Detailed Office Action
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
Acknowledgement is hereby made of receipt and entry of the communication filed 04 November, 2025. Claims 1, 2, 6, 10, 11, 14, 29-32, 34, 36-38, 40, and 42-46 are pending in the instant application. Applicant’s election of Group II (claims 29-32, 34, 36-38, and 40) for examination on the merits is noted. Because Applicant did not distinctly and specifically point out the purported errors in the restriction requirement, the election has been treated as an election without traverse (see M.P.E.P. § 818.03(a)). Accordingly, claims 1, 2, 6, 10, 11, 14, and 42-46 have been withdrawn from further consideration by the Examiner, pursuant to 37 C.F.R. § 1.142(b), as being drawn to a non-elected invention.
37 C.F.R. § 1.98
The information disclosure statements filed 06 March, 2023, and 01 May, 2024, have been placed in the application file and the information referred to therein has been considered.
37 C.F.R. § 1.84
The drawings filed 05 January, 2023, have been reviewed and are acceptable.
Claim Objections
Claim 34 is objected to because of the following informalities: Dabcyl, TAMRA, Eclipse, Black Hole Quencher, Iowa Black FQ, Iowa Black RQ, and ZENTM should read DABCYL, TAMRATM, Eclipse®, Black Hole QuencherTM (BHQTM), Iowa Black® FQ, Iowa Black® RQ, and ZEN®.
Appropriate correction is required.
35 U.S.C. § 112(b)
The following is a quotation of 35 U.S.C. § 112(b):
(b) CONCLUSION. —The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 29-32, 34, 36-38, and 40 are rejected under 35 U.S.C. § 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, regards as the invention. Two separate requirements are set forth under this statute: (1) the claims must set forth the subject matter that applicants regard as their invention; and (2) the claims must particularly point out and distinctly define the metes and bounds of the subject matter that will be protected by the patent grant.
Claim 29 references an oligonucleotide probe “being” 10-300 nucleotides in length. This recitation is confusing because the upper and lower limits of the probe size are not readily manifest. For instance, does the claim encompass and oligonucleotide consisting of 10-300 nucleotides in length, which would exclude larger fragments containing the sequence, or is the claim directed toward a probe comprising 10-300 nucleotides in length, which would encompass larger oligonucleotides. Perusal of the disclosure appears to support oligonucleotide sequences consisting of 10-300 nucleotides. Further clarification and amendment of the claim language is required.
Claim 30 specifies the first nucleotide is the 5’ nucleotide which is confusing since the first nucleotide is already 5’ of the other nucleotides. Accordingly, the precise structure encompassed by the claims is not readily manifest. Amendment of the claim language to reference the 5’-terminal nucleotide would be remedial.
Claim 31 specifies the second nucleotide is the 3’ nucleotide which is confusing since the second nucleotide is already 3’ of the other nucleotides. Accordingly, the precise structure encompassed by the claims is not readily manifest. Amendment of the claim language to reference the 3’-terminal nucleotide would be remedial.
Claim 34 contains the trademarks/trade names TAMRATM, Eclipse®, Black Hole QuencherTM (BHQTM), Iowa Black® FQ, Iowa Black® RQ, ZEN®, and TAOTM. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. § 112(b). See Ex parte Simpson, 218 U.S.P.Q. 1020 (Bd. App. 1982). See also Eli Lilly & Co. v. Apotex, Inc., 837 Fed. Appx. 780, 784-85, 2020 U.S.P.Q.2d 11531 (Fed. Cir. 2020) ("Following Patent Office procedure, the Examiner in this case rejected the claims of the '821 application as indefinite because they improperly used the trade name 'ALIMTA.' In response to the rejection, Lilly canceled its claims reciting the trade name and pursued claims using the generic name for the same substance, which mooted the rejection. Additionally, as the district court observed, the Examiner 'explicitly noted that pemetrexed disodium was 'also known by the trade name ALIMTA'' in the contemporaneous obviousness rejection."). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademarks/trade names are used to identify/describe various quencher moieties and, accordingly, the identification/description is indefinite.
35 U.S.C. § 112(a)
The following is a quotation of 35 U.S.C. § 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
Written Description
Claims 29-32, 34, and 36-38 are rejected under 35 U.S.C. § 112(a), as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, at the time the application was filed, had possession of the claimed invention. Amgen, Inc. v. Sanofi, 872 F.3d 1367, 124 U.S.P.Q.2d 1354 (Fed. Cir. 2017). AbbVie Deutschland GmbH & Co. v. Janssen Biotech, Inc., 759 F.3d 1285, 111 U.S.P.Q.2d 1780 (Fed. Cir. 2014). Univ. of Rochester v. G.D. Searle & Co., Inc., 358 F.3d 916, 920, 69 U.S.P.Q.2d 1886, (Fed. Cir. 2004). Enzo Biochem, Inc. v. Gen-Probe, Inc., 296 F.3d 1316, 63 U.S.P.Q.2d 1609, (Fed. Cir. 2002). Regents of the University of California v. Eli Lilly & Co., 119 F.3d 1559, 43 U.S.P.Q.2d 1398, (Fed. Cir. 1997). Fiers v. Revel Co., 984 F.2d 1164, 25 U.S.P.Q.2d 1601, (Fed. Cir. 1993). Amgen, Inc. v. Chugai Pharmaceutical Co., 927 F.2d 1200, 18 U.S.P.Q.2d 1016, (Fed. Cir. 1991). In re Rasmussen, 650 F.2d 1212, 211 U.S.P.Q. 323 (C.C.P.A. 1981). In re Wertheim, 541 F.2d 257, 191 U.S.P.Q. 90 (C.C.P.A. 1976).
The crux of the statutory requirement governing written description is whether one skilled in the art, familiar with the practice of the art at the time of the filing date, could reasonably have found the later claimed invention in the specification as filed. In re Kaslow, 707 F.2d 1366, 1375, 217 U.S.P.Q. 1089, 1096 (Fed. Cir. 1983). In re Wilder, 736 F.2d 1516, 1520 222 U.S.P.Q. 349, 372 (Fed. Cir. 1984, cert. denied, 469 U.S. 1209 (1985). Texas Instruments, Inc. v. International Trade Comm’n, 871 F.2d 1054, 1063, 10 U.S.P.Q.2d 1257, 1263 (Fed. Cir. 1989). Moreover, the courts have stated that the evaluation of written description is highly fact-specific, and that broadly articulated rules are inappropriate. In re Wertheim, 541 F.2d 257, 263, 191 U.S.P.Q. 90, 97 (C.C.P.A. 1976). In re Driscoll, 562 F.2d 1245, 1250, 195 U.S.P.Q. 434, 438 (C.C.P.A. 1977). It is also important to remember that the true issue in question is not whether the specification enables one of ordinary skill in the art to make the later claimed invention, but whether or not the disclosure is sufficiently clear that those skilled in the art will conclude that the applicant made the invention having the specific claim limitations. Martin v. Mayer, 823 F2d 500, 505, 3 U.S.P.Q.2d 1333, 1337 (Fed. Cir. 1987).
To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor has possession of the claimed invention. See, e.g., Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 U.S.P.Q.2d at 1116. An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations using such descriptive means as words, structures, figures, diagrams, and formulas that fully set forth the claimed invention. Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 U.S.P.Q.2d 1961, 1966 (Fed. Cir. 1997). The claimed invention as a whole may not be adequately described where an invention is described solely in terms of a method of its making coupled with its function and there is no described or art-recognized correlation or relationship between the structure of the invention and its function. A biomolecule sequence described only by a functional characteristic, without any known or disclosed correlation between that function and the structure of the sequence, normally is not a sufficient identifying characteristic for written description purposes, even when accompanied by a method of obtaining the claimed sequence. A lack of adequate written description issue also arises if the knowledge and level of skill in the art would not permit one skilled in the art to immediately envisage the product claimed from the disclosed process. Fujikawa v. Wattanasin, 93 F.3d 1559, 1571, 39 U.S.P.Q.2d 1895, 1905 (Fed. Cir. 1996).
Determination of adequate written description requires the Examiner to read and analyze the specification for compliance with 35 U.S.C. § 112(a). In particular, each claim should be analyzed to determine its broadest reasonable interpretation consistent with written description. Each claim should be evaluated to determine if sufficient structures, acts, or functions are recited to make clear the scope and meaning of the claim, including the weight to be given the preamble. The entire application should be reviewed including the specific embodiments, figures, and sequence listings, to understand how applicant provides support for the various features of the claimed invention. The analysis of whether the specification complies with the written description requirement calls for the examiner to compare the scope of the claim with the scope of the description to determine whether applicant has demonstrated that the inventor was in possession of the claimed invention. Such a review is conducted from the standpoint of one of ordinary skill in the art at the time the application was filed (see, e.g., Wang Labs., Inc. v. Toshiba Corp., 993 F.2d 858, 865, 26 USPQ2d 1767, 1774 (Fed. Cir. 1993)) and should include a determination of the field of the invention and the level of skill and knowledge in the art. Finally, the Examiner should determine whether there is sufficient written description to inform a skilled artisan that the inventor was in possession of the claimed invention as a whole at the time of filing.
The claims are broadly directed toward any oligonucleotide probe comprising 10-300 nucleotides, wherein said probe has the following characteristics: a) a fluorescent moiety attached to the first nucleotide (5’); b) a first quencher attached to a second nucleotide; c) a second quencher attached to a third nucleotide located between the first and second nucleotides; and d) a member of an affinity pair attached 5’ to said third nucleotide. This genus encompasses an inordinate number of nucleotide sequences that were neither contemplated nor disclosed in the specification. The specification provides a limited and finite number of oligonucleotide primers and probes directed toward the detection of SARS-CoV-2 and repetitive elements in chickens. No other nucleic acid sequences were identified, synthesized, purified, and characterized. Clearly the inventors did not contemplate generating any additional oligonucleotide probes.
Accordingly, when all the aforementioned factors are considered in toto, the skilled artisan would reasonably conclude that Applicant was not in possession of a sufficient number of oligonucleotide probes to support the desired claim breadth.
Scope of Enablement
Claim 34 is rejected under 35 U.S.C. § 112(a), because the specification does not reasonably enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. The claims are broadly directed toward any oligonucleotide probe comprising 10-300 nucleotides, wherein said probe has the following characteristics: a) a fluorescent moiety attached to the first nucleotide (5’); b) a first quencher attached to a second nucleotide; c) a second quencher attached to a third nucleotide located between the first and second nucleotides; and d) a member of an affinity pair attached 5’ to said third nucleotide, wherein said quenchers are selected from a group including DDQ, Qx1, Iowa Black® FQ, Iowa Black® RQ, ZEN® and TAQTM.
The legal considerations that govern enablement determinations pertaining to undue experimentation have been clearly set forth. Enzo Biochem, Inc., 52 U.S.P.Q.2d 1129 (C.A.F.C. 1999).In re Wands, 8 U.S.P.Q.2d 1400 (C.A.F.C. 1988). Ex parte Forman 230 U.S.P.Q. 546 (PTO Bd. Pat. App. Int., 1986). The courts concluded that several factual inquiries should be considered when making such assessments including the quantity of experimentation necessary, the amount of direction or guidance presented, the presence or absence of working examples, the nature of the invention, the state of the prior art, the relative skill of those in that art, the predictability or unpredictability of the art and the breadth of the claims. In re Rainer, 52 C.C.P.A. 1593, 347 F.2d 574, 146 U.S.P.Q. 218 (1965). The disclosure fails to provide adequate guidance pertaining to a number of these considerations as follows:
1) The disclosure fails to provide adequate guidance with respect to the quencher structures of DDQ, Qx1, Iowa Black® FQ, Iowa Black® RQ, ZEN® and TAQTM. These quencher structures appear to be proprietary to IDT (Integrated DNA Technologies) and are not readily available. In the absence of these chemical structures, it is not readily manifest how the skilled artisan could practice the claimed invention.
2) The disclosure fails to provide any working examples with respect to the recited quenchers. No chemical structures were available for DDQ, Qx1, Iowa Black® FQ, Iowa Black® RQ, ZEN® and TAQTM.
3) The state of the art can be characterized by unpredictability since the chemical structures of DDQ, Qx1, Iowa Black® FQ, Iowa Black® RQ, ZEN® and TAQTM do not appear to be readily available.
4) Undue experimentation would be required to produce the claimed quenchers because their chemical structures do not appear to be readily available.
Accordingly, when all the aforementioned factors are considered in toto, the skilled artisan would reasonably conclude that undue experimentation would be required to practice the claimed invention.
Joint Inventors, Common Ownership Presumed
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were effectively filed absent any evidence to the contrary. Applicant is advised of the obligation under 37 C.F.R. § 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned at the time a later invention was effectively filed in order for the examiner to consider the applicability of 35 U.S.C. § 102(b)(2)(C) for any potential 35 U.S.C. § 102(a)(2) prior art against the later invention.
35 U.S.C. § 103
The following is a quotation of 35 U.S.C. § 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 29-32, 34, 36, and 37 are rejected under 35 U.S.C. § 103 as being unpatentable over Hirotsu et al. (2020, Double-Quencher Probes Improved the Detection Sensitivity of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) by One-Step RT-PCR, medRxiv, doi.org/10.1101/2020.03.17.20037903, pp. 1-16) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863). Claim 29 is directed toward an oligonucleotide probe comprising 10-300 nucleotides, wherein said probe has the following characteristics: a) a fluorescent moiety attached to the first nucleotide (5’); b) a first quencher attached to a second nucleotide; c) a second quencher attached to a third nucleotide located between the first and second nucleotides; and d) a member of an affinity pair attached 5’ to said third nucleotide. Claim 30 specifies the first nucleotide is the 5’ nucleotide. Claim 31 specifies the second nucleotide is the 3’ nucleotide and said nucleotide is 5-20 nucleotides from the 5’ nucleotide. Claim 34 references a first quencher (e.g., DABCYL, TAMRATM, Eclipse®, DDQ, QSY, Blackberry quencher, Qx1, Black Hole QuencherTM (BHQTM), Iowa Black® FQ, Iowa Black® RQ, and IRDye QC-1) and second quencher (e.g., ZEN® and TAOTM). Claim 36 references biotin/avidin or biotin/streptavidin affinity pairs. Claim 37 references an oligonucleotide probe no longer than 30 nucleotides.
Hirotsu et al. (2020) disclose a real-time reverse transcription polymerase chain reaction (RT-PCR) assay for the detection of SARS-CoV-2. PCR primers and a double-quenched probe directed against the nucleocapsid gene were generated. The probe contained a 5’ FAM dye, internal ZEN® quencher, and 3’ Iowa Black® FQ quencher. The internal ZEN® quencher is incorporated between the ninth and tenth bases from the 5’end of the probe (5’-FAM/ATG TCG CGC/ZEN/ATT GGC ATG GA-IBFQ-3'). This design decreased the distance between the dye and quencher and reduced the background signal while achieving a higher dynamic signal (see Materials and Methods, Primer and probe sets, p. 4; Results, Design of primer and probes to detect SARS-CoV-2, pp. 5-6; and Table 1, p. 13). This teaching meets all of the claimed limitations with one exception, it fails to disclose the utilization of an affinity member pair (e.g., biotin).
Danielli et al. (2009) disclose the utilization of an RT-PCR FRET-based magnetic modulation biosensing assay for the detection of Ibaraki virus nucleic acids (see Fig. 1, p. 859, reproduced on next page). This procedure utilizes a double-labeled nucleic acid probe (5’-(Alexa488/biotin-dTCT TTA TCT GTC GCA ACC G-BHQ-3’) comprising a fluorescent dye and biotin at the 5’ on the same nucleotide and a dark quencher at the 3’ (see Materials and Methods, 2.1. FRET-based magnetic modulation biosensing (MMB) assay, p. 859; 2.3. FRET-based DNA biosensor synthesis). Taq polymerase cleaves the FRET-based probe to produce a fluorescent signal. The biotinylated probe is attached to streptavidin-coupled superparamagnetic beads and subjected to magnetic modulation. The authors noted that this system provides a rapid and sensitive method for the detection of viral nucleic acids. The rapid reaction time (<20 min), sensitivity (pM amount detection), and simplicity render this system useful for the rapid detection of various pathogens (see Summary, p. 863).
PNG
media_image1.png
360
614
media_image1.png
Greyscale
Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the double-quenched oligonucleotide probe of Hirotsu et al. (2020), to incorporate a biotin (or other suitable affinity member) at the 5’ terminus, as disclosed by Danielli et al. (2009), to facilitate the detection of viral nucleic acids. One of ordinary skill in the art would have been motivated to make this modification and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting viral nucleic acids.
Claim 38 is rejected under 35 U.S.C. § 103 as being unpatentable over Hirotsu et al. (2020, Double-Quencher Probes Improved the Detection Sensitivity of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) by One-Step RT-PCR, medRxiv, doi.org/10.1101/2020.03.17.20037903, pp. 1-16) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863), as applied supra to claim 29, and further in view of Hamburger et al. (2001, POLYMERASE CHAIN REACTION ASSAY BASED ON A HIGHLY REPEATED SEQUENCE OF SCHISTOSOMA HAEMATOBIUM: A POTENTIAL TOOL FOR MONITORING SCHISTOSOME-INFESTED WATER, Am. J. Trop. Med. Hyg. 65(6):907-911). Claim 38 references an oligonucleotide that hybridizes to a nucleic acid sequence that appears more than 100x in a single chromosome.
Hamburger et al. (2001) discloses a PCR assay for the detection of a highly repeated Schistosoma haemtobium DraI sequence (see Fig. 1 and MATERIALS AND METHODS, Polymerase chain reaction assay, p. 908). The authors noted that S. haemtobium contains hundreds of thousands of DraI repeats in the schistosome genome.
Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to prepare double-quenched S. haemtobium oligonucleotide probes, as taught by Hirotsu et al. (2020), and to modify these probes to incorporate a 5’ biotin, as disclosed by Danielli et al. (2009), to facilitate their rapid detection utilizing MMB. One of ordinary skill in the art would have been motivated to make these modifications and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting schistosome nucleic acids.
Claim 40 is rejected under 35 U.S.C. § 103 as being unpatentable over Hirotsu et al. (2020, Double-Quencher Probes Improved the Detection Sensitivity of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) by One-Step RT-PCR, medRxiv, doi.org/10.1101/2020.03.17.20037903, pp. 1-16) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863), as applied supra to claim 29, and further in view of Donati et al. (U.S. Pat. No. 11,001,901 B1, issued 11 May, 2021, and claiming priority to U.S. Appl. No. 16/809,717, filed 05 March, 2020; hereinafter referred to as “Donati et al. (2021)”) and Kim and Cha (U.S. Pat. No. 11,976,338 B2, issued 07 May, 2024, and claiming priority to PCT/KR2020/005337, filed 22 April, 2020; hereinafter referred to as “Kim and Cha (2024)”). Claim 40 references SARS-CoV-2 oligonucleotide probes corresponding to SEQ ID NOS.: 11, 14, 15, and 16. These probes are directed toward the E and RdRp genes and have the following structures:
1) SEQ ID NO.: 11 (SARS-CoV-2 E_Sarbeco_P1 probe):
5’-ATTO/Biotin/-ACA CTA GCC/ZEN/ATC CTT ACT GCG CTT CG-IBFQ/-3’;
2) SEQ ID NO.: 14 (SARS-CoV-2 RdRp probe):
5’-Biotin/ATTO-CAG GTG GAA/ZEN/CCT CAT CAG GAG ATG C-IBFQ/-3’;
3) SEQ ID NO.: 15 (SARS-CoV-2 RdRp gene):
5’-CAG GTG GAA CCT CAT CAG GAG ATG C-3’; and,
4) SEQ ID NO.: 16 (SARS-CoV-2 E gene):
5’-ACA CTA GCC ATC CTT ACT GCG CTT CG-3’.
Donati et al. (2021) disclose SARS-CoV-2-specific PCR primers and probes for real-time RT-PCR assays. In particular, this teaching discloses the same oligonucleotide primer sequence set forth in SEQ ID NOS.: 11 and 16 (see SEQ ID NO.: 9 in the patent and Appendix A).
Kim and Cha (2024) disclose SARS-CoV-2-specific PCR primers and probes for real-time RT-PCR assays. In particular, this teaching discloses the same oligonucleotide primer sequence set forth in SEQ ID NOS.: 14 and 15 (see SEQ ID NO.: 9 in the patent and Appendix B).
Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to prepare double-quenched SAR-CoV-2 oligonucleotide probes, as taught by Hirotsu et al. (2020), and to modify these probes to incorporate a 5’ biotin, as disclosed by Danielli et al. (2009), to facilitate their rapid detection utilizing MMB. One of ordinary skill in the art would have been motivated to make these modifications and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting SARS-CoV-2 nucleic acids.
Claims 29-32, 34, 36, and 37 are rejected under 35 U.S.C. § 103 as being unpatentable over Pilotte et al. (2016, Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design, PLoS Negl. Trop. Dis. 10(3):e0004578, pp. 1-18) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863). Claim 29 is directed toward an oligonucleotide probe comprising 10-300 nucleotides, wherein said probe has the following characteristics: a) a fluorescent moiety attached to the first nucleotide (5’); b) a first quencher attached to a second nucleotide; c) a second quencher attached to a third nucleotide located between the first and second nucleotides; and d) a member of an affinity pair attached 5’ to said third nucleotide. Claim 30 specifies the first nucleotide is the 5’ nucleotide. Claim 31 specifies the second nucleotide is the 3’ nucleotide and said nucleotide is 5-20 nucleotides from the 5’ nucleotide. Claim 34 references a first quencher (e.g., DABCYL, TAMRATM, Eclipse®, DDQ, QSY, Blackberry quencher, Qx1, Black Hole QuencherTM (BHQTM), Iowa Black® FQ, Iowa Black® RQ, and IRDye QC-1) and second quencher (e.g., ZEN® and TAOTM). Claim 36 references biotin/avidin or biotin/streptavidin affinity pairs. Claim 37 references an oligonucleotide probe no longer than 30 nucleotides.
Pilotte et al. (2016) disclose a real-time reverse transcription polymerase chain reaction (RT-PCR) assay for the detection of parasitic soil helminths. PCR primers and a double-quenched probes directed against Necator americanus, Ancylostoma duodenale, Trichuris trichiuria, and Strongyloides stercoralis were generated. The probes contained a 5’ FAM dye, internal ZEN® quencher, and 3’ Iowa Black® FQ quencher. The internal ZEN® quencher is incorporated between the ninth and tenth bases from the 5’end of the probe (5'-FAM/CCC GAT TTG/ZEN/AGC TGA ATT GTC AAA/IBFQ-3’; 5'-FAM/TGA CAG TGT/ZEN/GTC ATA CTG TGG AAA/IBFQ-3'; 5'-FAM/TTT GCG GGC/ZEN/GAG AAC GGA AAT ATT/IBFQ-3'; and 5'-FAM/ACA GTC TCC/ZEN/AGT TCA CTC CAG AAG AGT/IBFQ-3'; corresponding to N. americanus, A. duodenale, T. trichiuria, and S. stercoralis, respectively) (see Materials and methods, Primer and probe design, pp. 4-5; Table 1, Selected primer and probe sequences for each multi-parallel assay, p. 7). This design decreased the distance between the dye and quencher and reduced the background signal while achieving a higher dynamic signal. The authors noted that the probes provided a sensitive system for detecting species-specific helminths (see Discussion, p. 11). This teaching meets all of the claimed limitations with one exception, it fails to disclose the utilization of an affinity member pair (e.g., biotin).
Danielli et al. (2009) disclose the utilization of an RT-PCR FRET-based magnetic modulation biosensing assay for the detection of Ibaraki virus nucleic acids (see Fig. 1, p. 859, reproduced on next page). This procedure utilizes a double-labeled nucleic acid probe (5’-(Alexa488/biotin-dTCT TTA TCT GTC GCA ACC G-BHQ-3’) comprising a fluorescent dye and biotin at the 5’ on the same nucleotide and a dark quencher at the 3’ (see Materials and Methods, 2.1. FRET-based magnetic modulation biosensing (MMB) assay, p. 859; 2.3. FRET-based DNA biosensor synthesis). Taq polymerase cleaves the FRET-based probe to produce a fluorescent signal. The biotinylated probe is attached to streptavidin-coupled superparamagnetic beads and subjected to magnetic modulation. The authors noted that this system provides a rapid and sensitive method for the detection of viral nucleic acids. The rapid reaction time (<20 min), sensitivity (pM amount detection), and simplicity render this system useful for the rapid detection of various pathogens (see Summary, p. 863).
PNG
media_image1.png
360
614
media_image1.png
Greyscale
Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the double-quenched oligonucleotide probe of Pilotte et al. (2016), to incorporate a biotin (or other suitable affinity member) at the 5’ terminus, as disclosed by Danielli et al. (2009), to facilitate the detection of different parasitic helminth nucleic acids. One of ordinary skill in the art would have been motivated to make this modification and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting parasitic nucleic acids.
Claim 38 is rejected under 35 U.S.C. § 103 as being unpatentable over Pilotte et al. (2016, Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design, PLoS Negl. Trop. Dis. 10(3):e0004578, pp. 1-18) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863), as applied supra to claim 29, and further in view of Hamburger et al. (2001, POLYMERASE CHAIN REACTION ASSAY BASED ON A HIGHLY REPEATED SEQUENCE OF SCHISTOSOMA HAEMATOBIUM: A POTENTIAL TOOL FOR MONITORING SCHISTOSOME-INFESTED WATER, Am. J. Trop. Med. Hyg. 65(6):907-911). Claim 38 references an oligonucleotide that hybridizes to a nucleic acid sequence that appears more than 100x in a single chromosome.
Hamburger et al. (2001) discloses a PCR assay for the detection of a highly repeated Schistosoma haemtobium DraI sequence (see Fig. 1 and MATERIALS AND METHODS, Polymerase chain reaction assay, p. 908). The authors noted that S. haemtobium contains hundreds of thousands of DraI repeats in the schistosome genome. Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to prepare double-quenched S. haemtobium oligonucleotide probes, as taught by Pilotte et al. (2016), and to modify these probes to incorporate a 5’ biotin, as disclosed by Danielli et al. (2009), to facilitate their rapid detection utilizing MMB. One of ordinary skill in the art would have been motivated to make these modifications and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting schistosome nucleic acids.
Claim 40 is rejected under 35 U.S.C. § 103 as being unpatentable over Pilotte et al. (2016, Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design, PLoS Negl. Trop. Dis. 10(3):e0004578, pp. 1-18) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863), as applied supra to claim 29, and further in view of Donati et al. (U.S. Pat. No. 11,001,901 B1, issued 11 May, 2021, and claiming priority to U.S. Appl. No. 16/809,717, filed 05 March, 2020; hereinafter referred to as “Donati et al. (2021)”) and Kim and Cha (U.S. Pat. No. 11,976,338 B2, issued 07 May, 2024, and claiming priority to PCT/KR2020/005337, filed 22 April, 2020; hereinafter referred to as “Kim and Cha (2024)”). Claim 40 references SARS-CoV-2 oligonucleotide probes corresponding to SEQ ID NOS.: 11, 14, 15, and 16. These probes are directed toward the E and RdRp genes and have the following structures:
1) SEQ ID NO.: 11 (SARS-CoV-2 E_Sarbeco_P1 probe):
5’-ATTO/Biotin/-ACA CTA GCC/ZEN/ATC CTT ACT GCG CTT CG-IBFQ/-3’;
2) SEQ ID NO.: 14 (SARS-CoV-2 RdRp probe):
5’-Biotin/ATTO-CAG GTG GAA/ZEN/CCT CAT CAG GAG ATG C-IBFQ/-3’;
3) SEQ ID NO.: 15 (SARS-CoV-2 RdRp gene):
5’-CAG GTG GAA CCT CAT CAG GAG ATG C-3’; and,
4) SEQ ID NO.: 16 (SARS-CoV-2 E gene):
5’-ACA CTA GCC ATC CTT ACT GCG CTT CG-3’.
Donati et al. (2021) disclose SARS-CoV-2-specific PCR primers and probes for real-time RT-PCR assays. In particular, this teaching discloses the same oligonucleotide primer sequence set forth in SEQ ID NOS.: 11 and 16 (see SEQ ID NO.: 9 in the patent and Appendix A).
Kim and Cha (2024) disclose SARS-CoV-2-specific PCR primers and probes for real-time RT-PCR assays. In particular, this teaching discloses the same oligonucleotide primer sequence set forth in SEQ ID NOS.: 14 and 15 (see SEQ ID NO.: 9 in the patent and Appendix B).
Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to prepare double-quenched SAR-CoV-2 oligonucleotide probes, as taught by Pilotte et al. (2016), and to modify these probes to incorporate a 5’ biotin, as disclosed by Danielli et al. (2009), to facilitate their rapid detection utilizing MMB. One of ordinary skill in the art would have been motivated to make these modifications and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting SARS-CoV-2 nucleic acids.
Correspondence
Any inquiry concerning this communication should be directed to Jeffrey S. Parkin, Ph.D., whose telephone number is (571) 272-0908. The Examiner can normally be reached Monday through Friday from 10:00 AM to 6:00 PM. A message may be left on the Examiner's voice mail service. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the Examiner are unsuccessful, the Examiner's supervisor, Michael Allen, Ph.D., can be reached at (571) 270-3497. Direct general status inquiries to the Technology Center 1600 receptionist at (571) 272-1600.
Information regarding the status of an application may be obtained from the Patent Center. Status information for published applications may be obtained from the Patent Center. Status information for unpublished applications is available through the Patent Center for authorized users only. Should you have questions about access to Patent Center, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Respectfully,
/JEFFREY S PARKIN/Primary Examiner, Art Unit 1671 18 February, 2026
Appendix A
RESULT 1 (SEQ ID NOS.: 11/16)
US-16-809-717-9
Sequence 9, US/16809717
Patent No. 11001901
APPLICANT: INSTITUT PASTEUR
APPLICANT: DONATI, Flora
APPLICANT: ALBERT, Melanie
APPLICANT: BEHILIL, Sylvie
APPLICANT: ENOUF, Vincent
APPLICANT: VAN DER WERF, Sylvie
TITLE OF INVENTION: METHODS AND REAGENTS FOR THE SPECIFIC AND SENSITIVE DETECTION OF SARS-CoV-2
CURRENT APPLICATION NUMBER: US/16/809,717
CURRENT FILING DATE: 2020-03-05
NUMBER OF SEQ ID NOS: 19
SEQ ID NO 9
LENGTH: 26
TYPE: DNA
ORGANISM: artificial sequence
FEATURE:
OTHER INFORMATION: synthetic oligonucleotide (probe E_Sarbeco_P1)
Query Match 100.0%; Score 26; Length 26; Best Local Similarity 100.0%;
Matches 26; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACACTAGCCATCCTTACTGCGCTTCG 26
||||||||||||||||||||||||||
Db 1 ACACTAGCCATCCTTACTGCGCTTCG 26
Appendix B
RESULT 1 (SEQ ID NOS.: 14/15)
US-17-274-748A-9
Sequence 9, US/17274748A
Patent No. 11976338
APPLICANT: OSANG HEALTHCARE CO., LTD
TITLE OF INVENTION: METHOD FOR PREPARING DIAGNOSTIC KIT OF CORONA VIRUS, DIAGNOSTIC KIT OF CORONA VIRUS PREPARED USING THE SAME AND METHOD OF DIAGNOSING CORONA VIRUS USING THE SAME
CURRENT APPLICATION NUMBER: US/17/274,748A
CURRENT FILING DATE: 2021-03-09
PRIOR APPLICATION NUMBER: PCT/KR2020/005337
PRIOR FILING DATE: 2020-04-22
NUMBER OF SEQ ID NOS: 18
SEQ ID NO 9
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: B_RdRP_P2 PROBE
Query Match 100.0%; Score 25; Length 25; Best Local Similarity 100.0%; Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CAGGTGGAACCTCATCAGGAGATGC 25
|||||||||||||||||||||||||
Db 1 CAGGTGGAACCTCATCAGGAGATGC 25