Office Action Predictor
Last updated: April 15, 2026
Application No. 18/007,439

GENE CORRECTION FOR SCID-X1 IN LONG-TERM HEMATOPOIETIC STEM CELLS

Non-Final OA §103§112§DP
Filed
Jan 30, 2023
Examiner
BATES, KEENAN ALEXANDER
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Board Of Trustees Of The Leland Stanford Junior University
OA Round
1 (Non-Final)
46%
Grant Probability
Moderate
1-2
OA Rounds
3y 5m
To Grant
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allow Rate
25 granted / 54 resolved
-13.7% vs TC avg
Strong +71% interview lift
Without
With
+70.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
88 currently pending
Career history
142
Total Applications
across all art units

Statute-Specific Performance

§101
6.3%
-33.7% vs TC avg
§103
31.8%
-8.2% vs TC avg
§102
24.4%
-15.6% vs TC avg
§112
28.5%
-11.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 54 resolved cases

Office Action

§103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I (Claims 1, 3-5, 7-8, 11, 14-20, and 22; drawn to a method of genetically modifying a cell from a subject with X-linked Severe Combined Immunodeficiency) in the reply filed on November 24, 2025, is acknowledged. Claims 31, 34, 39-40, and 42 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention (Group II), there being no allowable generic or linking claim. Applicant further elected the following species: a. SEQ ID NO: 4 as the sgRNA species DETAILED ACTION The amended claims filed on August 24, 2023, have been acknowledged. Claims 2, 69-10, 12-13, 23-30, 32-33, 35-38, 41, and 43-47 were cancelled. Claims 3, 5, 7-8, 11, 14, 16-18, 20, 22, 34, 39, and 42 were amended. In light of the Applicant’s elected invention, claims 31, 34, 39-40, and 42 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claims 1, 3-5, 7-8, 11, 14-20, and 22 are pending and examined on the merits. Priority The applicant claims domestic priority from U.S. provisional application No. 63/060,586, filed on August 3, 2020. Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Claims 1, 3-5, 7-8, 11, 14-20, and 22 receive domestic benefit from U.S. provisional application No. 63/060,586, filed on August 3, 2020. Information Disclosure Statement The information disclosure statement (IDS) filed on November 25, 2025, has been considered. Claim Objections Claims 11 and 16 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. The following is a statement of reasons for the indication of allowable subject matter: The closest prior art to claim 11 is United States Patent Application No: 20190032091 (Dever) and United States Patent Application No: 20200009266 (Chan). Dever teaches a method of treating X-linked severe combined immunodeficiency by introducing a stable gene modification of a target nucleic acid via homologous recombination in a primary cell isolated from a subject for autologous transplantation (i.e. reintroduction into the subject), comprising: Introducing into the primary cell: a modified single guide RNA (sgRNA), a Cas polypeptide, and a homologous donor adeno-associated viral (AAV) vector comprising a recombinant donor template comprising two nucleotide sequences comprising two nonoverlapping, homologous portions of the target nucleic acid, wherein the nucleotide sequences are located at the 5' and 3' ends of a nucleotide sequence corresponding to the target nucleic acid to undergo homologous recombination. Dever teaches that the stable gene modification of the target nucleic acid comprises the insertion of an open reading frame (ORF) comprising a normal copy of the target nucleic acid (e.g., to knock in a wild-type cDNA of the target nucleic acid that is associated with a disease) (claims 1-2, 14, 38-39, 54, 60, and 62, paragraphs 0031-0032, 0100, 0104, 0311-0312, and 0392, and Figures 17-18). Dever does not teach a donor template comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 11. However, Chan teaches that they administered a vector encoding a codon-optimized human gamma chain receptor (also known as IL2RG) to canines with SCID-X1 (comprising a 4 base-pair null mutation on exon 1 of the IL2RG gene that results in premature termination of the protein) that successfully treated the disorder (Example 1). Chan teaches that their codon optimized IL2RG corresponds to SEQ ID NO: 1 which has a sequence 81.7% identical to SEQ ID NO: 11 of the instant application. However, the prior art does not teach a sequence that has 95% sequence identity to SEQ ID NO: 11 nor is there any teaching in the art to modify the sequence of Chan to reach the at least 95% sequence identity. Regarding claim 16, SEQ ID NO: 12 of the instant application comprises SEQ ID NO: 11. SEQ ID NO: 12 has a length of 2163 bps. The closest prior art is as discussed above. As Chan teaches a codon optimized IL2RG in SEQ ID NO: 1 which has a sequence 81.7% identical to SEQ ID NO: 11, this equates to 125 mismatches between the two sequences and would lead to a greater than 5% difference with SEQ ID NO: 12 of the instant application (109 mismatches or more fall outside of the 5% allowable difference). Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 17 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 17 recites “the method of claim 1 16”. As such, it is unclear whether claim 17 is supposed to be dependent on claim 1 or claim 16. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 3-5, 7-8, 14-15, 17-20, and 22 are rejected under 35 U.S.C. 103 as being unpatentable over United States Patent Application No: 20190032091 (Dever) and further in view of United States Patent Application No: 20200009266 (Chan). Regarding claims 1 and 22, Dever teaches a method of treating X-linked severe combined immunodeficiency by introducing a stable gene modification of a target nucleic acid via homologous recombination in a primary cell isolated from a subject for autologous transplantation (i.e. reintroduction into the subject), comprising: Introducing into the primary cell: a modified single guide RNA (sgRNA) that targets exon 1 of IL2RG comprising a first nucleotide sequence that is complementary to the target nucleic acid and a second nucleotide sequence that interacts with a CRISPR-associated protein (Cas) polypeptide; a Cas polypeptide, wherein the modified sgRNA guides the Cas polypeptide to the target nucleic acid; and a homologous donor adeno-associated viral (AAV) vector comprising a recombinant donor template comprising two nucleotide sequences comprising two nonoverlapping, homologous portions of the target nucleic acid, wherein the nucleotide sequences are located at the 5' and 3' ends of a nucleotide sequence corresponding to the target nucleic acid to undergo homologous recombination. Following genetic modification of the cell, the modified cell is administered to the subject to treat SCID-X1. Dever teaches that one of the target genes for modification is IL2RG and provides examples of targeting IL2RG using an sgRNA targeting 5'-TGGTAATGATGGCTTCAACATGG-3' (SEQ ID NO:44 of Dever) in Exon 1 of IL2RG. Dever teaches that the stable gene modification of the target nucleic acid comprises the insertion of an open reading frame (ORF) comprising a normal copy of the target nucleic acid (e.g., to knock in a wild-type cDNA of the target nucleic acid that is associated with a disease) (claims 1-2, 14, 38-39, 54, 60, and 62, paragraphs 0031-0032, 0100, 0104, 0311-0312, and 0392, and Figures 17-18). Dever does not teach a donor template comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 11. However, Chan teaches that they administered a vector encoding a codon-optimized human gamma chain receptor (also known as IL2RG) to canines with SCID-X1 (comprising a 4 base-pair null mutation on exon 1 of the IL2RG gene that results in premature termination of the protein) that successfully treated the disorder (Example 1). Chan teaches that their codon optimized IL2RG corresponds to SEQ ID NO: 1 which has a sequence 81.7% (bottom line) identical to SEQ ID NO: 11 of the instant application (upper line) as shown below: 4 TGAAACCCAGCCTGCCCTTTACTAGTCTGCTGTTTCTCCAACTCCCTCTGCTCGGGGTCG 63 ||||||| |||||||||||||| || |||||||| || || || || ||||| ||||||| 5 TGAAACCAAGCCTGCCCTTTACAAGCCTGCTGTTCCTGCAGCTGCCACTGCTGGGGGTCG 64 64 GCTTGAATACCACCATCCTCACCCCTAACGGAAACGAGGATACTACCGCCGATTTCTTTC 123 | ||||||| || ||||| || || |||||||| ||||| || || ||||||||||||| 65 GACTGAATACTACAATCCTGACACCAAACGGAAATGAGGACACCACAGCCGATTTCTTTC 124 124 TGACCACCATGCCAACCGATAGCCTGTCTGTCTCAACCCTGCCCCTGCCTGAAGTCCAGT 183 |||| |||||||| || || || ||||| || |||||||| ||||| || ||||||| 125 TGACTACCATGCCCACTGACAGTCTGTCAGTGAGCACCCTGCCACTGCCCGAGGTCCAGT 184 184 GCTTTGTCTTCAATGTGGAGTATATGAACTGCACCTGGAATAGCTCCTCTGAACCACAGC 243 |||| || || || || || ||||||||||| ||||||||||||||||||||||| |||| 185 GCTTCGTGTTTAACGTCGAATATATGAACTGTACCTGGAATAGCTCCTCTGAACCTCAGC 244 244 CCACCAACCTGACACTGCACTACTGGTATAAGAACAGCGACAATGATAAGGTGCAGAAAT 303 | || || ||||| ||||||||||||||||||||| |||||||||||||||||||||| 245 CAACAAATCTGACTCTGCACTACTGGTATAAGAACTCTGACAATGATAAGGTGCAGAAAT 304 304 GCTCCCATTATCTGTTCTCTGAGGAAATCACCAGTGGGTGTCAGCTGCAGAAGAAAGAGA 363 |||| |||||||||||| |||||||||||| || |||||||||||||||||||||| 305 GCTCACATTATCTGTTCAGCGAGGAAATCACCTCCGGCTGTCAGCTGCAGAAGAAAGAGA 364 364 TTCACCTGTACCAGACATTTGTGGTCCAGCTGCAGGACCCTCGGGAACCACGGAGACAGG 423 ||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||| 365 TTCACCTGTACCAGACATTTGTGGTCCAGCTGCAGGATCCCCGGGAACCTCGGAGACAGG 424 424 CCACTCAGATGCTGAAGCTGCAGAACCTGGTCATCCCCTGGGCTCCTGAGAATCTGACCC 483 ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| 425 CCACTCAGATGCTGAAGCTGCAGAACCTGGTCATCCCATGGGCTCCCGAGAATCTGACCC 484 484 TGCATAAACTGAGTGAGTCACAGCTGGAACTGAACTGGAACAATAGGTTCCTGAATCACT 543 ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| 485 TGCATAAACTGTCCGAGTCTCAGCTGGAACTGAACTGGAACAATAGGTTCCTGAATCACT 544 544 GTCTGGAGCATCTGGTGCAGTACCGCACAGACTGGGATCACTCATGGACTGAACAGAGCG 603 | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | 545 GCCTGGAGCATCTGGTGCAGTACCGCACAGACTGGGATCACTCTTGGACTGAACAGAGTG 604 604 TCGACTATCGACATAAGTTTAGCCTGCCATCCGTGGATGGACAGAAAAGGTACACCTTCC 663 | |||||||||||||||||||| ||||| || |||||||| |||||||||||||| ||| 605 TGGACTATCGACATAAGTTTAGTCTGCCTTCAGTGGATGGGCAGAAAAGGTACACATTCA 664 664 GGGTGCGGAGCCGGTTCAACCCACTGTGCGGATCCGCCCAGCACTGGTCTGAGTGGAGTC 723 |||| || ||||||||||||||||||||| ||||||||||||| |||||| | 665 GGGTCCGCTCTCGGTTCAACCCACTGTGCGGAAGCGCCCAGCACTGGAGCGAGTGGTCCC 724 724 ACCCCATCCATTGGGGGTCAAACACTAGCAAGGAGAATCCTTTCCTGTTTGCCCTGGAAG 783 ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| 725 ACCCCATCCATTGGGGGTCTAACACCAGCAAGGAGAATCCTTTCCTGTTTGCCCTGGAAG 784 784 CTGTGGTCATTTCCGTGGGATCTATGGGCCTGATCATTTCCCTGCTGTGCGTGTACTTCT 843 ||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||| 785 CTGTGGTCATTTCAGTGGGAAGCATGGGCCTGATCATTAGCCTGCTGTGCGTGTACTTCT 844 844 GGCTGGAGCGGACTATGCCACGAATTCCCACCCTGAAGAACCTGGAGGACCTGGTGACAG 903 ||||||||||||| ||||| |||| || || |||||||||||||||||||||||||||| 845 GGCTGGAGCGGACCATGCCTAGAATCCCAACACTGAAGAACCTGGAGGACCTGGTGACAG 904 904 AATATCACGGCAACTTCTCCGCCTGGTCAGGGGTCAGCAAAGGACTGGCAGAGTCCCTGC 963 ||||||||||||| || ||||| ||||| |||||||| ||||||||||||||| ||||| 905 AATATCACGGCAATTTTTCCGCTTGGTCTGGGGTCAGTAAAGGACTGGCAGAGAGCCTGC 964 964 AGCCTGATTACTCTGAGCGGCTGTGCCTGGTGTCCGAAATTCCCCCTAAAGGAGGGGCAC 1023 |||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||| 965 AGCCCGATTACTCCGAGCGGCTGTGCCTGGTGTCCGAAATTCCCCCTAAAGGCGGGGCAC 1024 1024 TGGGAGAAGGACCTGGAGCCTCTCCATGTAACCAGCACTCTCCTTATTGGGCTCCACCTT 1083 |||||||||| ||||| ||||| || || ||||||||||| || |||||||| ||||| | 1025 TGGGAGAAGGCCCTGGGGCCTCCCCCTGCAACCAGCACTCACCCTATTGGGCACCACCCT 1084 1084 GTTATACTCTGAAACCCGAAACCTGA 1109 |||| || |||||||||||||| | | 1085 GTTACACCCTGAAACCCGAAACTTAA 1110 It would have been obvious that this sequence could have been used as the sequence for the IL2RG gene as Dever teaches that the stable gene modification of the target nucleic acid can comprise the insertion of an open reading frame (ORF) comprising a normal copy of the target nucleic acid and the codon optimized coding sequence of Chan was previously shown to be useful in treating SCID-X1. Furthermore, the successful cloning and sequencing of a DNA encoding a known gene sequence is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Regarding the limitation, the cDNA is integrated by HDR at the sight of the cleaved IL2RG locus, such that the cDNA replaces the translational start site of the endogenous IL2RG gene and is expressed under the control of the endogenous IL2RG promoter, Dever teaches that one of the key features of precise genome editing is that endogenous promoters, regulatory elements, and enhancers can be preserved to mediate spatiotemporal gene expression and that entire open reading frames (ORFs) can be inserted at specific sites (paragraph 0290). Furthermore, Dever identifies an example where they knocked in HBB cDNA into the start codon to preserve endogenous promoter/enhancer function (paragraphs 0304-0305). Although Dever, does not teach that they did this with the IL2RG cDNA, it would have been obvious that this method of replacing the start codon could be performed with the IL2RG cDNA to maintain the endogenous promoter/enhancer function as this is an important benefit, as identified by Dever. Furthermore, the cDNA of Chan comprises an ATG start codon at the beginning of the cDNA and would be a viable option for replacing the start codon. Regarding claims 3-4, Dever, as stated supra, teaches that one of the target genes for modification is IL2RG and provides examples of targeting IL2RG using an sgRNA targeting 5'-TGGTAATGATGGCTTCAACATGG-3' (SEQ ID NO:44 of Dever) in Exon 1 of IL2RG (paragraphs 0311-0312 and 0392, and Figures 17-18). SEQ ID NO: 44 comprises a target sequence for the sgRNA that is 100% identical to SEQ ID NO: 4 of the instant application. As such, the sgRNA would be complementary to SEQ ID NO: 44. Regarding claim 5, Dever teaches that they chemically modified their sgRNA targeting IL2RG with chemically modified nucleotides at the three terminal positions at both the 5' and 3' ends. Modified nucleotides contained 2'O-Methyl 3'phosphorothioate (paragraphs 0311-0312). Regarding claim 7, Dever teaches that the Cas is a Cas9 (claim 38). Regarding claim 8, Dever teaches that the modified sgRNA and the Cas polypeptide are incubated together to form a ribonucleoprotein (RNP) complex prior to introducing into the primary cell (claim 39). Regarding claims 14-15, Dever teaches that their donor template (SEQ ID NO: 41) comprises a first homology arm that comprises a 400 nucleotide sequence that is 100% identical to the 400 nucleotide sequence of SEQ ID NO: 1 of the instant application (nucleotides 1-400 of SEQ ID NO: 41 of Dever correspond to the left homology arm (page 59) and a second homology arm that comprises a 422 nucleotide sequence that is 100% identical to the 414 nucleotide sequence of SEQ ID NO: 2 of the instant application (nucleotides 1848-2269 of SEQ ID NO: 41 of Dever correspond to the right homology arm (page 59). Regarding claim 17, this claim is interpreted to be dependent on claim 1 due to the 112b issue addressed above. Dever teaches that donor can be introduced into cells using an AAV6 vector (claim 14). Regarding claim 18, Dever teaches that the donor template can comprise a selectable marker (claim 66 and paragraph 0111). Regarding claim 19, Dever teaches that the selectable marker can be tNGFR (paragraph 0148). Regarding claim 20, Dever teaches that the primary cell can be a CD34+ HSPC (paragraphs 0229-0239, 0309-0312, and 0392). Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 3-5, 7-8, 14-15, 17-20, and 22 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 47 and 50 of copending Application No. 17/458,044 in view of United States Patent Application No: 20190032091 (Dever) and further in view of United States Patent Application No: 20200009266 (Chan). Regarding claims 1 and 22, ‘044 claims a method of treating X-Linked Severe Combined Immunodeficiency (SCID-X1) in a subject, the method comprising: contacting a cell from the subject in vitro with an effective amount of a donor polynucleotide composition comprising a nucleic acid cassette comprising: a cDNA encoding a interleukin 2 receptor gamma chain (IL2Ry) protein; and sequences flanking the cassette that are homologous to sequences flanking an integration site in the target locus; wherein the contacting occurs under conditions that are permissive for homologous recombination, wherein the target locus is an IL2Ry locus, and the cDNA integrates in frame at the endogenous IL2Ry ATG initiation codon; and transplanting the cell into the subject (claim 47). ‘044 does not claim using a sgRNA and a Cas9 for cleaving the gene in exon 1. Dever teaches a method of treating X-linked severe combined immunodeficiency by introducing a stable gene modification of a target nucleic acid via homologous recombination in a primary cell isolated from a subject for autologous transplantation (i.e. reintroduction into the subject), comprising: Introducing into the primary cell: a modified single guide RNA (sgRNA) comprising a first nucleotide sequence that is complementary to the target nucleic acid and a second nucleotide sequence that interacts with a CRISPR-associated protein (Cas) polypeptide; a Cas polypeptide (Cas9), wherein the modified sgRNA guides the Cas polypeptide to the target nucleic acid; and a homologous donor adeno-associated viral (AAV) vector comprising a recombinant donor template comprising two nucleotide sequences comprising two nonoverlapping, homologous portions of the target nucleic acid, wherein the nucleotide sequences are located at the 5' and 3' ends of a nucleotide sequence corresponding to the target nucleic acid to undergo homologous recombination. Following genetic modification of the cell, the modified cell is administered to the subject to treat SCID-X1. Dever teaches that one of the target genes for modification is IL2RG and provides examples of targeting IL2RG using an sgRNA targeting 5'-TGGTAATGATGGCTTCAACATGG-3' (SEQ ID NO:44 of Dever) in Exon 1 of IL2RG. Dever teaches that the stable gene modification of the target nucleic acid comprises the insertion of an open reading frame (ORF) comprising a normal copy of the target nucleic acid (e.g., to knock in a wild-type cDNA of the target nucleic acid that is associated with a disease) (claims 1-2, 14, 38-39, 54, 60, and 62, paragraphs 0031-0032, 0100, 0104, 0311-0312, and 0392, and Figures 17-18). Dever teaches that one of the key features of precise genome editing is that endogenous promoters, regulatory elements, and enhancers can be preserved to mediate spatiotemporal gene expression and that entire open reading frames (ORFs) can be inserted at specific sites (paragraph 0290). Furthermore, Dever identifies an example where they knocked in HBB cDNA into the start codon to preserve endogenous promoter/enhancer function (paragraphs 0304-0305). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have used a sgRNA and a Cas9 to target exon 1 of the IL2RG gene for integration of the cDNA in frame at the endogenous IL2RG ATG initiation codon in the method of ‘044 to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to use a sgRNA and a Cas9 to target exon 1 with a reasonable expectation of success because ‘044 and Dever are interested in treating SCID-X1 by knocking in a donor template and Dever has successfully reduced to practice that introducing a sgRNA and a Cas9 can target exon 1 of a gene to knockin a cDNA at the start codon which they did with the HBB gene. Therefore, it would have been obvious that a similar method of targeting exon 1 of the IL2RG gene could be used to knock in the cDNA of ‘044 at the initiation codon to maintain it in frame, preserving the endogenous promoters, regulatory elements, and enhancers to mediate spatiotemporal gene expression. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. ‘044 and Dever do not teach a donor template comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 11. However, Chan teaches that they administered a vector encoding a codon-optimized human gamma chain receptor (also known as IL2RG) to canines with SCID-X1 (comprising a 4 base-pair null mutation on exon 1 of the IL2RG gene that results in premature termination of the protein) that successfully treated the disorder (Example 1). Chan teaches that their codon optimized IL2RG corresponds to SEQ ID NO: 1 which has a sequence 81.7% identical to SEQ ID NO: 11 of the instant application (shown in the 103 rejection above). It would have been obvious that this sequence could have been used as the sequence for the IL2RG gene as ‘044 claims using a cDNA encoding a interleukin 2 receptor gamma chain (IL2Ry) protein and Dever teaches that the stable gene modification of the target nucleic acid can comprise the insertion of an open reading frame (ORF) comprising a normal copy of the target nucleic acid and the codon optimized coding sequence of Chan was previously shown to be useful in treating SCID-X1 and therefore, generates an IL2RG protein. Furthermore, the successful cloning and sequencing of a DNA encoding a known gene sequence is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. It would have been obvious that this method of replacing the start codon could be performed with the IL2RG cDNA of Chan as SEQ ID NO: 1 of Chan comprises an ATG start codon at the beginning of the cDNA and would be a viable option for replacing the start codon. Regarding claims 3-4, Dever, as stated supra, teaches that one of the target genes for modification is IL2RG and provides examples of targeting IL2RG using an sgRNA targeting 5'-TGGTAATGATGGCTTCAACATGG-3' (SEQ ID NO:44 of Dever) in Exon 1 of IL2RG (paragraphs 0311-0312 and 0392, and Figures 17-18). SEQ ID NO: 44 comprises a target sequence for the sgRNA that is 100% identical to SEQ ID NO: 4 of the instant application. As such, the sgRNA would be complementary to SEQ ID NO: 44. Regarding claim 5, ‘044 does not claim using chemically sgRNA. However, Dever teaches that they chemically modified their sgRNA targeting IL2RG with chemically modified nucleotides at the three terminal positions at both the 5' and 3' ends. Modified nucleotides contained 2'O-Methyl 3'phosphorothioate. sgRNAs containing one or more chemical modifications can increase the activity, stability, and specificity and/or decrease the toxicity of the modified sgRNA compared to a corresponding unmodified sgRNA when used for CRISPR based genome editing, e.g., homologous recombination (paragraphs 0196 and 0311-0312). Therefore, it would have been obvious to modify the sgRNA to include 2'O-Methyl 3'phosphorothioate as Dever teaches that there are clear benefits to using these chemically modified sgRNAs and successfully reduces to practice that they can be used to target exon 1 of IL2RG. Regarding claim 7, Dever, as stated supra, teaches that the Cas is a Cas9 (claim 38). Regarding claim 8, ‘044 does not claim usin RNPs. However, Dever teaches that the modified sgRNA and the Cas polypeptide are incubated together to form a ribonucleoprotein (RNP) complex prior to introducing into the primary cell (claim 39). Dever teaches that RNPs showed higher INDEL activity than delivering the Cas9 and sgRNA separately (paragraph 0293). Therefore, it would have been obvious to deliver the Cas9 and sgRNA as an RNP as this led to improved INDEL activity. Regarding claims 14-15, ‘044 is silent regarding the sequences of the homology arms. However, Dever teaches that their donor template (SEQ ID NO: 41) comprises a first homology arm that comprises a 400 nucleotide sequence that is 100% identical to the 400 nucleotide sequence of SEQ ID NO: 1 of the instant application (nucleotides 1-400 of SEQ ID NO: 41 of Dever correspond to the left homology arm (page 59) and a second homology arm that comprises a 422 nucleotide sequence that is 100% identical to the 414 nucleotide sequence of SEQ ID NO: 2 of the instant application (nucleotides 1848-2269 of SEQ ID NO: 41 of Dever correspond to the right homology arm (page 59). Furthermore, Dever teaches that these homology arms led to successful insertion of the donor DNA (paragraph 0392). It would have been obvious that these sequences could have been used as the homology arm sequences as Dever teaches identical homology arm sequnces were successful in inserting a donor DNA in exon 1 of the IL2RG gene. Furthermore, the successful cloning and sequencing of a DNA encoding a known gene sequence is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Regarding claim 17, this claim is interpreted to be dependent on claim 1 due to the 112b issue addressed above. ‘044 is silent regarding the method of introducing the donor DNA into the cell. However, Dever teaches that donor can be introduced into cells using an AAV6 vector and that this led to led to successful insertion of the donor DNA (claim 14 and paragraph 0392). Therefore, it would have been obvious to use an AAV6 vector to introduce the donor DNA to the cell as it has previously been shown to be successful in delivering and inserting the donor DNA into exon 1. Regarding claims 18-19, ‘044 does not claim including a selectable marker in the donor DNA. However, Dever teaches that the donor template can comprise a selectable marker (claim 66 and paragraph 0111). Dever teaches that the selectable marker can be tNGFR (paragraph 0148). It would have been obvious to include a selectable marker, such tNGFR in the donor template to be able to select for cells that successfully achieved insertion of the donor DNA. Regarding claim 20, ‘044 is silent regarding the cell. However, Dever teaches that the primary cell can be a CD34+ HSPC that can be used to treat SCID-X1 (paragraphs 0229-0239, 0309-0312, and 0392). Therefore, it would have been obvious that the modified cell could be a CD34+ HSPC as this was a known option. This is a provisional nonstatutory double patenting rejection. Claims 1, 3-5, 7-8, 14-15, 17-20, and 22 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-4 and 10-25 of copending Application No. 18/074,781 in view of United States Patent Application No: 20190032091 (Dever) and further in view of United States Patent Application No: 20200009266 (Chan). Regarding claims 1, 5, 7-8, 17, 20, and 22, ‘781 claims a method of stably integrating a polynucleotide sequence into a genome of one or more primary cells of a population of primary cells via homologous recombination, the method comprising introducing into the one or more primary cells: (a) a modified single guide RNA (sgRNA) comprising a first nucleotide sequence that is complementary to a target nucleic acid sequence in the genome of the one or more primary cells and a second nucleotide sequence that interacts with a CRISPR-associated Cas polypeptide, wherein the first nucleotide sequence, the second nucleotide sequence, or both comprise a 2'-0- methyl 3'-phosphorothioate nucleotide; (b) the Cas polypeptide (Cas9), wherein the modified sgRNA and the Cas polypeptide are formed in a ribonucleoprotein (RNP) complex prior to introducing into the one or more primary cells, wherein the modified sgRNA guides the Cas polypeptide to the target nucleic acid sequence; and (c) a recombinant adeno associated viral vector, serotype 6 (rAAV6) comprising the polynucleotide sequence wherein the polynucleotide sequence in the rAAV6 comprises two nucleotide sequences comprising two non-overlapping, homologous portions of the target nucleic acid, wherein the nucleotide sequences are located at the 5' and 3' ends of a nucleotide sequence corresponding to the target nucleic acid to undergo homologous recombination, wherein the Cas polypeptide cleaves the target nucleic acid sequence, thereby generating a double- strand break in the target nucleic acid sequence; and wherein the polynucleotide sequence is stably integrated into the target nucleic acid sequence in the genome of the primary cells, wherein integration of the polynucleotide sequence corrects a mutation in the target nucleic acid sequence that is associated with a disease. ‘781 claims that the primary cell can be a hematopoietic progenitor cell or hematopoietic stem cell (both of which are known to include CD34+ cells) (claims 1, 11-13, 16, and 25). ‘781 does not identify a specific sequence to integrate into the primary cell. Dever teaches a method of treating X-linked severe combined immunodeficiency by introducing a stable gene modification of a target nucleic acid via homologous recombination in a primary cell isolated from a subject for autologous transplantation (i.e. reintroduction into the subject), comprising: Introducing into the primary cell: a modified single guide RNA (sgRNA) comprising a first nucleotide sequence that is complementary to the target nucleic acid and a second nucleotide sequence that interacts with a CRISPR-associated protein (Cas) polypeptide; a Cas polypeptide (Cas9), wherein the modified sgRNA guides the Cas polypeptide to the target nucleic acid; and a homologous donor adeno-associated viral (AAV) vector comprising a recombinant donor template comprising two nucleotide sequences comprising two nonoverlapping, homologous portions of the target nucleic acid, wherein the nucleotide sequences are located at the 5' and 3' ends of a nucleotide sequence corresponding to the target nucleic acid to undergo homologous recombination. Following genetic modification of the cell, the modified cell is administered to the subject to treat SCID-X1. Dever teaches that one of the target genes for modification is IL2RG and provides examples of targeting IL2RG using an sgRNA targeting 5'-TGGTAATGATGGCTTCAACATGG-3' (SEQ ID NO:44 of Dever) in Exon 1 of IL2RG. Dever teaches that the stable gene modification of the target nucleic acid comprises the insertion of an open reading frame (ORF) comprising a normal copy of the target nucleic acid (e.g., to knock in a wild-type cDNA of the target nucleic acid that is associated with a disease) (claims 1-2, 14, 38-39, 54, 60, and 62, paragraphs 0031-0032, 0100, 0104, 0311-0312, and 0392, and Figures 17-18). Dever teaches that one of the key features of precise genome editing is that endogenous promoters, regulatory elements, and enhancers can be preserved to mediate spatiotemporal gene expression and that entire open reading frames (ORFs) can be inserted at specific sites (paragraph 0290). Furthermore, Dever identifies an example where they knocked in HBB cDNA into the start codon to preserve endogenous promoter/enhancer function (paragraphs 0304-0305). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the method of ‘781 with the method of treating SCID-X1 of Dever to target exon 1 of the IL2RG gene for integration of the cDNA in frame at the endogenous IL2RG ATG initiation codon to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because ‘781 and Dever are interested in treating a disease causing mutation by knocking in a donor template and Dever has successfully reduced to practice that introducing a sgRNA and a Cas9 can target exon 1 of a gene to knockin a cDNA at the start codon which they did with the HBB gene. Therefore, it would have been obvious that a similar method of targeting exon 1 of the IL2RG gene could be used to knock in the donor of ‘781 at the initiation codon to maintain it in frame, preserving the endogenous promoters, regulatory elements, and enhancers to mediate spatiotemporal gene expression. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. ‘781 and Dever do not teach a donor template comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 11. However, Chan teaches that they administered a vector encoding a codon-optimized human gamma chain receptor (also known as IL2RG) to canines with SCID-X1 (comprising a 4 base-pair null mutation on exon 1 of the IL2RG gene that results in premature termination of the protein) that successfully treated the disorder (Example 1). Chan teaches that their codon optimized IL2RG corresponds to SEQ ID NO: 1 which has a sequence 81.7% identical to SEQ ID NO: 11 of the instant application (shown in the 103 rejection above). It would have been obvious that this sequence could have been used as the sequence for the IL2RG gene as ‘781 claims using a cDNA encoding a interleukin 2 receptor gamma chain (IL2Ry) protein and Dever teaches that the stable gene modification of the target nucleic acid can comprise the insertion of an open reading frame (ORF) comprising a normal copy of the target nucleic acid and the codon optimized coding sequence of Chan was previously shown to be useful in treating SCID-X1 and therefore, generates an IL2RG protein. Furthermore, the successful cloning and sequencing of a DNA encoding a known gene sequence is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. It would have been obvious that this method of replacing the start codon could be performed with the IL2RG cDNA of Chan as SEQ ID NO: 1 of Chan comprises an ATG start codon at the beginning of the cDNA and would be a viable option for replacing the start codon. Regarding claims 3-4, Dever, as stated supra, teaches that one of the target genes for modification is IL2RG and provides examples of targeting IL2RG using an sgRNA targeting 5'-TGGTAATGATGGCTTCAACATGG-3' (SEQ ID NO:44 of Dever) in Exon 1 of IL2RG (paragraphs 0311-0312 and 0392, and Figures 17-18). SEQ ID NO: 44 comprises a target sequence for the sgRNA that is 100% identical to SEQ ID NO: 4 of the instant application. As such, the sgRNA would be complementary to SEQ ID NO: 44. Regarding claims 14-15, ‘781 is silent regarding the sequences of the homology arms. However, Dever teaches that their donor template (SEQ ID NO: 41) comprises a first homology arm that comprises a 400 nucleotide sequence that is 100% identical to the 400 nucleotide sequence of SEQ ID NO: 1 of the instant application (nucleotides 1-400 of SEQ ID NO: 41 of Dever correspond to the left homology arm (page 59) and a second homology arm that comprises a 422 nucleotide sequence that is 100% identical to the 414 nucleotide sequence of SEQ ID NO: 2 of the instant application (nucleotides 1848-2269 of SEQ ID NO: 41 of Dever correspond to the right homology arm (page 59). Furthermore, Dever teaches that these homology arms led to successful insertion of the donor DNA (paragraph 0392). It would have been obvious that these sequences could have been used as the homology arm sequences as Dever teaches identical homology arm sequnces were successful in inserting a donor DNA in exon 1 of the IL2RG gene. Furthermore, the successful cloning and sequencing of a DNA encoding a known gene sequence is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Regarding claims 18-19, ‘781 does not claim including a selectable marker in the donor DNA. However, Dever teaches that the donor template can comprise a selectable marker (claim 66 and paragraph 0111). Dever teaches that the selectable marker can be tNGFR (paragraph 0148). It would have been obvious to include a selectable marker, such tNGFR in the donor template to be able to select for cells that successfully achieved insertion of the donor DNA. This is a provisional nonstatutory double patenting rejection. Claims 1, 3-5, 7-8, 14-15, 17-20, and 22 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-17 of U.S. Patent No. 11193141 in view of United States Patent Application No: 20190032091 (Dever) and further in view of United States Patent Application No: 20200009266 (Chan). Regarding claims 1, 5, 7-8, 17, and 22, ‘141 claims a method for producing a stable integration of a polynucleotide into a genome of one or more primary cells of a population of primary cells via homologous recombination, the method comprising: introducing into the one or more primary cells: (a) a modified single guide RNA (sgRNA) comprising a first nucleotide sequence that is complementary to a target nucleic acid sequence in the genome of the one or more primary cells and a second nucleotide sequence that interacts with a CRISPR-associated Cas polypeptide, wherein the first nucleotide sequence, the second nucleotide sequence, or both comprise a modified nucleotide, such as a 2′-O-methyl 3′-phosphorothioate nucleotide; (b) the Cas polypeptide, an mRNA encoding the Cas polypeptide, or a recombinant expression vector comprising a nucleotide sequence encoding the Cas polypeptide, such as Cas9, wherein the modified sgRNA guides the Cas polypeptide to the target nucleic acid sequence; and (c) an adeno-associated viral (AAV), such as AAV6, vector comprising the polynucleotide, wherein the Cas polypeptide cleaves the target nucleic acid sequence, thereby generating a double-strand break in the target nucleic acid sequence, wherein the polynucleotide is integrated into the double-strand break in the target nucleic acid sequence, thereby producing the stable integration of the polynucleotide into the genome of the one or more primary cells; wherein the modified sgRNA and the Cas polypeptide are incubated together to form a ribonucleoprotein (RNP) complex prior to introducing into the one or more primary cells (claims 1, 3-4, 8-9, and 12). ‘141 does not identify a specific sequence to integrate into the primary cell. Dever teaches a method of treating X-linked severe combined immunodeficiency by introducing a stable gene modification of a target nucleic acid via homologous recombination in a primary cell isolated from a subject for autologous transplantation (i.e. reintroduction into the subject), comprising: Introducing into the primary cell: a modified single guide RNA (sgRNA) comprising a first nucleotide sequence that is complementary to the target nucleic acid and a second nucleotide sequence that interacts with a CRISPR-associated protein (Cas) polypeptide; a Cas polypeptide (Cas9), wherein the modified sgRNA guides the Cas polypeptide to the target nucleic acid; and a homologous donor adeno-associated viral (AAV) vector comprising a recombinant donor template comprising two nucleotide sequences comprising two nonoverlapping, homologous portions of the target nucleic acid, wherein the nucleotide sequences are located at the 5' and 3' ends of a nucleotide sequence corresponding to the target nucleic acid to undergo homologous recombination. Following genetic modification of the cell, the modified cell is administered to the subject to treat SCID-X1. Dever teaches that one of the target genes for modification is IL2RG and provides examples of targeting IL2RG using an sgRNA targeting 5'-TGGTAATGATGGCTTCAACATGG-3' (SEQ ID NO:44 of Dever) in Exon 1 of IL2RG. Dever teaches that the stable gene modification of the target nucleic acid comprises the insertion of an open reading frame (ORF) comprising a normal copy of the target nucleic acid (e.g., to knock in a wild-type cDNA of the target nucleic acid that is associated with a disease) (claims 1-2, 14, 38-39, 54, 60, and 62, paragraphs 0031-0032, 0100, 0104, 0311-0312, and 0392, and Figures 17-18). Dever teaches that one of the key features of precise genome editing is that endogenous promoters, regulatory elements, and enhancers can be preserved to mediate spatiotemporal gene expression and that entire open reading frames (ORFs) can be inserted at specific sites (paragraph 0290). Furthermore, Dever identifies an example where they knocked in HBB cDNA into the start codon to preserve endogenous promoter/enhancer function (paragraphs 0304-0305). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the method of ‘141 with the method of treating SCID-X1 of Dever to target exon 1 of the IL2RG gene for integration of the cDNA in frame at the endogenous IL2RG ATG initiation codon to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because ‘141 and Dever are interested in knocking in a donor template to a primary cell and Dever has successfully reduced to practice that introducing a sgRNA and a Cas9 can target exon 1 of a gene to knockin a cDNA at the start codon which they did with the HBB gene. Therefore, it would have been obvious that a similar method of targeting exon 1 of the IL2RG gene could be used to knock in the donor of ‘141 at the initiation codon to maintain it in frame, preserving the endogenous promoters, regulatory elements, and enhancers to mediate spatiotemporal gene expression. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. ‘141 and Dever do not teach a donor template comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 11. However, Chan teaches that they administered a vector encoding a codon-optimized human gamma chain receptor (also known as IL2RG) to canines with SCID-X1 (comprising a 4 base-pair null mutation on exon 1 of the IL2RG gene that results in premature termination of the protein) that successfully treated the disorder (Example 1). Chan teaches that their codon optimized IL2RG corresponds to SEQ ID NO: 1 which has a sequence 81.7% identical to SEQ ID NO: 11 of the instant application (shown in the 103 rejection above). It would have been obvious that this sequence could have been used as the sequence for the IL2RG gene as ‘141 claims using a cDNA encoding a interleukin 2 receptor gamma chain (IL2Ry) protein and Dever teaches that the stable gene modification of the target nucleic acid can comprise the insertion of an open reading frame (ORF) comprising a normal copy of the target nucleic acid and the codon optimized coding sequence of Chan was previously shown to be useful in treating SCID-X1 and therefore, generates an IL2RG protein. Furthermore, the successful cloning and sequencing of a DNA encoding a known gene sequence is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. It would have been obvious that this method of replacing the start codon could be performed with the IL2RG cDNA of Chan as SEQ ID NO: 1 of Chan comprises an ATG start codon at the beginning of the cDNA and would be a viable option for replacing the start codon. Regarding claims 3-4, Dever, as stated supra, teaches that one of the target genes for modification is IL2RG and provides examples of targeting IL2RG using an sgRNA targeting 5'-TGGTAATGATGGCTTCAACATGG-3' (SEQ ID NO:44 of Dever) in Exon 1 of IL2RG (paragraphs 0311-0312 and 0392, and Figures 17-18). SEQ ID NO: 44 comprises a target sequence for the sgRNA that is 100% identical to SEQ ID NO: 4 of the instant application. As such, the sgRNA would be complementary to SEQ ID NO: 44. Regarding claims 14-15, ‘141 is silent regarding the sequences of the homology arms. However, Dever teaches that their donor template (SEQ ID NO: 41) comprises a first homology arm that comprises a 400 nucleotide sequence that is 100% identical to the 400 nucleotide sequence of SEQ ID NO: 1 of the instant application (nucleotides 1-400 of SEQ ID NO: 41 of Dever correspond to the left homology arm (page 59) and a second homology arm that comprises a 422 nucleotide sequence that is 100% identical to the 414 nucleotide sequence of SEQ ID NO: 2 of the instant application (nucleotides 1848-2269 of SEQ ID NO: 41 of Dever correspond to the right homology arm (page 59). Furthermore, Dever teaches that these homology arms led to successful insertion of the donor DNA (paragraph 0392). It would have been obvious that these sequences could have been used as the homology arm sequences as Dever teaches identical homology arm sequnces were successful in inserting a donor DNA in exon 1 of the IL2RG gene. Furthermore, the successful cloning and sequencing of a DNA encoding a known gene sequence is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Regarding claims 18-19, ‘781 does not claim including a selectable marker in the donor DNA. However, Dever teaches that the donor template can comprise a selectable marker (claim 66 and paragraph 0111). Dever teaches that the selectable marker can be tNGFR (paragraph 0148). It would have been obvious to include a selectable marker, such tNGFR in the donor template to be able to select for cells that successfully achieved insertion of the donor DNA. Regarding claim 20, ‘044 is silent regarding the cell. However, Dever teaches that the primary cell can be a CD34+ HSPC that can be used to treat SCID-X1 (paragraphs 0229-0239, 0309-0312, and 0392). Therefore, it would have been obvious that the modified cell could be a CD34+ HSPC as this was a known option. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEENAN A BATES whose telephone number is (571)270-0727. The examiner can normally be reached M-F 7:30-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Doug Schultz can be reached at (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEENAN A BATES/Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Jan 30, 2023
Application Filed
Jan 14, 2026
Non-Final Rejection — §103, §112, §DP
Mar 25, 2026
Response Filed

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12545900
CGAS/DNCV-LIKE NUCLEOTIDYLTRANSFERASES AND USES THEREOF
2y 5m to grant Granted Feb 10, 2026
Patent 12516292
METHODS OF PRODUCING MODIFIED NATURAL KILLER CELLS AND METHODS OF USE
2y 5m to grant Granted Jan 06, 2026
Patent 12503693
INTEGRATED SYSTEM FOR LIBRARY CONSTRUCTION, AFFINITY BINDER SCREENING AND EXPRESSION THEREOF
2y 5m to grant Granted Dec 23, 2025
Patent 12502418
METHOD FOR TREATING MUSCULAR DYSTROPHY BY TARGETING LAMA1 GENE
2y 5m to grant Granted Dec 23, 2025
Patent 12491223
A METHOD FOR TREATING AN AUDITORY NEUROPATHY SPECTRUM DISORDER
2y 5m to grant Granted Dec 09, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+70.8%)
3y 5m
Median Time to Grant
Low
PTA Risk
Based on 54 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in for Full Analysis

Enter your email to receive a magic link. No password needed.

Free tier: 3 strategy analyses per month