Prosecution Insights
Last updated: April 19, 2026
Application No. 18/014,315

CIRCULAR miRNA SPONGES

Non-Final OA §103§112
Filed
Jan 03, 2023
Examiner
MCLEOD, AFRICA MHAIRIE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
National University Of Singapore
OA Round
1 (Non-Final)
33%
Grant Probability
At Risk
1-2
OA Rounds
4y 0m
To Grant
99%
With Interview

Examiner Intelligence

Grants only 33% of cases
33%
Career Allow Rate
9 granted / 27 resolved
-26.7% vs TC avg
Strong +82% interview lift
Without
With
+81.8%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
55 currently pending
Career history
82
Total Applications
across all art units

Statute-Specific Performance

§101
4.9%
-35.1% vs TC avg
§103
25.9%
-14.1% vs TC avg
§102
17.5%
-22.5% vs TC avg
§112
29.1%
-10.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 27 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims Status Claims 3-5, 24-26 is/are cancelled. Claims 1-2, 6-23, 27-32 is/are currently pending. Claims 1-2, 6-23, 27-32 is/are under examination. Claim Rejections - 35 USC § 112 112(b): The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1, 21, and 30-32 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites the limitation "each binding site" in line 3. There is insufficient antecedent basis for this limitation in the claim as the claim in line 2 recites the term “bulged binding sites.” Since the miRNA bulged binding site comprises a bulge and a binding site, it is unclear whether “binding site” refers to the entire bulged binding site or just the binding site. Claim 21 recites the limitation "pharmaceutical composition, expression construct or expression vector of claim 1" in lines 1-2. There is insufficient antecedent basis for this limitation in the claim. Claim 1 does not recite a pharmaceutical composition, expression construct, or expression vector. It is not clear what structures are referenced by this limitation in claim 21. The term “optimum” in claim 30 is a relative term which renders the claim indefinite. The term “optimum” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The disclosure and the claims do not describe or recite the minimum threshold of binding to a target miRNA which would render a spacer length or number of binding sites “optimum”. As such, one of ordinary skill in the art would not be able to determine what structures could be considered “optimum”. Claims 31-32 depend on claim 30 but do not clarify this indefiniteness, and thus claims 31-32 are also rendered indefinite. 112(a): The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Written Description: Claims 1-2, 6-7, 9-10, 12-15, 17-23, 27-32 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. See, e.g., Moba, B.V, v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116. Possession may be shown in a variety of ways including description of an actual reduction to practice, or by showing that the invention was "ready for patenting" such as by the disclosure of drawings or structural chemical formulas that show that the invention was complete, or by describing distinguishing identifying characteristics sufficient to show that the applicant was in possession of the claimed invention. See, e.g., Pfaff v. Wells Eiees., Inc., 525 U.S. 55, 68, 119 S.Ct. 304, 312, 48 USPQ2d 1641,1647 (1998); Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406; Amgen, Inc. v. Chugai Pharm., 927 F. 2d 1200, 1206, 18 USPQ2d 1016, 1021 (Fed. Cir. 1991) (one must define a compound by "whatever characteristics sufficiently distinguish it”). According to the MPEP § 2163, "The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice (see i)(A) above), reduction to drawings (see i)(B) above), or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus (see i)(C) above). See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. A "representative number of species" means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutsch land GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that "only describe[d] one type of structurally similar antibodies" that "are not representative of the full variety or scope of the genus.")." Claim 1 recites an isolated circular RNA polynucleotide microRNA sponge, comprising a plurality of microRNA bulged binding sites and a plurality of polynucleotide spacers, wherein a “plurality” is interpreted as encompassing “more than one”. However, the disclosure only describes circular RNA polynucleotides comprising twelve microRNA bulged binding sites and eleven polynucleotide spacers (see page 4, lines 6-11). Moreover, the disclosure only provides a limited number of species of microRNA bulged binding site and polynucleotide spacer sequences, and of sizes of “regions” which are 100% complementary to a microRNA seed region (binding sites of SEQ ID NOs:3-4, 7-8, 11-12; spacers of SEQ ID NOs:27-32, see pages 4-6). Furthermore, in the instant case, the microRNA bulged binding sites are described as having the characteristic of being 100% complementary to a microRNA seed region (claim 1), and the spacer sequences are described as providing a linker between binding sites (claim 1). These characteristics do not distinguish between different members of the claimed genera, as all members of the claimed genera will have these characteristics. The described sequences are not representative of the entire scope of the genera of human and non-human animal microRNA bulged binding sites or random non-identical spacer sequences, nor are they described circular RNA polynucleotides representative of the entire scope of the genus of circular RNA polynucleotides comprising any number of binding and spacer sequences. Claims 2, 6-7, 9-10, 12-15, 17-23, 27-29 read on these genera recited in claim 1, and thus are also rejected for lacking sufficient written description. Claim 12 recites a use for the isolated circular RNA polynucleotide “as a medicament”, without specifying any disease or condition for which it is used “as a medicament”. Claim 13 recites that the isolated circular RNA polynucleotide of claims 1 and 12 is “for use in the treatment of…cardiomyopathy…or…cancer” (lines 1-3, 5). Claim 21 recites a use of the isolate circular RNA polynucleotide of claim 1 for the “treatment, amelioration or prevention” of any disease or medical disorder “associated with the presence or over-expression of a plurality of microRNA.” Claim 23 recites a use of the isolated circular RNA polynucleotide in the treatment of any type of cardiomyopathy or any type of cancer. Claim 27 recites a “method for the treatment, amelioration or prevention of a disease or medical disorder associated with the presence or over-expression of a plurality of microRNA” using the circular RNA polynucleotide of claim 1. Claim 29 recites a method of treating any type of cardiomyopathy or any type of cancer using the isolated circular RNA polynucleotide. These claims create an enormous genus of diseases, of which only one species is described, and which species is not representative of the full scope of this genus. The disclosure only describes methods of using the isolated circular RNA polynucleotide in a treatment for cardiomyopathy associated with cardiac hypertrophy only; moreover, the disclosure does not describe uses of the isolated circular RNA polynucleotide in treatment of any cancer. Pages 19-20 of the specification describe the administration of the circular RNA to a mouse TAC (transverse aortic constriction) cardiac pressure overload mouse model. The art teaches that TAC mice are a model for hypertrophic cardiomyopathy, but not other types of cardiomyopathy (see Gu, 2021; see also Mayo Clinic, 2024, which teaches that two types of cardiomyopathy exist: dilated cardiomyopathy and hypertrophic cardiomyopathy). As such, the TAC mouse model taught in the disclosure is representative of treatment of hypertrophic cardiomyopathy, but not any type of cardiomyopathy. Based on what is disclosed in the specification and what was known in the art, discussed above, the applicants only describe methods and applications for treatment of hypertrophic cardiomyopathy using or by administering the claimed circular RNA polynucleotide. As a result, claims 12-13, 21-23, 27-29 lack sufficient written description of the full scope of the genera of uses of the claimed circular RNA polynucleotides and diseases treated by the claimed methods. Claim 30 recites the term “optimum”, regarding an “optimum spacer length and number of binding sites”. The term “optimum” is not defined by the claim or the specification. The disclosure and the claims do not describe or recite the minimum threshold of binding to a target miRNA which would render a spacer length or number of binding sites “optimum”. As such, one of ordinary skill in the art would not be able to determine what structures could be considered “optimum”. Claims 31-32 depend on claim 30 but do not clarify the definition of the term “optimum”, and thus claims 30-32 fail to provide sufficient written description of the claimed method. Scope of Enablement: Claims 27-29 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for methods of treating cardiomyopathy caused by cardiac hypertrophy using a circular RNA miRNA sponge comprising bulged binding sites for miR-132 and miR-212, does not reasonably provide enablement for methods of treating any disease associated with presence or overexpression of microRNA, including any cancer and any type of cardiomyopathy not caused by cardiac hypertrophy. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. The factors to be considered in determining whether a disclosure would require undue experimentation include: A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 8 USPQ2d, 1400 (CAFC 1988) and MPEP 2164.01. The breadth of the claims: With respect to claim breadth, the standard under 35 U.S.C. §112, first paragraph, entails the determination of what the claims recite and what the claims mean as a whole. As such, the broadest reasonable interpretation of the claimed method is that it encompasses methods of treating, ameliorating, or preventing any disease or disorder associated (not necessarily caused by) presence or overexpression of more than one microRNA (claim 27), wherein the disease can be any type of cardiomyopathy or cancer (claim 29) and the microRNA can be miR-132, miR-212, miR-17-5p, miR-17a-5p, miR-20b-5p, or miR-106a-5p (claim 28). A skilled artisan would not know how to use the method with a reasonable expectation of success based solely on what is disclosed in the specification. The amount of direction provided by the inventor and the level of predictability in the art: The specification teaches that the claimed circular RNA polynucleotides act as sponges for the microRNAs targeted by the bulged binding sites in the circular RNA polynucleotides (page 2 lines 22-27); sequestration of targeted microRNAs miR-212 and miR-132 can be used to treat hypertrophic cardiomyopathy (page 2 lines 28-35, page 5 lines 18-21, page 2 lines 8-18 and lines 24-31). The specification also teaches that circular microRNA sponges targeting miR-17-5p and miR-18a-5p, or miR-20b-4p and miR-106a-5p, can be used to treat any cancer (page 5 lines 22-25). The art at the time of filing taught that miR-17-5p, miR-18a-5p, miR-20b-5p, and miR-106a-5p exhibit different roles (e.g., diagnostic marker, oncogenic, tumor suppressor) in different cancers (see Kolenda, 2020, which teaches different roles of miR-17-92a cluster miRNA, including miR-17-5p, miR-18a-5p, miR-20b-5p, and miR-106a-5p, in different cancers; “The role of individual members of the miR-17-92a cluster in the process of tumor formation is unclear. This cluster can act both as a suppressor or an oncogene” page 811). It would be unclear to an artisan how suppression of miRNA acting as tumor suppressors or as diagnostic markers, but not oncogenes, in any cancer would treat said cancer. The prior art teaches that some miRNA are associated with cardiomyopathies, that each miRNA exhibits a different relationship with cardiomyopathy, and that not all miRNA associated with cardiomyopathy had a potential therapeutic application through reduction or sequestration of the miRNA (see van Rooij, 2007). An artisan would not be able to determine, based on the prior art and the present disclosure, what miRNA targets could or could not be used in a method of treating cardiomyopathy as claimed by claims 27-28, with the exception of miR-212 and miR-132. The specification as filed does not provide guidance that overcomes this unpredictability within the art. The existence of working examples: What is enabled by the working examples is narrow in comparison to the breadth of the claims: The specification discloses a method of treating hypertrophic cardiomyopathy in a TAC mouse model, which is predictive of treatment of hypertrophic cardiomyopathy (pages 19-20) (see Gu, 2021). The quantity of experimentation needed to make or use the invention: The standard of an enabling disclosure is not the ability to make and test if the invention works but one of the ability to make and use with a reasonable expectation of success. A patent is granted for a completed invention, not the general suggestion of an idea (MPEP 2164.03 and Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1325-26 (Fed. Cir. 2004). The instant specification is not enabling because one cannot follow the guidance presented therein, or within the art at the time of filing, and practice the claimed method without first making a substantial inventive contribution. Given that the nature of the invention encompasses methods of treating any cancer and any type of cardiomyopathy using a circular RNA miRNA sponge targeting any miRNA, a person having ordinary skill in the art would have to perform multiple further experiments, in human clinical trials or in animal models predictive of treatment of dilated cardiomyopathy and a representative number of types of cancers, and using a representative number of species of targeted microRNAs, in order to demonstrate the invention could be used with a reasonable expectation of success. The amount of experimentation required for enabling guidance, commensurate in scope with what is claimed, goes beyond what is considered ‘routine' within the art, and constitutes undue further experimentation in order to use the method with a reasonable expectation of successfully treating any CNS disorder or neurodegenerative disease. Therefore, Claims 27-29 are rejected under 35 U.S.C. 112, first paragraph, for failing to meet the enablement requirement. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-2, 6-10, 12, 21 is/are rejected under 35 U.S.C. 103 as being unpatentable over Liu (2018, provided by applicant with IDS filed 01/03/2023) in view of Kluiver (2012). Regarding claim 1, Liu teaches a circular RNA microRNA sponge comprising a plurality of microRNA bulged binding sites comprising a region 100% complementary to a microRNA seed region (Fig. 2; page 314). The circular RNA microRNA sponge comprises a plurality of spacer sequences, each spacer positioned between two bulged binding sites (Fig. 2). Regarding claim 6, Liu teaches that each bulge is created by mismatches and one nucleotide deletion at nucleotides 9-12 of the bulged binding site (page 316). Regarding claims 12 and 21, Liu teaches that the circRNA sponges can be used in therapeutic applications, for the treatment of gastric cancers associated with overexpression of miR-21 (Abstract; page 313). However, Liu does not teach that the spacer between bulged binding sites can be longer than 4 nucleotides and that multiple different spacer sequences can be used in one RNA miRNA sponge, as required by claim 1; that the circular RNA contains 12 microRNA binding sites, as required by claim 2; and that the bulged binding sites bind to miR-17-5p and miR-18a-5p, as required by claims 7-9. Kluiver teaches that RNA miRNA sponges can comprise spacers longer than 4 nucleotides and having different sequences, can comprise 12 microRNA bulged binding sites, and can target miR-17 and miR-18a. Regarding claim 1, Kluiver teaches that the RNA miRNA sponge can comprise at least two different spacer sequences (see Fig. 1, “GGGTCCC/GGGACCC” alternates with a different spacer sequence). Kluiver also teaches that the length of a spacer sequence can be varied (page 5); it would thus have been obvious to an artisan at the time of filing that different lengths of spacer sequences, including six or more nucleotides in length, were obvious variants. Regarding claim 2, Kluiver teaches a linear RNA miRNA sponge comprising 12 microRNA bulged binding sites, wherein the 12 microRNA bulged binding sites comprise at least three of each of two different microRNA bulged binding sites (Fig. 3, Combi-sp1, Combi-sp2). Regarding claim 7, Kluiver teaches that the RNA miRNA sponge comprises bulged binding sites targeting miR-18a and miR-17-5p (Fig. 3). It would have been obvious to an artisan at the time of filing that the miRNA bulged binding sites could be arranged in any order, and that any particular arrangement of miRNA bulged binding sites would be an obvious variant of any other particular arrangement. Furthermore, ). Kluiver also teaches that the length of a spacer sequence can be varied (page 5); it would thus have been obvious to an artisan at the time of filing that different lengths of spacer sequences, including six or more nucleotides in length, were obvious variants. Regarding claim 8, Kluiver teaches that the RNA miRNA sponge comprises bulged binding sites targeting three different miRNA: miR-17, miR-18a, miR-19, and miR-92a (page 3). An artisan at the time of filing would find it obvious that the “combi-sp1” and “combi-sp2” RNA miRNA sponges (Fig. 3; page 5) could be modified to target only two of the four miRNA by adjusting the number of repeats of each miRNA bulged binding site (e.g., replacing three copies each of four bulged binding sites to six copies each of two bulged binding sites, maintaining the total number of bulged binding sites at twelve). The teachings of Kluiver thus render obvious RNA miRNA sponges comprising six miR-17 and six miR-18a bulged binding sites. Regarding claim 9, Kluiver teaches an RNA miRNA sponge comprising the sequence: CTCGAGTTATCTACCTGCACTCCGGCACTTTGTTATCTACCTGCACTCCGGCACTTTGTTATCTACCTGCACTCCGGCACTTTGTTATCTATCTGCACTCAGGCACCTTATTATCTATCTGCACTCAGGCACCTTATTATCTATCTGCACTCAGGCACCTTATTATTCAGTTTTGCAGAGTTTGCACATTATTCAGTTTTGCAGAGTTTGCACATTATTCAGTTTTGCAGAGTTTGCACATTATACAGGCCGGGTTCGTGCAATATTATACAGGCCGGGTTCGTGCAATATTATACAGGCCGGGTTCGTGCAATATTATGAATTC (Supplemental Table S2), wherein the sequence comprises binding sites complementary to SEQ ID NO:5 and SEQ ID NO:6 (see alignments below). SEQ ID NO:5: PNG media_image1.png 163 662 media_image1.png Greyscale SEQ ID NO:6: PNG media_image2.png 161 654 media_image2.png Greyscale Regarding claim 10, Kluiver teaches an RNA miRNA sponge comprising the sequence above (Table S2), which comprises miRNA bulged binding sites which only differ from instant SEQ ID NOs:7 and 8 in the sequence of the bulge (see alignments below). As the only requirements for the bulge sequence are that it is not complementary to the target and comprises a deletion relative to the target, an artisan would recognize that the bulge sequence could be any sequence so long as those requirements are fulfilled. The miRNA bulged binding sites taught by Kluiver target the same sequences within the same miRNA as instant SEQ ID NOs:7-8. As such, it would be obvious to an artisan that instant SEQ ID NOs:7-8 are obvious variants of the miRNA bulged binding sites taught by Kluiver. SEQ ID NO:7: PNG media_image3.png 163 656 media_image3.png Greyscale SEQ ID NO:8: PNG media_image4.png 162 658 media_image4.png Greyscale It would have been obvious to a person of ordinary skill in the art at the time of filing that any linear RNA miRNA sponge, such as that taught by Kluiver, could be circularized using the methods of Liu (see Fig. 2 and page 313 of Liu). As such, the particular sequence of a circular RNA miRNA sponge taught by Liu could be modified to target multiple different miRNA sequences, such as by replacing the RNA miRNA sponge sequence of Liu with the RNA miRNA sponge sequence of Kluiver. Moreover, Kluiver teaches that the spacer sequence length can be varied, rendering obvious to an artisan that spacer sequences of lengths different from those taught by Kluiver and Liu (4 nucleotides long), including spacers of six or more nucleotides, were obvious variants. Allowable Subject Matter Claims 11 and 16 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. The following is a statement of reasons for the indication of allowable subject matter: The closest art found to the composition of claims 11 and 16 was Lavenniah, et al., 2020 (provided by applicant with IDS filed 01/03/2023). Lavenniah teaches an isolated circular RNA polynucleotide comprising bulged binding sites targeting, alternatingly, miR-132 and miR-212 (Fig. 1), used to treat a mouse model of hypertrophic cardiomyopathy (page 1510). No other art was found teaching the specific spacer sequences of SEQ ID NOs:27-32, as required by claims 11 and 16. However, Lavenniah, et al., is exempted as prior art under 102(b)(1)(A) as being disclosed by the inventor within the 1-year grace period prior to the effective filing date of the pending application. The specification teaches that the “presence of repeat sequences results in a high frequency of recombination events that interferes with techniques used to construct the sponge” (page 13 lines 24-26), and that while the miRNA-targeting regions cannot be altered, the spacer sequences can be randomized to reduce repetition and thus reduce recombination events (pages 13-14). Kluiver (Jan. 2012) teaches that spacer sequences of different lengths and sequences can be used in an RNA miRNA sponge; however, Kluiver does not teach that an RNA miRNA sponge should comprise more than two unique spacer sequences, and does not teach a motive for including more than two unique spacer sequences. As such, while circular RNA miRNA sponges were known in the art (see Panda, 2018; Jost, 2018, provided by applicant with IDS filed 10/29/2024), while recombination was known to negatively affect linear miRNA sponge stability correlated with the number of miRNA binding sequences in a linear miRNA sponge (Kluiver, July 2012, suggests that increased frequence of recombination events is a product of increasing numbers of miRNA bulged binding sites and not sequence repetition, and does not suggest that recombination events can be prevented by reducing repetition of sequences), and while linear RNA miRNA sponges comprising up to two different spacer sequences were known and resulted from the ligation process used to join together miRNA bulged binding sites (Kluiver, Jan. 2012), the inclusion of more than two unique spacer sequences in one RNA miRNA sponge, including all spacer sequences of SEQ ID NOs:27-32 in one RNA miRNA sponge, as required by claims 8 and 11, was not taught in the prior art and would not have been obvious in view of the prior art. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to AFRICA M MCLEOD whose telephone number is (703)756-1907. The examiner can normally be reached Mon-Fri 9:00AM-6:00PM EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached on (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. For those applications where applicant wishes to communicate with the examiner via Internet communications, e.g., email or video conferencing tools, the following is a sample authorization form which may be used by applicant: "Recognizing that Internet communications are not secure, I hereby authorize the USPTO to communicate with the undersigned and practitioners in accordance with 37 CFR 1.33 and 37 CFR 1.34 concerning any subject matter of this application by video conferencing, instant messaging, or electronic mail. I understand that a copy of these communications will be made of record in the application file." To facilitate processing of the internet communication authorization or withdraw of authorization, the Office strongly encourages use of Form PTO/SB/439, available at www.uspto.gov/patent/patents-forms. The form may be filed via EFS-Web using the document description Internet Communications Authorized or Internet Communications Authorization Withdrawn to facilitate processing. See MPEP 502.03(II). Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AFRICA M MCLEOD/ Examiner, Art Unit 1635 /RAM R SHUKLA/ Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jan 03, 2023
Application Filed
Dec 09, 2025
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12522822
APOLIPOPROTEIN C3 (APOC3) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Jan 13, 2026
Patent 12514868
Multiplex shRNA for Use in Vectors
2y 5m to grant Granted Jan 06, 2026
Patent 12516353
RECOMBINANT HERPESVIRUS OF TURKEYS (HVT) AND PREPARATION METHOD AND USE THEREOF
2y 5m to grant Granted Jan 06, 2026
Patent 12473527
OPTIMIZED GENETIC TOOL FOR MODIFYING BACTERIA
2y 5m to grant Granted Nov 18, 2025
Patent 12429487
NEUROFILAMENT PROTEIN FOR GUIDING THERAPEUTIC INTERVENTION IN AMYOTROPHIC LATERAL SCLEROSIS
2y 5m to grant Granted Sep 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
33%
Grant Probability
99%
With Interview (+81.8%)
4y 0m
Median Time to Grant
Low
PTA Risk
Based on 27 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month