DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1-2, 18-21, 24, 26-28, 37-39, 45, and 54-55 are pending. Claims 3-17, 22-23, 25, 29-36, 40-44, and 46-53 are cancelled. Claims 1, 20-21, 26-28, 39, and 45 are amended. Claims 54-55 are new.
Claims 2 and 24 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Elections were made without traverse in the reply filed on 11/13/25.
In response to Applicant’s 4/16/26 query for clarification on claim 2 withdrawal, the Examiner provides the below explanation.
The 8/19/25 request for an election of species of “a specific number of CpGs within the panel… and specific SEQ ID NOs” was answered in Applicant’s 11/13/25 Remarks of “at least one CpG, wherein the CpG is defined by SEQ ID NO: 67 (cg15975865)”.
It is noted that SEQ ID NO: 67 only has 12 CpGs, which is outside of the scope of claim 2 limitation reciting “at least 50/100/150/200/500 CpGs”. Therefore, claim 2 is withdrawn due to being drawn to a nonelected species.
SEQ ID NO: 67 ccctcccccggcccggcctggcccggcctggccagtccccgcggtctctgcccgggctgacgcccaggaatgtggtcgacgagaagccccaacagcacggcgtggcctctcagcctcggtga = 12 CpGs
Claims 1, 18-21, 26-28, 37-39, 45, and 54-55 are currently under examination.
Response to Amendment
The Amendment filed 4/16/26 has been entered. Claims 1-2, 18-21, 24, 26-28, 37-39, 45, and 54-55 are pending. Applicant’s amendments and/or cancellations of the specification and claims 1, 21, 26-30, 33, 39, and 45 have overcome the objections and 112(a), 112(b), and 101 rejections previously set forth in the Non-Final Office Action mailed 12/17/25.
Response to Arguments
Applicant’s arguments, see pages 24-25, filed 4/16/26, with respect to the rejections of claims 1, 18-21, 26-30, 33, 37-39, and 45 under 35 USC 103 have been fully considered are found unpersuasive, and the rejections documented in the Non-Final mailed 12/17/25 have been revised to address claim amendments and new claims 54-55 filed 4/16/26 in this Final Office Action. More detailed responses to Applicant’s arguments are provided at the end of each maintained rejection.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 18-21, 26, 28, 37-38, 45, and 54-55 remain/are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (2016; WO 2016/115530 A1; FOR citation N in PTO-892 filed 12/17/25).
This 103 rejection is necessitated by claim amendments and new claims 54-55.
Relevant to claims 1 and 55, Zhang et al. teaches “In some embodiments, a number of methods are utilized to measure, detect, determine, identify, and characterize the methylation status/level of a biomarker (i.e., a region/fragment of DNA or a region/fragment of genome DNA (e.g., CpG island-containing region/fragment)) in the development of a disease or condition (e.g., cancer) and thus diagnose the onset, presence or status of the disease or condition” (paragraph 0164).
Further relevant to claims 1 and 55, Zhang et al. teaches “In some embodiments, a biomarker (also referred herein as a marker) is obtained from a tissue sample. In some instances, a tissue corresponds to any cell(s)” (paragraph 0166).
Further relevant to claims 1 and 55, Zhang et al. teaches “In some embodiments, a biomarker is obtained from a liquid sample. In some embodiments, the liquid sample comprises blood and other liquid samples of biological origin” (paragraph 0167).
Further relevant to claims 1 and 55, Zhang et al. teaches “In some instances, a tumor or cancer originates from… cervix” (paragraph 98).
These teachings collectively render obvious to the skilled artisan claim 1 a method comprising assaying from a cervical liquid-based cytology sample from an individual the methylation status of a panel; and claim 55 a method comprising assaying from a cervical liquid-based cytology sample from an individual.
Relevant to claims 1, 18-21, and 54-55, Zhang et al. Abstract teaches that "Disclosed herein are methods, systems, platforms, non-transitory computer-readable medium, services, and kits for determining a cancer type in an individual. Also described herein include methods, systems, platforms, non-transitory computer-readable medium, and compositions for generating a CpG methylation profile database."
Further relevant to claims 1, 18-21, and 54-55, the below excerpt demonstrates that the elected SEQ ID NOs 67 and 503 align to the GYPC gene and contain cg15975865.
PNG
media_image1.png
531
1888
media_image1.png
Greyscale
Further relevant to claims 1, 18-21, and 54-55, Zhang et al. teaches "In some embodiments, the methylation profile comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 biomarkers selected from the group consisting of Table 15" (paragraph 0009). Zhang et al. page 216 teaches cg15975865 within Table 15.
Relevant to claim 26, Zhang et al. teaches "Suitable next generation sequencing technologies are widely available. Examples include… Illumina's Genome Analyzer, GoldenGate Methylation Assay, or Infinium Methylation Assays, i.e., Infinium HumanMethylation 27K BeadArray or VeraCode GoldenGate methylation array…" (paragraph 0199).
Relevant to claim 28, Zhang et al. teaches "In other embodiments, described herein include methods, systems, platform, non-transitory computer-readable medium, services, and kits for determining the prognosis of a cancer in an individual in need thereof, prediction of a treatment response, and treatment response monitoring" (paragraph 0004).
Further relevant to claim 28, Zhang et al. teaches "In some embodiments, the method further comprises implementing a treatment regimen based on the diagnosed cancer type" (paragraph 0029).
Relevant to claims 37-38, Zhang et al. teaches "In one embodiment, provided herein include methods for determining the course of cancer in a patient, cancer course refers to changes in cancer status over time, including cancer progression (worsening) and cancer regression (improvement). Over time, the amount or relative amount (e.g., the pattern) of methylation of the biomarkers changes. For example, hypermethylation or hypomethylation of biomarker ‘X’ and ‘Y’ are increased in some instances with cancer. Therefore, the trend of these biomarkers, either increased or decreased methylation over time toward cancer or non-cancer indicates the course of the disease. Accordingly, this method involves measuring the methylation level or status of one or more biomarkers in a patient at least two different time points, e.g., a first time and a second time, and comparing the change, if any. The course of cancer is determined based on these comparisons" (paragraph 0249).
Relevant to claim 45, Zhang et al. teaches "To identify a cancer-type specific signature, methylation differences between a particular cancer type and its surrounding normal tissue, differences between different cancer types, as well as differences between two normal tissues in a pair-wise fashion were compared" (paragraph 0361).
Relevant to claim 55, Zhang et al. teaches that “In some embodiments, the cancer type comprises… endometrial cancer” (paragraph 0013).
Zhang et al. does not teach a specific embodiment having all the claimed elements. That being said, however, it must be remembered that "[w]hen a patent simply arranges old elements with each performing the same function it had been known to perform and yields no more than one would expect from such an arrangement, the combination is obvious." KSR v. Teleflex, 127 S.Ct. 1727, 1740 (2007) (quoting Sakraida v. AG. Pro, 425 U.S. 273, 282 (1976)). "[W]hen the question is whether a patent claiming the combination of elements of prior art is obvious," the relevant question is "whether the improvement is more than the predictable use of prior art elements according to their established functions." (Id.). Addressing the issue of obviousness, the Supreme Court noted that the analysis under 35 USC 103 "need not seek out precise teachings directed to the specific subject matter of the challenged claim, for a court can take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR at 1741. The Court emphasized that "[a] person of ordinary skill is... a person of ordinary creativity, not an automaton." Id. At 1742.
Consistent with this reasoning, it would have been prima facie obvious to have
selected various combinations of various disclosed elements — including methylation markers, stratification, and multiple time points — for a method comprising assaying from a sample from an individual the methylation status of a panel, to arrive at compositions "yielding no more than one would expect from such an arrangement."
Applicant’s Arguments and Response to Applicant’s Arguments
Applicant argues that “Zhang includes over 250 unique markers throughout its specification that are used to determine the presence of cancer based on a methylation profile from one or more of those biomarkers. It is self-evident that it would not be obvious to the skilled artisan out of that many markers to select the marker in SEQ ID NO:67, as opposed to any other one disclosed” (Remarks 4/16/26, page 24, paragraph 2). Applicant further argues that the skilled artisan would not find selection of SEQ ID NO: 67 obvious amongst the Zhang et al. markers (Remarks 4/16/26, pages 24-25).
The Examiner respectfully disagrees with these assertions. As stated in the above rejection and reiterated from the 12/17/25 Non-Final Rejection, the instant patent “simply arranges old elements with each performing the same function it had been known to perform” from the disclosure of Zhang et al. The skilled artisan is “a person of ordinary creativity, not an automaton” and would find it obvious and reasonable to select previously disclosed elements from the Zhang et al. disclosure to arrive at the instantly rearranged combination of old elements.
Applicant further argues that the skilled artisan would not find it obvious to perform the methodology upon amended claim 1 limitation of a cervical liquid-based cytology sample (Remarks 4/16/26, page 24, paragraph 2). The Examiner respectfully disagrees, and directs Applicant to the above teachings relevant to the rejection of claim 1.
Applicant further argues that hindsight reasoning is applied to the rejection of claim 1 (Remarks 4/16/26, page 25, paragraph 2).
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
Claims 27 and 39 remain/are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (2016; WO 2016/115530 A1; FOR citation N in PTO-892 filed 12/17/25), as applied to claims 1, 18-21, 26, 28, 37-38, 45, and 54-55 above, and further in view of Alcazar et al. (2014; NPL citation V in PTO-892 filed 12/17/25; "The Role of Ultrasound in the Assessment of Uterine Cervical Cancer"; J Obstet Gynecol India 64, 311-316 (2014). https://doi.org/10.1007/s13224-014-0622-4).
The teachings of Zhang et al. are applied to instantly rejected claims 27 and 39 as they were previously applied to claims 1, 18-21, 26, 28, 37-38, 45, and 54-55 as rendering obvious a method comprising assaying from a sample from an individual the methylation status of a panel.
Relevant to claim 27, Zhang et al. teaches "In specific embodiments, provided herein include methods for determining the risk of developing cancer in a patient. Biomarker methylation percentages, amounts or patterns are characteristic of various risk states, e.g., high, medium or low" (paragraph 0243).
Zhang et al. is silent to specifics regarding transvaginal ultrasounds as treatments. However, these limitations were known in the prior art and taught by Alcazar et al.
Relevant to claims 27 and 39, Alcazar et al. teaches “Studies evaluating the role of transvaginal/transrectal ultrasound for staging cervical cancer were reported in early 90s” (first sentence of “Transvaginal/Transrectal Ultrasound for Local Staging of Cervical Cancer” Section). Alcazar et al. Figures 1-7 depict transvaginal ultrasound images successfully identifying cervical cancers.
Although Zhang et al. is silent to the Alcazar et al. transvaginal ultrasounds, this limitation would have been prima facie obvious to the skilled artisan. It is noted that Zhang et al. and Alcazar et al. are analogous disclosures to the instant cancer field.
The skilled artisan would have been motivated to combine the analogous art. Alcazar et al. teaches that transvaginal ultrasounds have been used since the early 90s, and the Figures demonstrate success in imaging cervical cancers. Thus, the skilled artisan would have been motivated to use this common and well-known technique to treat individuals.
The skilled artisan would have a reasonable expectation of success based on the disclosures of Zhang et al., and further in view of Alcazar et al., as discussed in the preceding paragraphs.
Applicant’s Arguments and Response to Applicant’s Arguments
Applicant did not respond to this rejection; therefore, this rejection is maintained.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 18-21, 26-28, 37-39, 45, and 54-55 remain/are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 16-19, 24, 48, 52-55, and 59 of copending Application No. 18/009,957 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because they are coextensive in scope.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
This nonstatutory double patenting rejection is necessitated by claim amendments and new claims 54-55.
The instant claims are drawn to A method comprising assaying from a cervical liquid-based cytology sample from an individual the methylation status of a panel of: one or more CpGs comprising the CpG identified in SEQ ID NO 67 wherein the CpG is identified at nucleotide positions 61 to 62.
The copending claims are drawn to “A method comprising assaying from a sample from an individual the methylation status of a panel of: i) one or more CpGs comprising the CpG identified in SEQ ID NO 83 wherein the CpG is identified at nucleotide positions 61 to 62; and ii) one or more CpGs identified in the sequences defined by SEQ ID NOs 5787 and 5797, wherein the CpGs are denoted by CG, wherein the assaying on the panel comprises performing PCR.”
Although the elected species of SEQ ID NOs are not identical to copending application SEQ ID NOs, the skilled artisan would find this difference prima facie obvious. Both inventions contain identical assay steps and methodologies to assay methylation status, and both inventions pertain to the same cancer (CIN3). It is noted that both the instant and copending SEQ ID NOs correspond to characterized methylation regions, as denoted by the cg-number designation. The skilled artisan would recognize that the instant and copending regions would be assayed within commercially available methylation arrays (e.g., Illumina), and would thus find the instant and copending inventions as obvious variants.
The copending claims are required to perform the instant methods. Thus, they are obvious variants. Dependent claims are rejected as they are coextensive in scope.
Applicant’s Arguments and Response to Applicant’s Arguments
Applicant did not respond to this rejection; therefore, this rejection is maintained.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Sarah J Kennedy whose telephone number is (571)272-1816. The examiner can normally be reached Monday - Friday 8a - 5p.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at 571-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SARAH JANE KENNEDY/Examiner, Art Unit 1682
/WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Prosecution Insights