DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Drawings
The drawings were received on 2/24/26. These drawings are acceptable.
Specification
The amendment to the specification filed on 2/24/26 and 3/10/26 has been entered.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.821 - 1.825. This application contains a “Sequence Listing” as a PDF file (37 CFR 1.821(c)(2)) or as physical sheets of paper (37 CFR 1.821(c)(3)). A copy of the "Sequence Listing" in computer readable form (CRF) has been submitted; however, the content of the CRF does not comply with one or more of the requirements of 37 CFR 1.822 through 1.824, as indicated in the "Error Report" that indicates the "Sequence Listing" could not be accepted. Refer to attachment or document "Computer Readable Form (CRF) for Sequence Listing – Defective" dated 3/10/26.
Required response – Applicant must provide:
A replacement "Sequence Listing" part of the disclosure, as described above in item 1); together with
An amendment specifically directing its entry into the application in accordance with 37 CFR 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter as required by 37 CFR 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the replacement "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter and
An amendment to the specification to remove the “Sequence Listing previously submitted as a PDF file (37 CFR 1.821(c)(2)) or as physical sheets of paper (37 CFR 1.821(c)(3))
If the replacement "Sequence Listing" part of the disclosure is submitted according to item 1) c) or d) above, Applicant must also provide:
A CRF in accordance with 1.821(e)(1) or 1.821(e)(2) as required by 37 CFR 1.825(b)(6)(ii); and
Statement according to item 2) a) or b) above.
Response to Arguments
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Applicant’s arguments, see pages 11-14, filed 2/24/26, with respect to the rejection(s) of claim(s) 1-4, 6, 8, 9, 10, 13, 14, 20, 23, and 25-31 under 102 and 103 as being taught or suggested based on the primary references; Agilent (US 20170355985 and WO2017040511) have been fully considered and are persuasive. Therefore, the rejection has been withdrawn because of the amendment to claim 1 to require that the RNA scaffold has a RNA motif that recruits a non-nuclease effector module; a crRNA having a guide RNA sequence ; and a 2’-O-methyl phosphorothioate modification on at least one 5’ nucleotide and at least one 3’ nucleotide of the RNA scaffold sequence. However, upon further consideration, a new ground(s) of rejection is made in view of the amendment to claim 1 and the addition of new claims 34-36.
Applicant’s arguments, see page 15, filed 2/24/26, with respect to provisional NSDP over claims from co-pending application no. 18011311 have been fully considered and are persuasive. The rejection of claims 1, 2, 4, 6, 8, 13, 25-31 has been withdrawn because of the amendment to claim 1 to require that the RNA scaffold has a RNA motif that recruits a non-nuclease effector module; a crRNA having a guide RNA sequence ; and a 2’-O-methyl phosphorothioate modification on at least one 5’ nucleotide and at least one 3’ nucleotide of the RNA scaffold sequence. .
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 28-31 and 36 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 28 recites the limitation "the effector module" in line 1. There is insufficient antecedent basis for this limitation in the claim. Claim 28 depends on Claim 1, which recites “a non-nuclease effector module”. Claims 29-31 are also rejected because they depend on claim 28.
Claim 29 is rejected on the basis that it contains an improper Markush grouping because the markush group requires a material selected from an open list of alternatives and it is unclear what other alternatives are intended to be encompassed by the claim. See MPEP 2173.05(h). For example, the terms particulates and molecules and nanoparticles are broader than reporters, tags, proteins, and enzymes also listed in the group and it is unclear what elements are encompassed by these terms.
Claim 36 recites the limitation "the DNA modification enzyme" in line 1. There is insufficient antecedent basis for this limitation in the claim. It appears that the claim should be dependent on claim 31.
Claim Interpretation
The broadest reasonable interpretation (BRI) of the amended claimed product embraces an RNA sequence comprising three items: a) a tracrRNA; b) an RNA sequence having an extension sequence, wherein the RNA sequence recruits a non-nuclease sequence; c) a crRNA comprising a guide RNA sequence; and further comprising a 2’-O-methyl phosphorothioate modification on at least one 5’ nucleotide and at least one 3’ nucleotides of the RNA sequence.
The modifications are very broad because the claim does not define what 5’ or 3’ nucleotide is being referred to for each modifications. In view of the BRI, the modification can be at the 5’ and 3’ ends of the RNA sequence or a 5’ or 3’ of any item a)-c) or any ribonucleotide on the 5’ half or 3’ half of the RNA sequence.
The RNA sequence can be a MS2 aptamer (see dependent claim 23).
Independent claim 1 does not limit the orientation of the three items a), b), and c), but dependent claim 4 (and claims 27-31) does limit the orientation of the three sequences, wherein b) is linked to the 3’ end of c). Other than these claims, the three items can be any orientation. A person of skill in the art would possess the knowledge that the claimed invention reads on a single guide RNA (sgRNA), where the crRNA is 5’ to the 3’ tracrRNA and the sequences are linked and an aptamer is linked to the 3’ end of the tracrRNA.
New claims 33 and 34 further limit the position of the modifications.
Amended claim 27 and claims 28-31 depend on claim 1 and are ‘wherein clauses’ for the RNA motif in item b). Claim 28 now requires that the RNA motif recruit an effector module that has an RNA binding domain capable of binding to the RNA motif and an effector domain. Claim 30 depends on claim 28 and now requires that the effector domain is a DNA modification enzyme. Claim 31 depends on claim 30 and further limits to the enzyme to a specific DNA modification enzyme. Claim 36 depends on claim 1, but should be dependent on claim 31 because the claim defines the DNA modification enzyme as a deaminase.
Claim 29 indicates that the RNA motif can be any molecule, including but not limited to reporters, tags, protein, enzyme, particulates and nanoparticles.
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1, 4, 6, 13, 14, 20, 23, 25-29, and 34-35 are rejected under 35 U.S.C. 103 as being unpatentable over Hendel et al. (Nature Biotechnology 33, pages 985-989 and online methods, 2015) taken with Zalatan et al. (Cell 160, 339-350, 2015 and Supplemental Tables and Experimental Procedures, pages 1-12).
Hendel teaches chemically modified sgRNA for enhance genome editing in human primary cells, wherein the sgRNA comprises 2’-O-methyl phosphorothioates (MS) at the 5’ and 3’ end of the sgRNA. “Chemically synthesized and modified sgRNAs offer advantages over expressed or in vitro transcribed sgRNAs, including (i) increased efficacy, (ii) robust and scalable production of highly pure sgRNAs for biotechnological and therapeutic applications, (iii) greater flexibility in the sgRNA design in contrast to constraints on the first transcribed nucleotides imposed by the U6 or T7 promoters typically used for plasmid expression or in vitro transcription of sgRNAs, respectively, and (iv) enabling of a highly active RNA-only or RNP CRISPR platform with lower cytotoxicity in primary cells than DNA plasmid-based systems (page 989).”
See pages 985-98, figure 1a (below)
PNG
media_image1.png
200
313
media_image1.png
Greyscale
Hendel does not specifically the sgRNA further comprising an RNA motif with an extension sequence, wherein the RNA motif recruits a non-nuclease effector module.
However, Zalatan teaches RNA scaffolds for use in enabling transcription programs and simultaneous activation and repression (pages 339-350). Linker between the sgRNA and RNA motif recruiting at least one non-nuclease effects (e.g., MS2 aptamer) was studied (pages 341-343 and 349). A single hairpin domain was added to the 3’ end of the sgRNA connected by a two base linker. MS2, PP7, and com were used as RNA recruitment modules. The linker reads on the extension sequence in item b) recited in instant claim 1.
PNG
media_image2.png
259
339
media_image2.png
Greyscale
Zalatan also teaches prior art showing that a sgRNA extended with MS2 hairpins can recruit activators to a reporter gene in human cells (page 341). Zalatan further discloses RNA binding modules for scRNA constructs (see pages 1-12, supplemental tables and extended experimental procedures). These constructs would read on the limitation of instant claim 20, because Zalatan teaches a 2 nucleotide extension with a RNA binding modules of 20-45 nucleotides in length.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to modify the chemically modified sgRNA of Hendel with the scaffold RNA taught by Zalatan, namely to arrive at the claimed invention. See MPEP 2431(I)(C)-(E). One of ordinary skill in the art would have been motivated to combine the teaching to allow regulation of targeted sequences and allow simultaneous activation and repression as taught by Zalatan. The linker taught by Zalatan reads on the extension sequence in item b) recited in instant claim 1. Zalatan teaches the RNA motif is linked to the 3’ of the tracrRNA via a linker (single stranded nucleotide sequence). The sgRNA would read on the fusion between crRNA and gRNA. Zalatan teaches using one or more RNA motifs (e.g., MS2 aptamer, Figure 2). sgRNA sequences were extended to include hairpin sequences for MS2 (C5 variant) (page 349). Figure 1A of Hendel makes obvious the location of the chemical modification in instant claims 1 and 34 and the last nucleotide of the 3’ end of the sgRNA is unmodified.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 8-9 are rejected under 35 U.S.C. 103 as being unpatentable over Hendel et al. (Nature Biotechnology 33, pages 985-989 and online methods, 2015) taken with Zalatan et al. (Cell 160, 339-350, 2015) as applied to claims 1, 4, 6, 13, 20, 23, 25-29, and 34-35 above, and further in view of Zhang et al. (US 20180312824, of record).
Hendel and Zalatan do not specifically teach the tracrRNA hybridizing to the crRNA via a repeat anti-repeat region.
However, Zhang teaches sgRNA comprises a repeat anti-repeat region connecting the crRNA to tracrRNA (fig 1b).
PNG
media_image3.png
223
286
media_image3.png
Greyscale
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Hendel and Zalatan taken with Zhang to show that sgRNA comprises a repeat/anti-repeat to connect the crRNA to the tracrRNA, namely to arrive at the claimed invention. See also MPEP 2141 II.C. Rationales to support rejections under 35 U.S.C. 103 recites, “Prior art is not limited to the references being applied, but includes the understanding of one of ordinary skill in the art.”
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 10 is rejected under 35 U.S.C. 103 as being unpatentable over Hendel et al. (Nature Biotechnology 33, pages 985-989 and online methods, 2015) and Zalatan et al. (Cell 160, 339-350, 2015) taken with Zhang (‘824) as applied to claims 8 and 9 above, and further in view of Zhong (WO 2021034373, EFD 8/19/19, of record).
Hendel, Zalatan and Zhang do not specifically teach the tracrRNA hybridizing to the crRNA via a repeat anti-repeat region, wherein the repeat anti-repeat region has an upper stem that is extended by a total length of 20-26 nucleotides.
However, Zhong teaches conjugates of gRNA-Cas protein complex (abstract and pages 2-5, 15, 23-34, 42-58 and Figure 4). The conjugate(s) comprises a gRNA-Cas protein (RNP) complex and one or more molecules selected from the group comprising PEG, non-PEG polymers, ligands for cellular receptors, lipids, oligonucleotides, antibodies, polysaccharides and peptides and chemically linked to Cas protein and/or guide RNA(s) (page 3). The conjugates are useful in improving preciseness in gene editing by driving templated DNA repair, in decreasing or preventing host immunity to guide RNA(s)-Cas protein complexes by masking epitopes and chemical modifications of guide RNA(s) and also improving the non-viral delivery of RNP complexes (page 4). The guide RNA is a chemically modified crRNA and tracrRNA, a sgRNA (page 4).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Hendel, Zalatan, and Zhang taken with Zhong to make the repeat anti-repeat region have an upper stem of a length of 20-26 nucleotides, namely to arrive at the claimed invention. See MPEP 2143(I)F. One of ordinary skill in the art would have been motivated to combine the teaching to try the gRNA-Cas protein complex taught by '373 (pages 23-33) having an upper stem that is extended comprising a total length of 20-26 nucleotides to study the efficiency of gene editing.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 30, 31, 33 and 36 are rejected under 35 U.S.C. 103 as being unpatentable over Hendel et al. (Nature Biotechnology 33, pages 985-989 and online methods, 2015) and Zalatan et al. (Cell 160, 339-350, 2015) as applied to claims 1, 4, 6, 13, 14, 20, 23, 25-29, and 34-35 above, and further in view of Rutgers, The State University of New Jersey, (WO 2018129129, cited on an IDS).
Hendel and Zalatan do not specifically teach the RNA motif has a sequence selected from SEQ ID NO: 21 to 24.
However, '129 teaches gene editing system comprising RNA scaffolds for sequence recognition and effector-recruitment for use in gene editing (e.g., pages 2-35 and 64-68 and Figures 1, 6 and 10-11). The effector can be AID, CDA, or APOBEC family member (pages 23-27). This system addresses the limited applicability for gene editing that involved repair or correction using double stranded breaks (DSB)-mediated homologous recombination (page 2). The RNA scaffolds have three sub-components, a programmable gRNA motif, a CRISPR RNA motif, and a recruiting motif (Figure 1b). The components can be linked together to form the scaffold via covalent, non-covalent, or binding, including Watson-Crick base pairing. The scaffold can be either a single gRNA or a complex of multiple RNA molecules. more modifications, including modified nucleotides. The scaffold can be a crRNA:tracRNA. The system takes advantage of various RNA motif/RNA binding protein binding pairs. Table 2 of '129 discloses examples of recruiting RNA motifs that can be used in the RNA scaffold (as set forth in instant claim 23), as well as their pairing RNA binding protein/protein domains, including MS2 phase operator stem-loop set forth SEQ ID NO: 17 (Db) on page 21, which is 100% identical to instant SEQ ID NO: 21 (Qy).
Qy 1 GCGCACAUGAGGAUCACCCAUGUGC 25
Db 1 GCGCACATGAGGATCACCCATGTGC 25
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Hendel and Zalatan with '129 as a simple substitution to try using SEQ ID NO: 17 when making the RNA motif of the RNA scaffold. See MPEP 2143(I)E. Also, '129 teaches that the RNA motif can be SEQ ID NO: 21 recited in instant claim 33 (SEQ ID NO: 17 on page 21 of ‘129). The RNA scaffold made obvious by would read on the length of the RNA motif and extension sequence recited in instant claim 20. One of ordinary skill in the art would have been motivated to combine the teaching to study the system for use in gene editing. Pages 23-29 of '129 make obvious the limitations in claims 30-31 and 36.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Conclusion
See attached PTO-326 for disposition of claims.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. MIT (US 20180187186) disclose that applying chemical modification to gRNA was considered routine experimentation (e.g., pages 51-57 and 63-66). See MPEP 2144.05(II).
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636