DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 146-150 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/20/2025.
In addition, the Applicant has elected the species of SEQ ID NO: 1 to read on the 5’UTR element, SEQ ID NO: 33 to read on the stop element, and SEQ ID NO: 126 to read on the 3’UTR element. Claims 129, 131, and 132 are withdrawn from examination because they are drawn to sequences of 5’UTRs (SEQ ID NOs 46, 41, and 42, respectively) which are not Applicant’s elected species of SEQ ID NO: 1. Claims 153-155 are withdrawn from examination because they are drawn to sequences (SEQ ID NOs (37, 56, and 57, respectively) which are not the Applicant’s elected species of stop element (i.e., SEQ ID NO: 33). Claims 160-168 are withdrawn from examination because they are drawn to a 3’UTR sequence (SEQ ID NO 11) which was not elected by the Applicant’s election of SEQ ID NO: 126.
Additionally, the Applicant recites in claim 134 that the 5’UTR comprises a Kozak sequence, which is defined in the specification as “GCCRCC,” (page 139 second paragraph) or “CCRCCAUGG,” (page 189, second paragraph). The elected species of SEQ ID NO: 1 does not comprise either of these sequences. Claim 134 therefore does not read on Applicant’s election and is withdrawn.
The Applicant has elected an mRNA with a structure comprising SEQ ID NO: 1 for the 5’UTR, SEQ ID NO: 33 for a stop element, and SEQ ID NO: 126 for a 3’UTR. An mRNA comprising all of these structures in combination was found to be free of the art. The search was therefore expanded to additional embodiments recited.
Application Status
This action is written in response to applicant’s correspondence received on 7/23/2024. Claims 128-168 are pending. Claims 1-127 have been previously cancelled. Claims 129, 131, 132, 134, 146-150, 153-155, and 160-168 are withdrawn from examination as they are drawn to non-elected species (see “Election/Restrictions,” above). Claims 128, 130, 133, 135-145, 151-152, 156-159 are currently under examination.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 136-138, 151 and 156-159 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 136, claim 136 recites “an increased half-life of the mRNA” and “an increased level and/or activity of the polypeptide encoded by the mRNA.” Claim 136 is indefinite because it is unclear to what “level” the increase is meant to be compared with. Examples 1-37 of the specification recite comparative levels of mRNA relative to references A1, B1, and C1 for each of the 5’UTR, stop element, and 3’UTR elements, respectively. The specification does not offer a clear definition of “an increased level” with respect to what an initial “level” is being compared with. It is therefore unclear what an ”increased” level would mean as presently recited without a clear definition of an initial “level” with which to compare.
Furthermore, it is unclear how the presence of a 5’UTR would increase the activity of a polypeptide, where such claim language reasonably encompasses activity of a protein such as enzymatic functionality. The relationship between the existence of the 5’UTR and how it would affect a protein’s enzymatic functionality is unclear. The specification does not offer a definition or guidance with regards to how the UTR element would increase the activity of a polypeptide, where the term “activity” is not defined. The specification recites that:
“In an embodiment, the increase in level and/or activity, e.g., output, of the polypeptide encoded by the polynucleotide is measured according to an assay that measures the level and/or activity of a polypeptide, e.g., an assay described in any one of Examples disclosed herein,” (page 130, second paragraph).
The assays disclosed in Examples 1-37 relate to the detection of reporter genes such as fluorescent proteins. The specification does not recite or describe how or if the 5’UTR has any effect on the activity of the fluorescence of the reporter genes but instead show an increased level of expression, which is not directed correlated to the individual intensity of a given fluorescent protein.
Regarding claim 137, claim 137 recites “Table 2,” “Table 3,” and “Table 4.” MPEP 2173.05(s) states that: “[w]here possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table 'is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.' Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993)" (MPEP 2173.05(s)). Claim 137 is therefore rejected under 112(b) because the claims can not reference a table or figure where it is reasonable to incorporate the contents of the table into the claims.
Furthermore, claim 137 also recites “e.g.,”. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 137 recites the broad recitation of a stop element from Table 3, and the claim also recites examples of such elements which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
Claim 138 depends from claim 137 and does not address the 112(b) issues and is therefore also rejected.
Claim 151 recites “Table 3.” As discussed in the rejection of claim 137, claims which recite elements such as tables are properly rejected under 112(b).
Claims 156-159 depend from claim 151 and do not resolve this 112(b) issue and are therefore also rejected.
Regarding claim 156, claim 156 recites that the stop element results in an “increased half-life of the mRNA” and “an increased level and/or activity of the polypeptide encoded by the mRNA.” Claim 156 is indefinite because it is unclear to what level is being compared which would be “increased” relative to the presence of the stop element. Furthermore, it is unclear how the presence of the stop element would result in the “activity” of a polypeptide, which reasonably includes proteins such as enzymes with specific functionality. Thus, claim 156 recites similar 112(b) issues as those recited in claim 136 and is rejected for the same reason (see rejection of claim 136, above).
Regarding claim 157, claim 157 recites “Table 1,” “Table 2,” and “Table 4.” As discussed above in the rejection of claim 137, it is improper to reference a Table in the claims as presently recited, where the reference to a Table is properly rejected under 112(b).
Claims 158 and 159 depend from claim 157 and do not resolve this 112(b) issue and are therefore also rejected under 112(b).
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 128, 130, 133, 135-145, 151-152, 156-159 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Regents of the University of California v. Eli Lilly & Co, 119 F.3d at 1568, 43 USPQ2d at 1406.
Nature of the Invention/Breadth of Claims
Regarding independent claim 128, claim 128 recites an mRNA molecule comprising a 5’UTR comprising SEQ ID NO: 1 or a variant or fragment thereof, where the mRNA molecule is further recited to comprise a coding region and stop element and 3’UTR. Claim 151 is also drawn to an mRNA molecule, where claim 151 recites that the mRNA molecule comprises a 5’UTR element, a coding region with stop element from Table 3, and a 3’UTR element. The independent claims are therefore claiming a genus of mRNA molecule where essentially any combination of 5’UTR and 3’UTR elements can be used, as claim 128 recites a “variant” or “fragment” of SEQ ID NO: 1, which includes any various number of changes to the sequence, while claim 151 is drawn broadly to the categories of UTR elements. This claim language therefore encompasses an enormous number of potential molecules comprising various combinations of each of the three recited elements of the claims (5’UTR, coding region with stop element, and 3’UTR). This claim language is problematic because it is known in the art that variability and complexity exists within the genus of UTR elements recited. Furthermore, the specification does not provide adequate demonstration or guidance to show sufficient possession of the broadly claimed genus of molecules.
Additionally, claim 151 recites a stop element from Table 3. Table 3 recites numerous embodiments which allow for various sequence substitutions and alterations (e.g., SEQ ID NOs 37 and 56-57). As discussed further below, the stop elements of the application appear to show variable and unpredictable activity, where common core structures of the sequences with relation to their functionality was not shown to be in possession by the Applicant.
Guidance Provided in the Specification
As an initial matter, the specification defines “variant” at page 127, third paragraph, to mean a molecule having at least 50-100% “activity” of, or structural similarity to, the wild-type molecule. Thus, recitation of the term “variant” in each of the claims of the application includes molecules which not only vary by 50% sequence, but also with unrelated sequence which have the same level of activity. Proper guidance is not provided in the specification which would lead a practitioner to a separate 5’UTR element with the same activity of, for instance, SEQ ID NO: 1, but with a different sequence, as is reasonably encompassed by the definition given for “variant.” Such “variants” are therefore not defined by a specific sequence, and a practitioner has no guidance for completely different, untested sequences of UTRs with equivalent “activity” of SEQ ID NO: 1.
Furthermore, “fragment” is defined at page 116, fourth paragraph, to mean simply a portion. Thus, a fragment could potentially be any portion of, for instance, SEQ ID NO: 1 without lower limits, which would include for instance one nucleotide from SEQ ID NO: 1. However, no experimentation exists to demonstrate such relevant portions of SEQ ID NO: 1 which identify a core structure required for functionality, and it is unknown what truncations or fragments would render functional UTRs.
With regards to the examples offered in the specification, the Applicant offers examples 1-37. Example 1 reviews screening for 5’UTRs, where “A1” is chosen (SEQ ID NO: 1), for its beneficial properties. Furthermore, it is stated in Example 1 that “most 5' UTRs associated with substantial increases in expression had some attribute that precluded their broad utility,” (page 280, second paragraph). Thus, the specification itself acknowledges that not some, or a few, but “most” 5’UTRs comprise attributes which negatively affect their utility, and therefore acknowledges that large portions of UTRs are not utile for the intended purposes owing to unpredictable attributes of the molecules. Example 1 characterizes A1 relative to a “reference” UTR (“A11”) and recites that A1 appears to have increased expression. Examples 2-6 describe testing of A1/A11 testing in various backgrounds (in vivo, various cell types) and demonstrates increased expression using A1 relative to A11.
Example 7 recites testing of variants of A1, in the form of A2 and A3 (i.e., SEQ ID NOs 41 and 42). Example 7 reports that variants A2 and A3 show similar expression levels of A1, while Example 8 demonstrates in vivo testing and expression using A2 and A3.
Example 9 recites the discovery of 3’UTR sequences with increased mRNA half-life, where it is stated that 120,000 3’UTRs were pooled, modeled, and tested, however, data for only 9 such UTRs is shown. Applicants recite that 3’UTR “B1” (i.e., SEQ ID NO: 11), showed improved half-life.
Example 10 recites the identification of stop elements C1-C11, where such elements were identified through modeling and testing and demonstrated improved half-life of mRNA.
Example 11 states that stop elements C1, C3-5 and C11 demonstrate increased expression of a target protein when incorporated into mRNA. Data is shown in Figure 12. Data for stop elements C2 and C6-10 is not shown.
Example 12 recites that stop elements were incorporated into mRNA and tested in in vivo models to show increased expression of target protein. Stop elements C7, C8, and C10, which were different from those tested in Example 11, are shown in Figure 13, where incorporation of such stop elements appears to show increased expression of protein.
Example 13 shows data for stop elements incorporated in mRNA to express a reporter construct, where C3, C4, and C6 were tested, where C6 appears to show only a modest increase relative to the reference stop element.
Example 14 focuses on variant protein expression when stabilizing tail elements are added. Examples 15-16 demonstrates the application of 5’UTR element A1 in the context of LNP in vivo administration, where furthermore the 5’UTR element appears to show synergistic effects in combination with a stabilizing tail to increase protein expression.
Example 17 demonstrates the combination of the A1 5’UTR element and 3’UTR B1 element, where such a combination of the two elements increased protein expression in an in vivo model. Example 18 demonstrates increased protein expression when the 5’UTR A1 is paired with the 3’UTR B1 in bronchial epithelial cells.
Example 19 shows an experiment where stop elements C1, C3, C5, C7, and C9 were used in a reporter assay to test stop codon readthrough, where the results indicate that no such reporter activity was observed for GFP in the study indicating no evidence of stop codon readthrough.
Examples 20-26 recite experiments demonstrating the incorporation of stop elements C1, C5, and C7-10 into mRNAs in different cell types/in vivo models using various reporter proteins. Notable, Example 22 references Figure 21A and shows stop element C5 with a noticeable decrease in luminescence relative to the reference C1 (Figure 21A). Similarly, stop element C8 appears to show a lower average level of fluorescence compared with C1 (Figures 21A-21C); there therefore appears to be unpredictability and variability concerning stop elements tested.
Examples 27-31 recite various in vitro and in vivo experiments reducing to practice mRNA molecules comprising 5’UTRs such as A1 and A3 and stop elements (from C1-C11) tested in combination with one another, where protein expression is measured relative to a control.
Examples 32-33 recite experiments related to testing mRNAs comprising the 3’UTR B18 compared with a reference 3’UTR B10, where in vitro and in vivo experiments using various reporter molecules show an increased in target protein expression when B18 was used.
Example 34 recites an experiment testing other 5’UTR sequences A12, A14, A15, A18, A20, A26, A27, and the A11 reference. Example 34 recites that “at least A20, A26, A15, and A18” were associated with increased relative fluorescence per Figures 35A-35B. However, Figure 35 in fact appears to show that A20 and A26 are comparable if not lower in expression (e.g., A20) than the reference. Thus, Example 34 shows variability and unpredictability in using 5’UTRs depending on their sequence, where not all 5’UTRs work to the same degree relative to a given reference.
Example 35 recites an in vivo experiment where mRNAs comprising 5’UTR elements A12, A14, A20, A26, A27, A15, and reference A11 were tested, where an increase in protein expression of a fluorescent reporter was observed upon introduction of the 5’UTR elements. Of note, protein expression level of the mRNA comprising A26 appears to be comparable to the reference A11 in the tested liver cells (Figure 36C). Thus, the 5’UTRs appear to show some variability and unpredictability with respect to the cell type and timepoint in the experiments of Example 35 (Figure 36).
Examples 36-37 relate to the production of different formulations of lipid nanoparticles.
Taken together, the Applicant appears to have tested a handful of mRNA elements including 5’UTRs, stop elements, and 3’UTRs, where the Applicant acknowledges variability in 5’UTR sequences and their potential to be used, stating that “most 5' UTRs associated with substantial increases in expression had some attribute that precluded their broad utility,” (page 280, second paragraph). Furthermore, UTRs and stop elements did not all appear to have increased protein expression levels per Figures 21 and 35-36. The specification therefore does not show sufficient possession of the embodiments of variations in the stop element sequences recited in Table 3. The specification offers no guidance with respect to “variants” which comprise different sequences but have the same activity of, for instance, SEQ ID NO: 1. Furthermore, no common structure-function relationship is established to define the recited genera.
State of the Art
Regarding the state of the art, it is known in the art that UTR regions used in different combination with one another are known to be unpredictable and variable, where furthermore such regions are known to be complex and subject to dramatic variations in functionality dependent upon their lengths.
For instance, Kirshina (Kirshina A et al. Biomolecules. 2023 Nov 20;13(11):1677), a post-filing research article which reflects a general scientific truth which was also true at the time of filing, teaches that:
“in a 5′UTR, complicated secondary structures can occur, such as a G-quadruplex and pseudoknot. G-quadruplexes are guanine-rich structures that fold into a noncanonical tetrahelical structure with potassium ions (K+) chelated inside and are highly stable outside cells at temperatures above the physiological. Some papers have shown that G-quadruplexes can block translation both outside cells (when tested on human NRAS proto-oncogene mRNA) and in eukaryotic cells (when tested on the Zic1 zinc finger protein mRNA). On the other hand, the effects of G-quadruplexes in cells remain to be studied in more detail, because apparently, in many mRNAs, G-quadruplexes are in a linear form. Pseudoknots are complicated intramolecular mRNA conformations that form a knot-like three-dimensional structure and contain at least two hairpins. This structure has been found in the 5′UTR of human interferon gamma (IFNG) mRNA; this pseudoknot participates in a feedback process by regulating mRNA translation through protein kinase R signaling to prevent excess interferon synthesis,” (Introduction, page 2, second paragraph).
Thus, Kirshina teaches that 5’UTR regions can adopt complicated and relatively uncharacterized secondary structures which can directly affect translation of proteins within a cell. Thus, the general category of a 5’UTR element with a variation in sequence broadly encompasses unknown secondary structures, where the effects of such secondary structures can affect the translation potential of mRNAs in unpredictable ways.
Concerning 3’UTR elements, Kirshina teaches that:
“Various RBPs also associate with 3′UTR sequences, but binding sites for some RBPs have not been identified. Nonetheless, even in the case of a known sequence of binding sites, a direct relation between the presence of a landing site and RNA stability has been difficult to discern because some RBPs stabilize RNA, some destabilize it, and others can modulate RNA stability in a context-dependent manner, as is the case for PCBP2. It should also be pointed out that the impact of most RBPs on the stability and translational efficiency of mRNA is poorly investigated. Among the best-known RBPs that bind to a 3′UTR is polypyrimidine tract–binding protein (PTB), which associates with CU-rich elements, thereby forming large loops (in RNA) important for modulation of the interaction of factors necessary for splicing,” (page 3, third paragraph)
Thus, 3’UTR can comprise unknow RBP binding sites, where such binding can either stabilize, destabilize, or affect translation in unidentified and context-specific manners, where furthermore Kirshina teaches that the impact of RBPs and the stability and translational efficiency of mRNA is “poorly investigated.” The art therefore teaches known unpredictability in the broad category of “3’UTR” presently recited.
Concerning the use of such UTRs in the context of heterologous mRNA expression, Kirshina teaches that:
“Of note, despite active research into the properties of UTRs, the number of studies assessing the contribution of certain UTRs to the expression of heterologous RNAs is rather small,” (page 3, fourth paragraph).
Thus, Kirshina teaches that there are relatively few studies concerning the contribution of UTRs to the expression of heterologous RNA, such as a coding region encompassed by the claims.
With regards to the use of combinations of various 5’ and 3’ UTRs, Kirshina teaches that:
“In addition to the choice of individual UTRs, another question is whether protein expression depends on a specific combination of a 5′UTR and 3′UTR. Although a 5′UTR and 3′UTR do not interact directly during translation, it has been demonstrated by means of p53 mRNA as an example that the 5′UTR and 3′UTR contain complementary regions that bind translation factor RPL26, which mediates translation enhancement in response to DNA damage. Thus, the aim of the current study was to find optimal combinations of a 5′UTR and 3′UTR to improve protein synthesis and mRNA stability,” (page 3, fifth paragraph).
Kirshina therefore teaches that, in addition to the complexity of choosing individual UTR sequences, 5’ and 3’UTRs are also known to interact with each other in order to affect overall changes in translation efficiency; thus, the genus of mRNA is complex and unpredictable when considering how such 5’ and 3’ UTR combinations would behave in different combinations with one another, as well as their variants.
To further elaborate upon the importance of 5’ and 3’UTR interactions, Chen (Chen et al. Genes Dev. 2010 Oct 1;24(19):2146-56) is a research article focused on 5’ and 3’ UTR interactions and their effects on p53 translation efficiency (Title, Abstract, throughout). Chen teaches that:
“Mutating as few as 3 bases in either of the two complementary UTR sequences abrogates the ability of RPL26 to bind to p53 mRNA and stimulate p53 translation,” (Abstract)
and:
“We report here that translation of human p53 mRNA is regulated by base-pairing interactions between 5′- and 3′-UTR sequences. Mutations that disrupt the interaction abolish the binding of RPL26 to human p53 mRNA and diminish RPL26-dependent p53 induction,” (Introduction, page 2147 left column, second paragraph and Figure 2A).
Thus, Chen teaches that 5’UTRs and 3’UTRs can interact with each other to form complimentary base pairings which have an overall effect on translational efficiency. Chen therefore teaches that there is a known mechanism in the art which relies upon the sequences of the 5’ and 3’ UTRs, where such mechanisms are sequence dependent and can have effects on translational efficiency. Kirshina and Chen therefore teach synergistic and antagonistic effects of variations in UTR sequences, where such sequences can act in partnership to recruit translational machinery (Kirshina, above) or to form additional mRNA structures by complementation (Chen). The pairing of 5’ and 3’UTR sequences is therefore an additional complexity to the recited invention, where a practitioner is not provided with guidance on how any such 5’ and 3’UTRs should be paired with the exception of the few examples reduced to practice.
Furthermore, with regard to “fragments” of such UTR sequences, it is known in the art that not all fragmented portions of UTRs efficiently function as UTR elements. For instance, Tanguay (Tanguay RL et al. Mol Cell Biol. 1996 Jan;16(1):146-56) is a research article focused on the effects of length and 3’UTR functionality. Tanguay teaches that shortening 3’UTR segments can dramatically reduce the overall translation efficiency of the mRNA (Abstract). Thus, the genus of “fragments” recited is unpredictable, as not all fragments of 3’UTRs are functional.
Similarly, it is also known that fragmentation of 5’UTRs is known to have dramatic effects on translational efficiency, as taught by Hinnebusch (Hinnebusch AG et al. Science. 2016 Jun 17;352(6292):1413-6). Hinnebusch teaches that reducing 5’UTR lengths to shorter 5’UTRs can dramatically reduce translational efficiency (page 2, final paragraph).
Thus, it was known in the art that both 5’UTR and 3’UTR lengths play critical roles in translational efficiency, where furthermore their sequences are critical for 5’/3’UTR interactions and/or translational protein recruitment. The category of such UTRs and their combinations are therefore highly unpredictable, where furthermore the claimed invention has an added layer of complexity in the sense that the components are recited with variations used in combination with each other.
The Applicant has therefore not shown possession of the broadly recited genus of mRNA molecules commensurate in scope with what is presently recited owing to the complex and unpredictable nature of the genus.
The claims which depend from independent claims 128 and 151 do not resolve these 112(a) issues and are therefore also rejected.
Claim 135, which recites that the 5’UTR comprises SEQ ID NO:1, does not resolve the issue because, although the claim is drawn to a 5’UTR comprising a tested sequence, the claim also encompasses other combinations of 3’UTR to be used with the 5’UTR, where 5’UTRs and 3’UTRs are known to function together in context-specific manners (above).
Claims 136 and 156 recite additional limitations, such that the mRNAs are recited to increase the half-life of an mRNA, or the level/activity of a polypeptide. The Applicant has not shown possession of which combinations of the unpredictable mRNA elements would lead to such functional outcomes.
Additionally, claim 137-138, while reciting additional sequence limitations, recites the stop elements and 3’UTR in the alternative, where the 3’UTR is recited as a “fragment” as an embodiment of the claim. Thus, claim 137 is drawn to an mRNA comprising essentially any sequence, and is rejected for the reasons outlined in claim rejection of claim 128.
Claim 152, while limiting the stop element sequence, still recites the broad and unpredictable genera of 5’ and 3’UTR elements, where the Applicant has not shown possession of such a broad category of molecules .
Claims 157-159, while reciting additional sequences as limitations, is still broadly drawn to “fragments” of these sequences, which could be any number of sequence. Thus, claims 157-159 are not narrowed to specific SEQ ID numbers recited and is rejected for the reasons outlined above.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 128, 130, 133, and 136-141 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by NM 020034 (hereafter ‘034, NCBI BLAST Accession number NM 020034, published 11/3/2017)as evidenced by Pesole (Pesole G et al. Gene. 1997 Dec 31;205(1-2):95-102).
Regarding claim 128, as discussed in the above section entitled “Election/Restrictions,” the Applicant’s elected species, an mRNA comprising SEQ ID NO: 1, SEQ ID NO: 33, and SEQ ID NO: 126, was not found in the art. Thus, the search has been expanded to additional embodiments of the claim. Claim 128 is broadly drawn to an mRNA comprising SEQ ID NO: 1 or a fragment thereof, a coding region comprising a stop element, and a 3’UTR. Regarding these claim limitations, ‘034 is an NCBI accession number for histone cluster in mice (Title, and page 1). An alignment of ‘034 and SEQ ID NO: 1 is shown below, with SEQ ID NO: 1 on the top row (also reproduced on page 1 of ‘034):
PNG
media_image1.png
378
1021
media_image1.png
Greyscale
As shown above, with the exception of the first four bases, ‘034 is a 100% match of SEQ ID NO: 1, and therefore reasonably can be interpreted as a “fragment” of SEQ ID NO: 1. Furthermore, ‘034 teaches that the nucleotide encoded is an “mRNA,” (Title). Furthermore, ‘034 comprises a coding region (example “CDS,” bottom of page 2). Additionally, as evidenced by Pesole, eukaryotic mRNAs, as ‘034 is defined and identified to be, comprise 3’UTRs and stop codons (e.g., Introduction paragraphs 2-5, page 96 left column, paragraph 4). Thus, ‘034 reads on the claim elements of instantly recited claim 128, as ‘034 is an mRNA comprising a fragment of SEQ ID NO: 1, comprises a coding region in an mRNA, which furthermore comprises a stop codon and 3’UTR as defined.
Regarding claim 130, as discussed above, the 5’UTR of ‘034 is a fragment with 100% sequence identity to SEQ ID NO: 1.
Regarding claim 133, the specification defines uridine content as being interchangeable with uracil content. ‘034 and its mRNA equivalent therefore read on claim 133, as the “uridine” content of SEQ ID NO: 1, on which ‘034 reads, is at least 5%:
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc – SEQ ID NO: 1
Uracil total = 30, 30/75(i.e., total length) = 40% uracil content
Regarding claim 136, claim 136 simply recites properties of recited mRNA, which are inherent to the mRNA. Furthermore, recitation of “increased” characteristics are not given in relation to anything. Therefore, the recitation does not add or change the structural characteristics of claim 128, as such an “increase” could simply be in comparison to a non-functional embodiment of an mRNA (i.e., zero half-life or polypeptide activity). Claim 136 broadly includes relative comparison to any level of activity; ‘034 therefore reads on the claim.
Regarding claims 137-138, claims 137-138 recite in the alternative a fragment of a given 3’UTR, which could be any sequence. ‘034 therefore reads on claim 137 because it comprises additional sequences after the 5’UTR fragment.
Regarding claim 139, claim 139 only recites a miRNA binding site, which can comprise any site which could be recognized or bound by an miRNA, which can any sequence. ‘034 therefore reads on this limitation by the recitation of additional sequence elements separate from the 5’UTR.
Regarding claim 140, as discussed above, ‘034 encodes a coding sequence (“CDS,” page 2). Furthermore, the specification broadly defines a therapeutic or prophylactic payload as simply a payload (specification at page 177, second paragraph). ‘034 therefore reads on the broadest reasonable interpretation of claim 140.
Regarding claim 141, as evidenced by Pesole (page 96, right column, final paragraph), eukaryotic mRNAs naturally comprise 5’ cap structures. ‘034 therefore reads on claim 141 as it is a eukaryotic mRNA, or at the very least because a practitioner or ordinary skill in the art could immediately envision such an mRNA comprising a 5’ cap or naturally occurring poly adenylation stabilizing region (page 96, left column, fourth paragraph of Pesole).
Claims 151-152 and 156-159 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by GenBank EZ971123 (hereafter ‘123, GenBank Accession Number EZ971123, published 1/24/2011) as evidenced by Pesole (Pesole G et al. Gene. 1997 Dec 31;205(1-2):95-102).
Regarding claim 151, claim 151 is drawn to an mRNA molecule comprising a 5’UTR, a coding region with a stop element selected from Table 3, and a 3’UTR element. The Applicant has elected the stop element SEQ ID NO: 33. Claim 151 broadly encompasses an mRNA, where the limitations of 5’UTR and 3’UTR do not add specific structural requirements to the claim, and can in effect be any sequence. Thus, claim 151 is most broadly drawn to an mRNA which comprises SEQ ID NO: 33.
‘123 is identified as an mRNA molecule which occurs in Anopheles funestus (Title of ‘123, page 1). The reverse transcription of residues 283-297 (i.e., the mRNA copy of ‘123) is aligned with SEQ ID NO: 33 below:
PNG
media_image2.png
68
261
media_image2.png
Greyscale
Thus, as seen above, ‘123 is an mRNA which comprises the element of SEQ ID NO: 33, where furthermore ‘123 comprises additional elements upstream and downstream of the element, which can reasonably be interpreted to by both 5’ and 3’ UTRs. Furthermore, as evidenced by Pesole, such mRNAs as those taught by ‘123 comprise 5’ UTRs, coding sequences (e.g., start codon), stop elements (e.g., stop codon), and 3’ UTRs (page 96, left column, fourth paragraph). ‘123 therefore reads on the presently recited claim limitations, as it is an mRNA comprising SEQ ID NO: 33.
Regarding claim 152, as discussed above, ‘123 comprises the sequence of SEQ ID NO: 33.
Regarding claim 156, claim 156 simply recites properties of recited the mRNA, which are inherent to the mRNA. Furthermore, recitation of “increased” characteristics are not given in relation to anything. Therefore, the recitation does not add or change the structural characteristics of claim 156, as such an “increase” could simply be in comparison to a non-functional embodiment of an mRNA (i.e., zero half-life or polypeptide activity). Claim 156 broadly includes relative comparison to any level; ‘123 therefore reads on the claim.
Regarding claims 157-159, while these claims broadly recite 5’UTR and/or 3’UTR sequences, such sequences are recited with the additional limitation which allows for variants or “fragments” of such sequences, which reasonably includes any such variants or fragments to include any sequence. Thus, in the broadest interpretation of claim 157, ‘123 reads on such sequences as ‘123 comprises additional sequences in addition to SEQ ID NO: 33.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 128, 130, 133, 136-141, 145, 151-152 and 156-159 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a naturally occurring product of nature without significantly more.
Regarding claim 128, claim 128 is broadly drawn to an mRNA comprising SEQ ID NO: 1 or a fragment thereof, a coding region comprising a stop element, and a 3’UTR. Regarding these claim limitations, NM 020034 (hereafter ‘034, NCBI BLAST Accession number NM 020034, published 11/3/2017) is an NCBI accession number for a naturally occurring histone cluster in mice (Title, and page 1). An alignment of ‘034 and SEQ ID NO: 1 is shown below, with SEQ ID NO: 1 on the top row (also reproduced on page 1 of ‘034):
PNG
media_image1.png
378
1021
media_image1.png
Greyscale
As shown above, with the exception of the first four bases, ‘034 is a 100% match of SEQ ID NO: 1, and therefore reasonably can be interpreted as a “fragment” of SEQ ID NO: 1. Furthermore, ‘034 teaches that the nucleotide encoded is an “mRNA,” (Title). Furthermore, ‘034 comprises a coding region (example “CDS,” bottom of page 2). Additionally, as evidenced by Pesole (Pesole G et al. Gene. 1997 Dec 31;205(1-2):95-102), eukaryotic mRNAs, as ‘034 is defined and identified to be, comprise 3’UTRs and stop codons (e.g., Introduction paragraphs 2-5, page 96 left column, paragraph 4). Thus, ‘034 reads on the claim elements of instantly recited claim 128, as ‘034 is an mRNA comprising a fragment of SEQ ID NO: 1, comprises a coding region, which furthermore comprises a stop codon and 3’UTR as defined. Claim 128 therefore recites a naturally occurring mRNA found within the mouse genome (step 2A, prong 1). Claim 128 does not recite additional claim limitations to integrate the naturally occurring product into a practical application (step 2A, prong 2) nor are there additional claim elements to transform the claim into significantly more (step 2B). Thus, claim 128 is not patent eligible subject matter because it is drawn to a naturally occurring mRNA without markedly different characteristics.
Regarding claim 130, as discussed above, the 5’UTR of ‘034 is a fragment with 100% sequence identity to SEQ ID NO: 1.
Regarding claim 133, the specification defines uridine content as being interchangeable with uracil content. ‘034 and its mRNA equivalent therefore read on claim 133, as the “uridine” content of SEQ ID NO: 1, on which ‘034 reads, is at least 5%:
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc – SEQ ID NO: 1
Uracil total = 30, 30/75(i.e., total length) = 40% uracil content
Regarding claim 136, claim 136 simply recites properties of recited mRNA, which are inherent to the mRNA. Furthermore, recitation of “increased” characteristics are not given in relation to anything. Therefore, the recitation does not add or change the structural characteristics of claim 128, as such an “increase” could simply be in comparison to a non-functional embodiment of an mRNA (i.e., zero half-life or polypeptide activity).
Regarding claims 137-138, claims 137-138 recite in the alternative a fragment of a given 3’UTR, which could be any sequence. ‘034 therefore reads on claim 137 because it comprises additional sequences after the 5’UTR fragment.
Regarding claim 139, claim 139 only recites a miRNA binding site, which can comprise any site which could be recognized or bound by an miRNA, which can any sequence. ‘034 therefore reads on this limitation by the recitation of additional sequence elements separate from the 5’UTR.
Regarding claim 140, as discussed above, ‘034 encodes a coding sequence (“CDS,” page 2). Furthermore, the specification broadly defines a therapeutic or prophylactic payload as simply a payload (specification at page 177, second paragraph). ‘034 therefore reads on the broadest reasonable interpretation of claim 140.
Regarding claim 141, as evidenced by Pesole (page 96, right column, final paragraph), eukaryotic mRNAs naturally comprise 5’ cap structures. ‘034 therefore reads on claim 141 as it is a eukaryotic mRNA.
Regarding claim 145, claim 145 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101. Specifically, claim 145 recites “a cell comprising the LNP composition of claim 143”. While claims immediately considered on merits recite a composition, the specification describes methods of treating a subject where the claimed cell comprising the LNP will be administered for treating or preventing a disorder (see paragraph 5 on page 138, paragraph 3 on page 151, final paragraph of page 158, and final paragraph of page 125). Furthermore, claims 146-150 recite a method of treatment. Accordingly, when the claimed LNP compositions in cells are delivered to a human subject, cells of the subject will comprise the composition claimed. Therefore, the claims would encompass cells in a human organism and the human organism itself.
Amending the claim to an isolated host cell or a host cell in vitro will be remedial.
Regarding claim 151, claim 151 is drawn to an mRNA molecule comprising a 5’UTR, a coding region with a stop element selected from Table 3, and a 3’UTR element. Claim 151 broadly encompasses an mRNA, where the limitations of 5’UTR and 3’UTR do not add specific structural requirements to the claim, and can in effect be any sequence. Thus, claim 151 is most broadly drawn to an mRNA which comprises SEQ ID NO: 33.
GenBank EZ971123 (hereafter ‘123, GenBank Accession Number EZ971123, published 1/24/2011) is a published mRNA from a mosquito species Anopheles funestus (Title, page 1). ‘123 is identified as an mRNA molecule which occurs in Anopheles funestus (Title of ‘123, page 1). The reverse transcription of residues 283-297 (i.e., the mRNA copy of ‘123) is aligned with SEQ ID NO: 33 below:
PNG
media_image2.png
68
261
media_image2.png
Greyscale
Thus, as seen above, ‘123 is an mRNA which comprises the element of SEQ ID NO: 33, where furthermore ‘123 comprises additional elements upstream and downstream of the element, which can reasonably be interpreted to by both 5’ and 3’ UTRs. Furthermore, as evidenced by Pesole, such mRNAs as those taught by ‘123 comprise 5’ UTRs, coding sequences (e.g., start codon), stop elements (e.g., stop codon), and 3’ UTRs (page 96, left column, fourth paragraph). ‘123 therefore reads on the presently recited claim limitations, as it is an mRNA comprising SEQ ID NO: 33. Claim 151 is therefore drawn to the naturally occurring mRNA ‘123 (Step 2A, prong 1). Claim 151 does not recite additional limitations which integrate the natural product into a practical application (Step 2A, prong 2) or transform the claim into significantly more than the judicial exception (Step 2B); claim 151 is therefore most broadly drawn to the naturally occurring product of nature ‘123 and is not patent eligible.
Regarding claim 152, as discussed above, ‘123 comprises the sequence of SEQ ID NO: 33.
Regarding claim 156, claim 156 simply recites properties of recited the mRNA, which are inherent to the mRNA. Furthermore, recitation of “increased” characteristics are not given in relation to anything. Therefore, the recitation does not add or change the structural characteristics of claim 156, as such an “increase” could simply be in comparison to a non-functional embodiment of an mRNA (i.e., zero half-life or polypeptide activity). Claim 156 broadly includes relative comparison to any level; ‘123 therefore reads on the claim.
Regarding claims 157-159, while these claims broadly recite 5’UTR and/or 3’UTR sequences, such sequences are recited with the additional limitation which allows for variants or “fragments” of such sequences, which reasonably includes any such variants or fragments to include any sequence. Thus, in the broadest interpretation of claim 157, ‘123 reads on such sequences, as ‘123 comprises additional sequences in addition to SEQ ID NO: 33.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 128, 130, 133, and 135-145 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 38, 52, 58, 61, 63, 72, and 73 of copending Application No. 18/849,675 (‘675 reference application). Although the claims at issue are not identical, they are not patentably distinct from each other.
Regarding claim 128, claim 1of ‘675 recites an mRNA comprising a 5’UTR, coding region, and 3’UTR. Furthermore, claim 38 depends from claim 1 of ‘675 and recites that the 5’UTR is SEQ ID NO: 50. SEQ ID NO: 50 is a 100% identical match to instant SEQ ID NO: 1 (see below, where SEQ ID NO: 50 is aligned with SEQ ID NO: 1, where the RNA equivalent is identical). Claim 38 is therefore drawn to the same subject matter of instantly recited claim 128.
ggaaatcgcaaaatttgctcttcgcgttagatttcttttagttttctcgcaactagcaagctttttgttctcgcc – SEQ ID NO: 50 (‘675)
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc -SEQ ID NO: 1, instant app.
Regarding claim 130, as discussed above, instant SEQ ID NO: 1 is identical to SEQ ID NO: 50 recited in ‘675 claim 38.
Regarding claim 133, SEQ ID NO: 50 comprises the same sequence as SEQ ID NO:1 of the instant application – the uridine content is therefore the same.
Regarding claim 135, SEQ ID NO: 50 of claim 38 of ‘675 comprises SEQ ID NO: 1.
Regarding claim 136, claim 136 recites a property which is inherent to the claimed structure of the 5’UTR; claim 38 of ‘675 therefore reads on claim 136 because they recite the same structure.
Regarding claims 137-138, claims 137-138 are broadly drawn to a 3’UTR of any sequence. Claim 38 of ‘675 comprises a 3’UTR owing to its dependency from claim 1 of ‘675, which recites a 3’UTR.
Regarding claim 139, claim 1 of ‘675 recites that the molecule comprises a TENT recruiting site and/or a miRNA binding site.
Regarding claim 140, claim 61 of ‘675 recites that the polypeptide can be a cytokine, which can reasonably be interpreted as a therapeutic payload.
Regarding claim 141, claim 52 recites that the mRNA comprises a cap.
Regarding claim 142, claim 58 recites that the mRNA comprises a modified base.
Regarding claim 143, claim 63 recites that the mRNA is in an LNP.
Regarding claim 144, claim 72 of ‘675 recites that the LNP is in a pharmaceutical composition.
Regarding claim 145, claim 73 of ‘675 recites that the LNP is in a cell.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 128, 130, 133, and 135-145 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 5, 6, 14, 15, 25, 26, of copending Application No. 18/572,490 (‘490 reference application). Although the claims at issue are not identical, they are not patentably distinct from each other.
Regarding claim 128, claim 1 of ‘490 recites an mRNA comprising a 5’UTR comprising SEQ ID NO: 50 and a coding region (i.e., “ORF”). SEQ ID NO: 50 is a 100% identical match to instant SEQ ID NO: 1 (see alignment below, RNA equivalents):
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc – SEQ ID NO: 50, ‘490
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc -SEQ ID NO: 1, instant app.
Claim 3 of ‘490 recites that the mRNA comprises a 3’UTR element. Thus, claim 3 of ‘490 is drawn to the same subject matter as instant claim 128.
Regarding claim 130, as discussed above, SEQ ID NO: 50 is identical to instant SEQ ID NO: 1.
Regarding claim 133, as discussed above, SEQ ID NO: 50 is identical to instant SEQ ID NO: 1, and therefore comprises the same uridine content.
Regarding claim 135, as discussed above, SEQ ID NO: 50 of ‘490 is identical to instant SEQ ID NO: 1.
Regarding claim 136, claim 136 is simply drawn to inherent characteristics of the mRNA. The structure of claim 3 therefore inherently reads on claim 136 because the structure is identical for the two mRNAs recited in both applications.
Regarding claims 137-138, these claims are broadly drawn to any sequence of 3’UTR, as the claims recite a fragment of the recited sequences. Claim 3 of ‘490 recites a 3’UTR, and thus reads on claims 137-138.
Regarding claim 139, with regards to the limitation that the sequence comprises an miRNA binding site, such a sequence can virtually be any sequence to which miRNA can be engineered to bind. The structure recited in ‘490 claim 3 therefore reads on claim 139.
Regarding claim 140, claim 1 of ‘490 recites that the mRNA encodes the human protein UGT1A1 which broadly reads on the claim language of a therapeutic payload.
Regarding claim 141, claim 5 of ‘490 recites that the mRNA comprises a cap.
Regarding claim 142, claim 6 of ‘490 recites a modified nucleotide in the mRNA.
Regarding claim 143, claim 26 of ‘490 recites that the mRNA is comprised in an LNP.
Regarding claim 144, claim 25 of ‘490 recites that the composition is comprised in a pharmaceutical composition.
Regarding claim 145, the claims of ‘490 do not recite that the composition is in a cell. However, given that the claims of ‘490 also claim pharmaceutical compositions and LNPs, a practitioner could immediately envision such a composition in a cell so as to deliver the pharmaceutical composition.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 128, 130, 133, and 135-145 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 5, 7, 10, 11, 14, 18, of copending Application No. 18/036,560 (‘560 reference application). Although the claims at issue are not identical, they are not patentably distinct from each other.
Regarding claim 128, claim 1 of ‘560 recites an mRNA comprising an ORF (coding region). Claim 2 recites that the mRNA comprises a 5’UTR with a sequence of SEQ ID NO: 25. SEQ ID NO: 25 is shown below aligned with instant SEQ ID NO: 1:
aggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc – SEQ ID NO: 25, ‘560
ggaaaucgcaaaauuugcucuucgcguuagauuucuuuuaguuuucucgcaacuagcaagcuuuuuguucucgcc -SEQ ID NO: 1, instant app
Thus, SEQ ID NO: 25 comprises instant SEQ ID NO: 1. Furthermore, claim 7 recites that the mRNA comprises a 3’UTR. Thus, claims 1, 2, and 7 anticipate each structure of the instantly recited claim 128.
Regarding claim 130, as discussed above, SEQ ID NO: 25 of ‘560 is identical to instant SEQ ID NO: 1.
Regarding claim 133, as discussed above, SEQ ID NO: 25 of ‘560 is identical to instant SEQ ID NO:1 an therefore comprises the same uridine content.
Regarding claim 135, as discussed above, SEQ ID NO: 25 of ‘560 comprises SEQ ID NO: 1 of the instant application.
Regarding claim 136, claim 136 is simply drawn to inherent characteristics of the mRNA. The structure of claims 1, 2, and 7 and there combinations therefore inherently reads on claim 136 because the structure is identical for the two mRNAs recited in both applications.
Regarding claims 137-138, these claims are broadly drawn to any sequence of 3’UTR, as the claims recite a fragment of the recited sequences. Claim 7 of ‘560 recites a 3’UTR, and thus reads on claims 137-138.
Regarding claim 139, with regards to the limitation that the sequence comprises an miRNA binding site, such a sequence can virtually be any sequence to which miRNA can be engineered to bind. The structure recited in ‘560 claims 1, 2, and 7 therefore reads on claim 139.
Regarding claim 140, claim 1 of ‘560 recites a CFTR transmembrane protein as the encoded protein, which can reasonably be interpreted to be a therapeutic payload.
Regarding claim 141, claim 11 of ‘560 recites that the mRNA comprises a cap.
Regarding claim 142, claim 14 of ‘560 recites chemical modifications to the mRNA.
Regarding claim 143, claim 18 of ‘560 recites an LNP comprising the mRNA.
Regarding claim 144, claim 17 of ‘560 recites that the composition is comprised within a pharmaceutical composition.
Regarding claim 145, the claims of ‘560 do not recite that the composition is in a cell. However, given that the claims of ‘560 also claim pharmaceutical compositions and LNPs, a practitioner could immediately envision such a composition in a cell so as to deliver the pharmaceutical composition.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635