DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 137 and 170-177, are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/20/2025.
Regarding claim 137, claim 137 does not recite the 3’ UTR of the elected species of SEQ ID NO: 126 and is therefore drawn to a non-elected species. Claim 137 is withdrawn from consideration.
Regarding claims 170-176, claims 170-176 recite that the 5’UTR comprises either SEQ ID NO 41 or SEQ ID NO 42. These claims are therefore drawn to a non-elected species, where the Applicant has elected SEQ ID NO: 1 as the 5’UTR to be examined.
Regarding claim 177, claim 177 recites that the miRNA binding site comprises any of SEQ ID NOs 38-40. However, the Applicant’s elected sequence for the 3’UTR (SEQ ID NO: 126) does not comprise any of SEQ ID NOs 38-40. Claim 177 therefore reads on a non-elected 3’UTR sequence and is withdrawn from examination.
The Applicant has elected an mRNA with a structure comprising SEQ ID NO: 1 for the 5’UTR, SEQ ID NO: 33 for a stop element, and SEQ ID NO: 126 for a 3’UTR. An mRNA comprising all of these structures in combination was found to be free of the art. The search was therefore expanded to additional embodiments recited.
Application Status
This action is written in response to applicant’s correspondence received on 6/5/5026. Claims 128, 130, 135, 137, 139, 141-145, and 169-188 are pending. Claims 129, 131-134, 136, 138, 140, and 146-168 have been cancelled. Claims 137 and 170-177 are withdrawn from examination as they are drawn to non-elected species (see “Election/Restrictions,” above). Claims 128, 130, 135, 139, 141-145, 169, and 178-188 are currently under examination.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. This Office Action is Final.
Claim Rejections - 35 USC § 112 New Rejection Necessitated by Amendment
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 179, 181-184 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 179, claim 179 recites that the mRNA of claim 128 comprises one of SEQ ID NOs 61, 119, or 126-127. The specification identifies SEQ ID NOs 61, 119, and 126-127 as sequences of 3’UTR and stop elements (see Table 4 of specification, at page 168). However, claim 179 does not identify that SEQ ID NOs 61, 119, and 126-127 are the stop element and 3’UTR required in the independent claim 128. It is unclear if the stop element and 3’UTR elements of for instance SEQ ID NO 61 are meant to be the stop element and 3’UTR as recited in claim 128, or if the mRNA recited further comprises additional stop and 3’UTR elements. The claim should be amended to clarify that SEQ ID NOs 61, 119, and 126-127 comprise the stop element and 3’UTR of claim 128 to clarify the structure of the mRNA because presently the claim recites two separate 3’UTRs (the 3’UTR recited in independent claim 128 and the 3’UTRs present in each of SEQ ID NOs 61, 119, and 126-127). Claims 181-184 are recited to depend from claim 179 and do not resolve this 112(b) issue and are therefore also rejected.
Furthermore, regarding claim 181, claim 181 is recited to depend from claim 179 and recites “the stabilizing region.” However, no stabilizing region is recited in claim 179 or previously in claim 181. Recitation of “the stabilizing region” in claim 181 therefore lacks proper antecedent basis.
Additionally, claim 181 recites “comprising 80-150 adenines (SEQ ID NO: 123).” SEQ ID NO: 123 is 150 adenine residues. It is therefore unclear if the polyA tail recited in claim 181 is required to be 150 adenines in length, as recited in SEQ ID NO: 123, or if recitation of SEQ ID NO: 123 is merely exemplary language. The exemplary langue in claim 181 by recitation of SEQ ID NO: 123 renders the structure of the polA tail unclear.
Claims 182-184 depend from claim 181 and do not resolve the 112(b) issues above and are therefore also rejected.
Claim Rejections - 35 USC § 112 – Maintained/Updated in Response to Amendment
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 128, 130, 135, 139, 141-145, 169, 178, and 180-188 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Regents of the University of California v. Eli Lilly & Co, 119 F.3d at 1568, 43 USPQ2d at 1406.
Nature of the Invention/Breadth of Claims
Regarding independent claim 128, claim 128 recites an mRNA molecule comprising a 5’UTR comprising a sequence 95% identical to SEQ ID NO: 1, where the mRNA molecule is further recited to comprise a coding region and stop element and 3’UTR. The independent claim is therefore claiming a genus of mRNA molecule where a combination of a 5’UTR with 95% identity to SEQ ID NO: 1 and 3’UTR elements can be used, where the structure of the 3’UTR is not limited. This claim language therefore encompasses an enormous number of potential molecules comprising various combinations of each of the recited elements of the claim (i.e., stop elements and 3’UTR). This claim language is problematic because it is known in the art that variability and complexity exists within the genus of UTR elements recited, where it is known that 5’UTRs and 3’UTRs function together and their interactions are known to be unpredictable in the art (see below). Thus, the genus of “3’UTR” as presently recited in claim 1, which would include its functionality as defined as a 3’UTR which are known to interact with and function with 5’UTRs, was not shown to be in possession as presently recited. Furthermore, the specification does not provide adequate demonstration or guidance to show sufficient possession of the broadly claimed genus of molecules.
Additionally, as discussed further below, the stop elements of the application appear to show variable and unpredictable activity, where common core structures of the sequences with relation to their functionality was not shown to be in possession by the Applicant. As presently recited, the stop elements are only restricted in that they recite known stop codons UGA, UAA, and UAG (claim 128).
Guidance Provided in the Specification
With regards to the examples offered in the specification, the Applicant offers examples 1-37. Example 1 reviews screening for 5’UTRs, where “A1” is chosen (SEQ ID NO: 1), for its beneficial properties. Furthermore, it is stated in Example 1 that “most 5' UTRs associated with substantial increases in expression had some attribute that precluded their broad utility,” (page 280, second paragraph). Thus, the specification itself acknowledges that not some, or a few, but “most” 5’UTRs comprise attributes which negatively affect their utility, and therefore acknowledges that large portions of UTRs are not utile for the intended purposes owing to unpredictable attributes of the molecules. Example 1 characterizes A1 relative to a “reference” UTR (“A11”) and recites that A1 appears to have increased expression. Examples 2-6 describe testing of A1/A11 testing in various backgrounds (in vivo, various cell types) and demonstrates increased expression using A1 relative to A11.
Example 7 recites testing of variants of A1, in the form of A2 and A3 (i.e., SEQ ID NOs 41 and 42). Example 7 reports that variants A2 and A3 show similar expression levels of A1, while Example 8 demonstrates in vivo testing and expression using A2 and A3.
Example 9 recites the discovery of 3’UTR sequences with increased mRNA half-life, where it is stated that 120,000 3’UTRs were pooled, modeled, and tested, however, data for only 9 such UTRs is shown. Applicants recite that 3’UTR “B1” (i.e., SEQ ID NO: 11), showed improved half-life. Thus, there is unknown predictability within the genus of “3’UTR” as evidenced by the specification itself, including compatibility with a given 5’UTR.
Example 10 recites the identification of stop elements C1-C11, where such elements were identified through modeling and testing and demonstrated improved half-life of mRNA.
Example 11 states that stop elements C1, C3-5 and C11 demonstrate increased expression of a target protein when incorporated into mRNA. Data is shown in Figure 12. Data for stop elements C2 and C6-10 is not shown.
Example 12 recites that stop elements were incorporated into mRNA and tested in in vivo models to show increased expression of target protein. Stop elements C7, C8, and C10, which were different from those tested in Example 11, are shown in Figure 13, where incorporation of such stop elements appears to show increased expression of protein.
Example 13 shows data for stop elements incorporated in mRNA to express a reporter construct, where C3, C4, and C6 were tested, where C6 appears to show only a modest increase relative to the reference stop element.
Example 14 focuses on variant protein expression when stabilizing tail elements are added. Examples 15-16 demonstrates the application of 5’UTR element A1 in the context of LNP in vivo administration, where furthermore the 5’UTR element appears to show synergistic effects in combination with a stabilizing tail to increase protein expression.
Example 17 demonstrates the combination of the A1 5’UTR element and 3’UTR B1 element, where such a combination of the two elements increased protein expression in an in vivo model. Example 18 demonstrates increased protein expression when the 5’UTR A1 is paired with the 3’UTR B1 in bronchial epithelial cells.
Example 19 shows an experiment where stop elements C1, C3, C5, C7, and C9 were used in a reporter assay to test stop codon readthrough, where the results indicate that no such reporter activity was observed for GFP in the study indicating no evidence of stop codon readthrough.
Examples 20-26 recite experiments demonstrating the incorporation of stop elements C1, C5, and C7-10 into mRNAs in different cell types/in vivo models using various reporter proteins. Notable, Example 22 references Figure 21A and shows stop element C5 with a noticeable decrease in luminescence relative to the reference C1 (Figure 21A). Similarly, stop element C8 appears to show a lower average level of fluorescence compared with C1 (Figures 21A-21C); there therefore appears to be unpredictability and variability concerning stop elements tested.
Examples 27-31 recite various in vitro and in vivo experiments reducing to practice mRNA molecules comprising 5’UTRs such as A1 and A3 and stop elements (from C1-C11) tested in combination with one another, where protein expression is measured relative to a control.
Examples 32-33 recite experiments related to testing mRNAs comprising the 3’UTR B18 compared with a reference 3’UTR B10, where in vitro and in vivo experiments using various reporter molecules show an increased in target protein expression when B18 was used.
Example 34 recites an experiment testing other 5’UTR sequences A12, A14, A15, A18, A20, A26, A27, and the A11 reference. Example 34 recites that “at least A20, A26, A15, and A18” were associated with increased relative fluorescence per Figures 35A-35B. However, Figure 35 in fact appears to show that A20 and A26 are comparable if not lower in expression (e.g., A20) than the reference. Thus, Example 34 shows variability and unpredictability in using 5’UTRs depending on their sequence, where not all 5’UTRs work to the same degree relative to a given reference.
Example 35 recites an in vivo experiment where mRNAs comprising 5’UTR elements A12, A14, A20, A26, A27, A15, and reference A11 were tested, where an increase in protein expression of a fluorescent reporter was observed upon introduction of the 5’UTR elements. Of note, protein expression level of the mRNA comprising A26 appears to be comparable to the reference A11 in the tested liver cells (Figure 36C). Thus, the 5’UTRs appear to show some variability and unpredictability with respect to the cell type and timepoint in the experiments of Example 35 (Figure 36).
Examples 36-37 relate to the production of different formulations of lipid nanoparticles.
Taken together, the Applicant appears to have tested a handful of mRNA elements including 5’UTRs, stop elements, and 3’UTRs, where the Applicant acknowledges variability in 5’UTR sequences and their potential to be used, stating that “most 5' UTRs associated with substantial increases in expression had some attribute that precluded their broad utility,” (page 280, second paragraph). Furthermore, UTRs and stop elements did not all appear to have increased protein expression levels per Figures 21 and 35-36. The specification therefore does not show sufficient possession of the embodiments of variations in the stop element sequences and 3’UTRs recited. Furthermore, no common structure-function relationship is established to define the recited genera, where different UTRs appear to function with unpredictable characteristics.
State of the Art
Regarding the state of the art, it is known in the art that UTR regions used in different combination with one another are known to be unpredictable and variable, where furthermore such regions are known to be complex and subject to dramatic variations in functionality dependent upon their lengths.
For instance, Kirshina (Kirshina A et al. Biomolecules. 2023 Nov 20;13(11):1677), a post-filing research article which reflects a general scientific truth which was also true at the time of filing, teaches that:
“Various RBPs also associate with 3′UTR sequences, but binding sites for some RBPs have not been identified. Nonetheless, even in the case of a known sequence of binding sites, a direct relation between the presence of a landing site and RNA stability has been difficult to discern because some RBPs stabilize RNA, some destabilize it, and others can modulate RNA stability in a context-dependent manner, as is the case for PCBP2. It should also be pointed out that the impact of most RBPs on the stability and translational efficiency of mRNA is poorly investigated. Among the best-known RBPs that bind to a 3′UTR is polypyrimidine tract–binding protein (PTB), which associates with CU-rich elements, thereby forming large loops (in RNA) important for modulation of the interaction of factors necessary for splicing,” (page 3, third paragraph)
Thus, 3’UTR can comprise unknow RBP binding sites, where such binding can either stabilize, destabilize, or affect translation in unidentified and context-specific manners, where furthermore Kirshina teaches that the impact of RBPs and the stability and translational efficiency of mRNA is “poorly investigated.” The art therefore teaches known unpredictability in the broad category of “3’UTR” presently recited.
Concerning the use of such UTRs in the context of heterologous mRNA expression, Kirshina teaches that:
“Of note, despite active research into the properties of UTRs, the number of studies assessing the contribution of certain UTRs to the expression of heterologous RNAs is rather small,” (page 3, fourth paragraph).
Thus, Kirshina teaches that there are relatively few studies concerning the contribution of UTRs to the expression of heterologous RNA, such as a coding region encompassed by the claims.
With regards to the use of combinations of various 5’ and 3’ UTRs, Kirshina teaches that:
“In addition to the choice of individual UTRs, another question is whether protein expression depends on a specific combination of a 5′UTR and 3′UTR. Although a 5′UTR and 3′UTR do not interact directly during translation, it has been demonstrated by means of p53 mRNA as an example that the 5′UTR and 3′UTR contain complementary regions that bind translation factor RPL26, which mediates translation enhancement in response to DNA damage. Thus, the aim of the current study was to find optimal combinations of a 5′UTR and 3′UTR to improve protein synthesis and mRNA stability,” (page 3, fifth paragraph).
Kirshina therefore teaches that, in addition to the complexity of choosing individual UTR sequences, 5’ and 3’UTRs are also known to interact with each other in order to affect overall changes in translation efficiency; thus, the genus of mRNA is complex and unpredictable when considering how such 5’ and 3’ UTR combinations would behave in different combinations with one another. Thus, by reciting that the 5’UTR of claim 128 is 95% identical to SEQ ID NO: 1 or 41, there is an inherent and unpredictable relationship which exists between the 5’UTR recited and the 3’UTR, where no structure-function relationship is established or characterized between the complex structures of the recited UTRs, where furthermore it is known that the 5’ and 3’UTRs function with each other in complex and unpredictable ways (above).
To further elaborate upon the importance of 5’ and 3’UTR interactions, Chen (Chen et al. Genes Dev. 2010 Oct 1;24(19):2146-56) is a research article focused on 5’ and 3’ UTR interactions and their effects on p53 translation efficiency (Title, Abstract, throughout). Chen teaches that:
“Mutating as few as 3 bases in either of the two complementary UTR sequences abrogates the ability of RPL26 to bind to p53 mRNA and stimulate p53 translation,” (Abstract)
and:
“We report here that translation of human p53 mRNA is regulated by base-pairing interactions between 5′- and 3′-UTR sequences. Mutations that disrupt the interaction abolish the binding of RPL26 to human p53 mRNA and diminish RPL26-dependent p53 induction,” (Introduction, page 2147 left column, second paragraph and Figure 2A).
Thus, Chen teaches that 5’UTRs and 3’UTRs can interact with each other to form complimentary base pairings which have an overall effect on translational efficiency. Chen therefore teaches that there is a known mechanism in the art which relies upon the sequences of the 5’ and 3’ UTRs, where such mechanisms are sequence dependent and can have effects on translational efficiency. Thus, while the Applicant has amended claim 128 to now be restricted to “95%” sequence identity to SEQ ID NOs 1 or 41 for the 5’UTR sequence, the Applicant has not identified which regions of such 5’UTRs can tolerate mutation and still function, where it is known in the art that as few as 3 mutations can abrogate the ability of mRNA to be translated per Chen (above).
Kirshina and Chen therefore teach synergistic and antagonistic effects of variations in UTR sequences, where such sequences can act in partnership to recruit translational machinery (Kirshina, above) or to form additional mRNA structures by complementation (Chen). The pairing of 5’ and 3’UTR sequences is therefore an additional complexity to the recited invention, where a practitioner is not provided with guidance on how any such 5’ and 3’UTRs should be paired with the exception of the few examples reduced to practice.
Furthermore, it is known in the art that not all embodiments of 3’UTRs efficiently function as UTR elements. For instance, Tanguay (Tanguay RL et al. Mol Cell Biol. 1996 Jan;16(1):146-56) is a research article focused on the effects of length and 3’UTR functionality. Tanguay teaches that shortening 3’UTR segments can dramatically reduce the overall translation efficiency of the mRNA (Abstract). Thus, the genus of 3’UTRs recited is unpredictable, as not all 3’UTRs are functional.
Thus, it was known in the art that 3’UTR lengths play critical roles in translational efficiency, where furthermore their sequences are critical for 5’/3’UTR interactions and/or translational protein recruitment. The category of such UTRs and their combinations are therefore highly unpredictable, where furthermore the claimed invention has an added layer of complexity in the sense that the components are recited to be used in combination with each other on the same mRNA, where such UTRs would function with each other as known in the art (above).
The Applicant has therefore not shown possession of the broadly recited genus of mRNA molecules commensurate in scope with what is presently recited owing to the complex and unpredictable nature of the genus.
The claims which depend from independent claim 128 do not resolve this issue and are therefore also rejected (claims 130, 135, 139, 141-145, 169, and 178-188).
Claims 130 and 135 and 169, which recites that the 5’UTR comprises 98%, 99% identity or full identity to SEQ ID NO:1, does not resolve the issue because, although the claim is drawn to a 5’UTR comprising a tested sequence, the claim also encompasses other combinations of 3’UTR to be used with the 5’UTR, where 5’UTRs and 3’UTRs are known to function together in context-specific manners (above).
Note that, while claim 179 is not rejected under this 112(a) rejection, claim 181 which is presently recited to depend from claim 179 is rejected. This discrepancy is explained as follows: claim 181 is presently recited to depend from claim 179, but it appears that this is a typographical error in the claims, where claim 181 is meant to depend from claim 180. As such, for the purposes of this rejection, claim 181 is being interpreted to depend from claim 180 and not claim 179.
Response to Arguments
The Applicant’s arguments filed 6/5/2026 have been considered but are not persuasive. The Applicant argues that they have amended claim 128 to recite a 5’UTR with at least 95% sequence identity to SEQ ID NO 1 or 41, where their specification has reduced to practice such mRNA sequences. This argument is not persuasive because claim 128 still broadly recites any 3’UTR or stop element. As discussed above, it is known in the art that the 3’UTR element of an mRNA has significant effect and impact on the mRNA, as such UTRs are known to interact directly with the 5’UTR. Thus, the present genus of mRNA molecule recited is not simply drawn to the sequence of the 5’UTR, but inherently comprises the 3’UTR sequence and the structural/functional relationship known in the art to exist between the 5’ and 3’UTRs. As discussed above, such 3’UTR and 5’UTR interactions are known to be unpredictable and complex. Thus, although the Applicant has narrowed claim 128 to more clearly define the 5’UTR, the overall structure and genus of mRNA presently recited has not been described by the Applicant because variable and unpredictable embodiments of the 3’UTR region are known in the art to effect mRNA translational efficiency in direct functional relationship with the 5’UTR (above).
Claim Rejections - 35 USC § 102 – New Rejection Necessitated by Amendment
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 128, 139, 141, and 180-181 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by DV062276 (hereafter ‘276, NCBI BLAST Accession number DV062276, published 2011) as evidenced by Pesole (Pesole G et al. Gene. 1997 Dec 31;205(1-2):95-102, of record) and Chang (Chang H et al. Mol Cell. 2014 Mar 20;53(6):1044-52 ).
Regarding claim 128, as discussed in the above section entitled “Election/Restrictions,” the Applicant’s elected species, an mRNA comprising SEQ ID NO: 1, SEQ ID NO: 33, and SEQ ID NO: 126, was not found in the art. Thus, the search has been expanded to additional embodiments of the claim. Claim 128 is broadly drawn to an mRNA comprising a sequence that is 95% identical at the 5’UTR site with SEQ ID NO: 1, and further comprises a coding region with a stop codon (i.e., UAA, UAG, or UGA) and a 3’UTR. Regarding these claim limitations, ‘276 is an NCBI BLAST accession for an mRNA (see page 1, line 5, which identifies ‘276 as an mRNA). Furthermore, residues 51-125 of ‘276 are match 73/75 = 97% of the residues of instant SEQ ID NO: 1 (see top of page 1 of ‘276). Thus, ‘276 comprises the 5’UTR region at a 97% identity (page 1 of ‘276). Furthermore, ‘276 comprises a coding region (i.e., the histone gene which it encodes, page 1, “Definition”). Additionally, as evidenced by Pesole, eukaryotic mRNAs, as ‘276 is defined and identified to be, comprise 3’UTRs and stop codons (e.g., Introduction paragraphs 2-5, page 96 left column, paragraph 4). Thus, ‘276 reads on the claim elements of instantly recited claim 128, as ‘276 is an mRNA comprising a 5’UTR with 97% identity of SEQ ID NO: 1, comprises a coding region in an mRNA, which furthermore comprises a stop codon and 3’UTR as defined.
Regarding claim 139, claim 139 only recites a miRNA binding site, which can comprise any site which could be recognized or bound by an miRNA, which can any sequence. ‘276 therefore reads on this limitation by the recitation of additional sequence elements separate from the 5’UTR.
Regarding claim 141, as evidenced by Pesole (page 96, right column, final paragraph), eukaryotic mRNAs naturally comprise 5’ cap structures. ‘276 therefore reads on claim 141 as it is a eukaryotic mRNA, or at the very least because a practitioner or ordinary skill in the art could immediately envision such an mRNA comprising a 5’ cap or naturally occurring poly adenylation stabilizing region (page 96, left column, fourth paragraph of Pesole).
Regarding claims 180-181, as evidenced by Chang, eukaryotic mRNAs naturally comprise poly-A tails which are about 50-100 nucleotides (Summary). Thus, ‘276 inherently comprises a polyA tail which is about 80-100 nucleotides.
Response to Arguments
The Applicant’s argument filed 6/5/2026 have been considered but are not persuasive. The Applicant’s argues that their amendments overcome the original 102 rejection. This argument is persuasive. However, the Applicant’s amendments prompted a new search within the new scope of the claims. Thus, a new 102 rejection has been issued to address the new scope of the claims (above).
Claim Rejections - 35 USC § 101 – New Rejection Necessitated by Amendment
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 128, 139, 141, 145, and 180-181 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a naturally occurring product of nature without significantly more.
Regarding claim 128, claim 128 is broadly drawn to an mRNA comprising a sequence that is 95% identical at the 5’UTR site with SEQ ID NO: 1, and further comprises a coding region with a stop codon (i.e., UAA, UAG, or UGA) and a 3’UTR. Regarding these claim limitations, DV062276 (hereafter ‘276, NCBI BLAST Accession number DV062276, published 2011) is an NCBI BLAST accession which describes a naturally occurring histone gene in mice encoding an mRNA (see page 1, line 5, which identifies ‘276 as an mRNA). Furthermore, residues 51-125 of ‘276 match 73/75 = 97% of the residues of instant SEQ ID NO: 1 (see top of page 1 of ‘276). Thus, ‘276 comprises the 5’UTR region at a 97% identity to SEQ ID NO: 1 (page 1 of ‘276). Furthermore, ‘276 comprises a coding region (i.e., the histone gene which it encodes, page 1, “Definition”). Additionally, as evidenced by Pesole (Pesole G et al. Gene. 1997 Dec 31;205(1-2):95-102, of record), eukaryotic mRNAs, as ‘276 is defined and identified to be, comprise 3’UTRs and stop codons (e.g., Introduction paragraphs 2-5, page 96 left column, paragraph 4). Thus, ‘276 reads on the claim elements of instantly recited claim 128, as ‘276 is an mRNA comprising a 5’UTR with 97% identity of SEQ ID NO: 1, comprises a coding region in an mRNA, which furthermore comprises a stop codon and 3’UTR as defined. Claim 128 therefore recites a naturally occurring gene produce and sequence structure without additional elements or markedly different characteristics. Claim 128 is therefore not subject matter eligible.
Regarding claim 139, claim 139 only recites a miRNA binding site, which can comprise any site which could be recognized or bound by an miRNA, which can any sequence. ‘276 therefore reads on this limitation by the recitation of additional sequence elements separate from the 5’UTR. Claim 139 therefore recites a naturally occurring product of nature without additional structures or markedly different characteristics compared with the product of nature. Claim 139 is therefore not subject matter eligible.
Regarding claim 141, as evidenced by Pesole (page 96, right column, final paragraph), eukaryotic mRNAs naturally comprise 5’ cap structures. ‘276 therefore reads on claim 141 as it is a eukaryotic mRNA (page 96, left column, fourth paragraph of Pesole). Claim 141 therefore recites a naturally occurring product of nature and is not subject matter eligible.
Regarding claim 145, claim 145 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101. Specifically, claim 145 recites “a cell comprising the LNP composition of claim 143”. While claims immediately considered on merits recite a composition, the specification describes methods of treating a subject where the claimed cell comprising the LNP will be administered for treating or preventing a disorder (see paragraph 5 on page 138, paragraph 3 on page 151, final paragraph of page 158, and final paragraph of page 125). Furthermore, claims 146-150 recite a method of treatment. Accordingly, when the claimed LNP compositions in cells are delivered to a human subject, cells of the subject will comprise the composition claimed. Therefore, the claims would encompass cells in a human organism and the human organism itself.
Amending the claim to an isolated host cell or a host cell in vitro will be remedial.
Regarding claims 180-181, as evidenced by Chang (Chang H et al. Mol Cell. 2014 Mar 20;53(6):1044-52), eukaryotic mRNAs naturally comprise poly-A tails which are about 50-100 nucleotides (Summary). Thus, ‘276 inherently comprises a polyA tail which is about 80-100 nucleotides. Claims 180-181 therefore recite naturally occurring products of nature and are not subject matter eligible.
Response to Arguments
The Applicant’s argument filed 6/5/2026 have been considered but are not persuasive. The Applicant’s argues that their amendments overcome the original 101 rejection. This argument is persuasive. However, the Applicant’s amendments prompted a new search within the new scope of the claims. Thus, a new 101 rejection has been issued to address the new scope of the claims (above).
Double Patenting - Maintained
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 128, 130, 133, and 135-145 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 38, 52, 58, 61, 63, 72, and 73 of copending Application No. 18/849,675 (‘675 reference application). Although the claims at issue are not identical, they are not patentably distinct from each other.
Regarding claim 128, claim 1of ‘675 recites an mRNA comprising a 5’UTR, coding region, and 3’UTR. Furthermore, claim 38 depends from claim 1 of ‘675 and recites that the 5’UTR is SEQ ID NO: 50. SEQ ID NO: 50 is a 100% identical match to instant SEQ ID NO: 1 (see below, where SEQ ID NO: 50 is aligned with SEQ ID NO: 1, where the RNA equivalent is identical). Claim 38 is therefore drawn to the same subject matter of instantly recited claim 128.
ggaaatcgcaaaatttgctcttcgcgttagatttcttttagttttctcgcaactagcaagctttttgttctcgcc – SEQ ID NO: 50 (‘675)
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc -SEQ ID NO: 1, instant app.
Regarding claim 130, as discussed above, instant SEQ ID NO: 1 is identical to SEQ ID NO: 50 recited in ‘675 claim 38.
Regarding claim 133, SEQ ID NO: 50 comprises the same sequence as SEQ ID NO:1 of the instant application – the uridine content is therefore the same.
Regarding claim 135, SEQ ID NO: 50 of claim 38 of ‘675 comprises SEQ ID NO: 1.
Regarding claim 136, claim 136 recites a property which is inherent to the claimed structure of the 5’UTR; claim 38 of ‘675 therefore reads on claim 136 because they recite the same structure.
Regarding claims 137-138, claims 137-138 are broadly drawn to a 3’UTR of any sequence. Claim 38 of ‘675 comprises a 3’UTR owing to its dependency from claim 1 of ‘675, which recites a 3’UTR.
Regarding claim 139, claim 1 of ‘675 recites that the molecule comprises a TENT recruiting site and/or a miRNA binding site.
Regarding claim 140, claim 61 of ‘675 recites that the polypeptide can be a cytokine, which can reasonably be interpreted as a therapeutic payload.
Regarding claim 141, claim 52 recites that the mRNA comprises a cap.
Regarding claim 142, claim 58 recites that the mRNA comprises a modified base.
Regarding claim 143, claim 63 recites that the mRNA is in an LNP.
Regarding claim 144, claim 72 of ‘675 recites that the LNP is in a pharmaceutical composition.
Regarding claim 145, claim 73 of ‘675 recites that the LNP is in a cell.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 128, 130, 133, and 135-145 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 5, 6, 14, 15, 25, 26, of copending Application No. 18/572,490 (‘490 reference application). Although the claims at issue are not identical, they are not patentably distinct from each other.
Regarding claim 128, claim 1 of ‘490 recites an mRNA comprising a 5’UTR comprising SEQ ID NO: 50 and a coding region (i.e., “ORF”). SEQ ID NO: 50 is a 100% identical match to instant SEQ ID NO: 1 (see alignment below, RNA equivalents):
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc – SEQ ID NO: 50, ‘490
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc -SEQ ID NO: 1, instant app.
Claim 3 of ‘490 recites that the mRNA comprises a 3’UTR element. Thus, claim 3 of ‘490 is drawn to the same subject matter as instant claim 128.
Regarding claim 130, as discussed above, SEQ ID NO: 50 is identical to instant SEQ ID NO: 1.
Regarding claim 133, as discussed above, SEQ ID NO: 50 is identical to instant SEQ ID NO: 1, and therefore comprises the same uridine content.
Regarding claim 135, as discussed above, SEQ ID NO: 50 of ‘490 is identical to instant SEQ ID NO: 1.
Regarding claim 136, claim 136 is simply drawn to inherent characteristics of the mRNA. The structure of claim 3 therefore inherently reads on claim 136 because the structure is identical for the two mRNAs recited in both applications.
Regarding claims 137-138, these claims are broadly drawn to any sequence of 3’UTR, as the claims recite a fragment of the recited sequences. Claim 3 of ‘490 recites a 3’UTR, and thus reads on claims 137-138.
Regarding claim 139, with regards to the limitation that the sequence comprises an miRNA binding site, such a sequence can virtually be any sequence to which miRNA can be engineered to bind. The structure recited in ‘490 claim 3 therefore reads on claim 139.
Regarding claim 140, claim 1 of ‘490 recites that the mRNA encodes the human protein UGT1A1 which broadly reads on the claim language of a therapeutic payload.
Regarding claim 141, claim 5 of ‘490 recites that the mRNA comprises a cap.
Regarding claim 142, claim 6 of ‘490 recites a modified nucleotide in the mRNA.
Regarding claim 143, claim 26 of ‘490 recites that the mRNA is comprised in an LNP.
Regarding claim 144, claim 25 of ‘490 recites that the composition is comprised in a pharmaceutical composition.
Regarding claim 145, the claims of ‘490 do not recite that the composition is in a cell. However, given that the claims of ‘490 also claim pharmaceutical compositions and LNPs, a practitioner could immediately envision such a composition in a cell so as to deliver the pharmaceutical composition.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 128, 130, 133, and 135-145 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 5, 7, 10, 11, 14, 18, of copending Application No. 18/036,560 (‘560 reference application). Although the claims at issue are not identical, they are not patentably distinct from each other.
Regarding claim 128, claim 1 of ‘560 recites an mRNA comprising an ORF (coding region). Claim 2 recites that the mRNA comprises a 5’UTR with a sequence of SEQ ID NO: 25. SEQ ID NO: 25 is shown below aligned with instant SEQ ID NO: 1:
aggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc – SEQ ID NO: 25, ‘560
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc -SEQ ID NO: 1, instant app
Thus, SEQ ID NO: 25 comprises instant SEQ ID NO: 1. Furthermore, claim 7 recites that the mRNA comprises a 3’UTR. Thus, claims 1, 2, and 7 anticipate each structure of the instantly recited claim 128.
Regarding claim 130, as discussed above, SEQ ID NO: 25 of ‘560 is identical to instant SEQ ID NO: 1.
Regarding claim 133, as discussed above, SEQ ID NO: 25 of ‘560 is identical to instant SEQ ID NO:1 an therefore comprises the same uridine content.
Regarding claim 135, as discussed above, SEQ ID NO: 25 of ‘560 comprises SEQ ID NO: 1 of the instant application.
Regarding claim 136, claim 136 is simply drawn to inherent characteristics of the mRNA. The structure of claims 1, 2, and 7 and there combinations therefore inherently reads on claim 136 because the structure is identical for the two mRNAs recited in both applications.
Regarding claims 137-138, these claims are broadly drawn to any sequence of 3’UTR, as the claims recite a fragment of the recited sequences. Claim 7 of ‘560 recites a 3’UTR, and thus reads on claims 137-138.
Regarding claim 139, with regards to the limitation that the sequence comprises an miRNA binding site, such a sequence can virtually be any sequence to which miRNA can be engineered to bind. The structure recited in ‘560 claims 1, 2, and 7 therefore reads on claim 139.
Regarding claim 140, claim 1 of ‘560 recites a CFTR transmembrane protein as the encoded protein, which can reasonably be interpreted to be a therapeutic payload.
Regarding claim 141, claim 11 of ‘560 recites that the mRNA comprises a cap.
Regarding claim 142, claim 14 of ‘560 recites chemical modifications to the mRNA.
Regarding claim 143, claim 18 of ‘560 recites an LNP comprising the mRNA.
Regarding claim 144, claim 17 of ‘560 recites that the composition is comprised within a pharmaceutical composition.
Regarding claim 145, the claims of ‘560 do not recite that the composition is in a cell. However, given that the claims of ‘560 also claim pharmaceutical compositions and LNPs, a practitioner could immediately envision such a composition in a cell so as to deliver the pharmaceutical composition.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to Arguments
The Applicant’s arguments filed 6/5/2026 have been considered but are not persuasive. The Applicant argues that no outstanding rejections remain, and that the double patenting rejection should be withdrawn. This argument is not persuasive because as discussed above, multipole rejections of the claims remain. The Applicant offers no other argument. Thus, the double patenting rejection is maintained.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights