA or DNA (see col 7-8 of 11,667,974).
Claim(s) 1-2, 4-5, 17 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Almeida-King (Human DNA sequence from clone RP11-305B13 on chromosome 1, Accession AL606484, January 2013).
A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim.
Almeida-King teaches a Human DNA sequence from clone RP11-305B13 on chromosome 1, Accession AL606484. The sequence comprises nucleotides 1-335 of SEQ ID NO: 1, a functional fragment.
Query Match 53.8%; Score 335; Length 85553;
Best Local Similarity 100.0%;
Matches 335; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCCTGCCGACCCGGGTCCGGGGGCCCAGTTGGCGCCCGGACCAGCTCTCCGGTCTGCGTC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 77599 GCCTGCCGACCCGGGTCCGGGGGCCCAGTTGGCGCCCGGACCAGCTCTCCGGTCTGCGTC 77658
Qy 61 CTGTAGATGGGAAAACTGAGGCCTGAGAGGGCGCGAGGGCGGGGACGAGGCCGAGGACTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 77659 CTGTAGATGGGAAAACTGAGGCCTGAGAGGGCGCGAGGGCGGGGACGAGGCCGAGGACTC 77718
Qy 121 GGGTTCGAATCTCGAGGACGCCAGTAGCCCGCTCTGAGGCCGCGTGGGGCTGGTGGAGGA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 77719 GGGTTCGAATCTCGAGGACGCCAGTAGCCCGCTCTGAGGCCGCGTGGGGCTGGTGGAGGA 77778
Qy 181 GCCACCGGTCGGGCCCCCAAGACCGGCTGACGTGGGCCTCGCCTCGGGCGACTCCCGCCG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 77779 GCCACCGGTCGGGCCCCCAAGACCGGCTGACGTGGGCCTCGCCTCGGGCGACTCCCGCCG 77838
Qy 241 GGCTAGTGGCTGGCCGTGTGGTGACCTTGGGCGAGTTACTTCGCACAGCCACCCAGGGGC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 77839 GGCTAGTGGCTGGCCGTGTGGTGACCTTGGGCGAGTTACTTCGCACAGCCACCCAGGGGC 77898
Qy 301 CTCTTCTCCAACACGATAGCACTGCACCCGGAGGG 335
|||||||||||||||||||||||||||||||||||
Db 77899 CTCTTCTCCAACACGATAGCACTGCACCCGGAGGG 77933
Conclusion
No claims allowable over the art.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JEANINE ANNE GOLDBERG whose telephone number is (571)272-0743. The examiner can normally be reached Monday-Friday 6am-3:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached on (571)272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JEANINE A GOLDBERG/Primary Examiner, Art Unit 1682
March 6, 2024