Prosecution Insights
Last updated: October 04, 2026
Application No. 18/014,507

DETECTING AND QUANTIFYING A VIRAL TARGET NUCLEIC ACID SEQUENCE

Final Rejection §103§112
Filed
Jan 05, 2023
Priority
Jul 07, 2020 — nonprovisional of PCTIL2020050761
Examiner
PARKIN, JEFFREY S
Art Unit
1671
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Bar-Ilan University
OA Round
2 (Final)
64%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
85%
With Interview

Examiner Intelligence

Grants 64% of resolved cases
64%
Career Allowance Rate
557 granted / 874 resolved
+3.7% vs TC avg
Strong +22% interview lift
Without
With
+21.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
32 currently pending
Career history
907
Total Applications
across all art units

Statute-Specific Performance

§101
4.1%
-35.9% vs TC avg
§103
25.8%
-14.2% vs TC avg
§102
7.6%
-32.4% vs TC avg
§112
52.2%
+12.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 874 resolved cases

Office Action

§103 §112
Detailed Office Action Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of the Claims Acknowledgement is hereby made of receipt and entry of the communication filed 05 June, 2026. Claims 1, 2, 6, 10, 11, 14, 29-32, 36-38, 40, and 42-46 are pending in the instant application. Claims 1, 2, 6, 10, 11, 14, and 42-46 stand withdrawn from further consideration by the Examiner, pursuant to 37 C.F.R. § 1.142(b), as being drawn to a non-elected invention. 35 U.S.C. § 112(b) The following is a quotation of 35 U.S.C. § 112(b): (b) CONCLUSION. —The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The previous rejection of claims 29-32, 34, 36-38, and 40 are rejected under 35 U.S.C. § 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, regards as the invention, is hereby withdrawn in response to Applicant’s amendment and arguments. 35 U.S.C. § 112(a) The following is a quotation of 35 U.S.C. § 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Written Description The previous rejection of claims 29-32, 34, and 36-38 under 35 U.S.C. § 112(a), as failing to comply with the written description requirement, is hereby withdrawn in response to Applicant’s amendment and arguments. Scope of Enablement The previous rejection of claim 34 under 35 U.S.C. § 112(a), because the specification does not reasonably enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims, is hereby withdrawn in response to Applicant’s amendment. Joint Inventors, Common Ownership Presumed This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were effectively filed absent any evidence to the contrary. Applicant is advised of the obligation under 37 C.F.R. § 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned at the time a later invention was effectively filed in order for the examiner to consider the applicability of 35 U.S.C. § 102(b)(2)(C) for any potential 35 U.S.C. § 102(a)(2) prior art against the later invention. 35 U.S.C. § 103 The following is a quotation of 35 U.S.C. § 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 29-32, 36, and 37 stand rejected under 35 U.S.C. § 103 as being unpatentable over Hirotsu et al. (2020, Double-Quencher Probes Improved the Detection Sensitivity of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) by One-Step RT-PCR, medRxiv, doi.org/10.1101/2020.03.17.20037903, pp. 1-16) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863). Claim 29 is directed toward an oligonucleotide probe comprising 10-300 nucleotides, wherein said probe has the following characteristics: a) a fluorescent moiety attached to the first nucleotide (5’); b) a first quencher attached to a second nucleotide; c) a second quencher attached to a third nucleotide located between the first and second nucleotides; and d) a member of an affinity pair attached 5’ to said third nucleotide. Claim 30 specifies the first nucleotide is the 5’ nucleotide. Claim 31 specifies the second nucleotide is the 3’ nucleotide and said nucleotide is 5-20 nucleotides from the 5’ nucleotide. Claim 34 references a first quencher (e.g., DABCYL, TAMRATM, Eclipse®, DDQ, QSY, Blackberry quencher, Qx1, Black Hole QuencherTM (BHQTM), Iowa Black® FQ, Iowa Black® RQ, and IRDye QC-1) and second quencher (e.g., ZEN® and TAOTM). Claim 36 references biotin/avidin or biotin/streptavidin affinity pairs. Claim 37 references an oligonucleotide probe no longer than 30 nucleotides. Hirotsu et al. (2020) disclose a real-time reverse transcription polymerase chain reaction (RT-PCR) assay for the detection of SARS-CoV-2. PCR primers and a double-quenched probe directed against the nucleocapsid gene were generated. The probe contained a 5’ FAM dye, internal ZEN® quencher, and 3’ Iowa Black® FQ quencher. The internal ZEN® quencher is incorporated between the ninth and tenth bases from the 5’end of the probe (5’-FAM/ATG TCG CGC/ZEN/ATT GGC ATG GA-IBFQ-3'). This design decreased the distance between the dye and quencher and reduced the background signal while achieving a higher dynamic signal (see Materials and Methods, Primer and probe sets, p. 4; Results, Design of primer and probes to detect SARS-CoV-2, pp. 5-6; and Table 1, p. 13). This teaching meets all of the claimed limitations with one exception, it fails to disclose the utilization of an affinity member pair (e.g., biotin). Danielli et al. (2009) disclose the utilization of an RT-PCR FRET-based magnetic modulation biosensing assay for the detection of Ibaraki virus nucleic acids (see Fig. 1, p. 859, reproduced on next page). This procedure utilizes a double-labeled nucleic acid probe (5’-(Alexa488/biotin-dTCT TTA TCT GTC GCA ACC G-BHQ-3’) comprising a fluorescent dye and biotin at the 5’ on the same nucleotide and a dark quencher at the 3’ (see Materials and Methods, 2.1. FRET-based magnetic modulation biosensing (MMB) assay, p. 859; 2.3. FRET-based DNA biosensor synthesis). Taq polymerase cleaves the FRET-based probe to produce a fluorescent signal. The biotinylated probe is attached to streptavidin-coupled superparamagnetic beads and subjected to magnetic modulation. The authors noted that this system provides a rapid and sensitive method for the detection of viral nucleic acids. The rapid reaction time (<20 min), sensitivity (pM amount detection), and simplicity render this system useful for the rapid detection of various pathogens (see Summary, p. 863). PNG media_image1.png 360 614 media_image1.png Greyscale Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the double-quenched oligonucleotide probe of Hirotsu et al. (2020), to incorporate a biotin (or other suitable affinity member) at the 5’ terminus, as disclosed by Danielli et al. (2009), to facilitate the detection of viral nucleic acids. One of ordinary skill in the art would have been motivated to make this modification and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting viral nucleic acids. Applicant traverses and submits that while Hirotsu et al. (2020) teaches double-quencher probes (e.g., see Fig. 3) with an internal quencher (ZEN) positioned between the 5’ fluorescent moiety (FAM) and 3’ quencher moiety (IBFQ), it fails to teach or suggest the utilization of an affinity pair member. While Danielli et al. (2009) teach detection systems employing biotinylated probes and magnetic beads, it fails to teach or suggest modifying double-quencher probes to incorporate an affinity moiety. It was argued that the prior art fails to provide any motivation or suggesting to combine these teachings. Applicant’s arguments have been carefully considered but are not deemed to be persuasive for the reasons of record clearly set forth supra. In response to Applicant’s arguments that the Examiner’s conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant’s disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 U.S.P.Q. 209 (C.C.P.A. 1971). Hirotsu et al. (2020) unequivocally demonstrate that double-quencher probes decrease the background signal in RT-PCR reactions leading to a higher dynamic range which facilitated the detection of low numbers of SARS-CoV-2 in clinical samples. The high background fluorescence was reduced by creating a shorter distance between the fluorescence dye and the quencher, and because the probe formed a three-dimensional structure due to self-quenching. Danielli et al. (2009) provide a FRET-based magnetic modulation biosensing assay that utilizes a double-labeled nucleic acid probe. The probe contains a fluorescent dye and biotin on the same nucleotide at the 5’ end and a dark quencher connected to the 3’ end. The biotinylated probes are attached to streptavidin-coupled superparamagnetic beads to facilitate detection. The authors concluded that magnetic modulation and synchronous detection can be used for the rapid and sensitive detection of virus. As previously set forth, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the double-quenched oligonucleotide probe of Hirotsu et al. (2020), to incorporate a biotin (or other suitable affinity member) at the 5’ terminus, as disclosed by Danielli et al. (2009), to facilitate the detection of viral nucleic acids. One of ordinary skill in the art would have been motivated to make this modification and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting viral nucleic acids. Both the motivation and a reasonable expectation of success were present in the prior art. Claim 38 stands rejected under 35 U.S.C. § 103 as being unpatentable over Hirotsu et al. (2020, Double-Quencher Probes Improved the Detection Sensitivity of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) by One-Step RT-PCR, medRxiv, doi.org/10.1101/2020.03.17.20037903, pp. 1-16) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863), as applied supra to claim 29, and further in view of Hamburger et al. (2001, POLYMERASE CHAIN REACTION ASSAY BASED ON A HIGHLY REPEATED SEQUENCE OF SCHISTOSOMA HAEMATOBIUM: A POTENTIAL TOOL FOR MONITORING SCHISTOSOME-INFESTED WATER, Am. J. Trop. Med. Hyg. 65(6):907-911). Claim 38 references an oligonucleotide that hybridizes to a nucleic acid sequence that appears more than 100x in a single chromosome. Hamburger et al. (2001) discloses a PCR assay for the detection of a highly repeated Schistosoma haemtobium DraI sequence (see Fig. 1 and MATERIALS AND METHODS, Polymerase chain reaction assay, p. 908). The authors noted that S. haemtobium contains hundreds of thousands of DraI repeats in the schistosome genome. Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to prepare double-quenched S. haemtobium oligonucleotide probes, as taught by Hirotsu et al. (2020), and to modify these probes to incorporate a 5’ biotin, as disclosed by Danielli et al. (2009), to facilitate their rapid detection utilizing MMB. One of ordinary skill in the art would have been motivated to make these modifications and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting schistosome nucleic acids. Applicant’s arguments have been carefully considered but are not deemed to be persuasive for the reasons of record set forth supra. Claim 40 stands rejected under 35 U.S.C. § 103 as being unpatentable over Hirotsu et al. (2020, Double-Quencher Probes Improved the Detection Sensitivity of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) by One-Step RT-PCR, medRxiv, doi.org/10.1101/2020.03.17.20037903, pp. 1-16) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863), as applied supra to claim 29, and further in view of Donati et al. (U.S. Pat. No. 11,001,901 B1, issued 11 May, 2021, and claiming priority to U.S. Appl. No. 16/809,717, filed 05 March, 2020; hereinafter referred to as “Donati et al. (2021)”) and Kim and Cha (U.S. Pat. No. 11,976,338 B2, issued 07 May, 2024, and claiming priority to PCT/KR2020/005337, filed 22 April, 2020; hereinafter referred to as “Kim and Cha (2024)”). Claim 40 references SARS-CoV-2 oligonucleotide probes corresponding to SEQ ID NOS.: 11, 14, 15, and 16. These probes are directed toward the E and RdRp genes and have the following structures: 1) SEQ ID NO.: 11 (SARS-CoV-2 E_Sarbeco_P1 probe): 5’-ATTO/Biotin/-ACA CTA GCC/ZEN/ATC CTT ACT GCG CTT CG-IBFQ/-3’; 2) SEQ ID NO.: 14 (SARS-CoV-2 RdRp probe): 5’-Biotin/ATTO-CAG GTG GAA/ZEN/CCT CAT CAG GAG ATG C-IBFQ/-3’; 3) SEQ ID NO.: 15 (SARS-CoV-2 RdRp gene): 5’-CAG GTG GAA CCT CAT CAG GAG ATG C-3’; and, 4) SEQ ID NO.: 16 (SARS-CoV-2 E gene): 5’-ACA CTA GCC ATC CTT ACT GCG CTT CG-3’. Donati et al. (2021) disclose SARS-CoV-2-specific PCR primers and probes for real-time RT-PCR assays. In particular, this teaching discloses the same oligonucleotide primer sequence set forth in SEQ ID NOS.: 11 and 16 (see SEQ ID NO.: 9 in the patent and Appendix A). Kim and Cha (2024) disclose SARS-CoV-2-specific PCR primers and probes for real-time RT-PCR assays. In particular, this teaching discloses the same oligonucleotide primer sequence set forth in SEQ ID NOS.: 14 and 15 (see SEQ ID NO.: 9 in the patent and Appendix B). Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to prepare double-quenched SAR-CoV-2 oligonucleotide probes, as taught by Hirotsu et al. (2020), and to modify these probes to incorporate a 5’ biotin, as disclosed by Danielli et al. (2009), to facilitate their rapid detection utilizing MMB. One of ordinary skill in the art would have been motivated to make these modifications and utilize the MMB system because it provides a rapid, sensitive, and simple system for detecting SARS-CoV-2 nucleic acids. Applicant’s arguments have been carefully considered but are not deemed to be persuasive for the reasons of record set forth supra. The previous rejection of claims 29-32, 36, and 37 under 35 U.S.C. § 103 as being unpatentable over Pilotte et al. (2016, Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design, PLoS Negl. Trop. Dis. 10(3):e0004578, pp. 1-18) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863), is hereby withdrawn in response to Applicant’s arguments. The previous rejection of claim 38 under 35 U.S.C. § 103 as being unpatentable over Pilotte et al. (2016, Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design, PLoS Negl. Trop. Dis. 10(3):e0004578, pp. 1-18) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863), as applied supra to claim 29, and further in view of Hamburger et al. (2001, POLYMERASE CHAIN REACTION ASSAY BASED ON A HIGHLY REPEATED SEQUENCE OF SCHISTOSOMA HAEMATOBIUM: A POTENTIAL TOOL FOR MONITORING SCHISTOSOME-INFESTED WATER, Am. J. Trop. Med. Hyg. 65(6):907-911), is hereby withdrawn in response to Applicant’s arguments. The previous rejection of claim 40 under 35 U.S.C. § 103 as being unpatentable over Pilotte et al. (2016, Improved PCR-Based Detection of Soil Transmitted Helminth Infections Using a Next-Generation Sequencing Approach to Assay Design, PLoS Negl. Trop. Dis. 10(3):e0004578, pp. 1-18) in view of Danielli et al. (2009, Rapid homogenous detection of the Ibaraki virus NS3 cDNA at picomolar concentrations by magnetic modulation, Biosensors and Bioelectronics, 25:858-863), as applied supra to claim 29, and further in view of Donati et al. (U.S. Pat. No. 11,001,901 B1, issued 11 May, 2021, and claiming priority to U.S. Appl. No. 16/809,717, filed 05 March, 2020; hereinafter referred to as “Donati et al. (2021)”) and Kim and Cha (U.S. Pat. No. 11,976,338 B2, issued 07 May, 2024, and claiming priority to PCT/KR2020/005337, filed 22 April, 2020; hereinafter referred to as “Kim and Cha (2024)”), is hereby withdrawn in response to Applicant’s arguments. Action Is Final THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 C.F.R. § 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 C.F.R. § 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Correspondence Any inquiry concerning this communication should be directed to Jeffrey S. Parkin, Ph.D., whose telephone number is (571) 272-0908. The Examiner can normally be reached Monday through Friday from 10:00 AM to 6:00 PM. A message may be left on the Examiner's voice mail service. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the Examiner are unsuccessful, the Examiner's supervisor, Michael Allen, Ph.D., can be reached at (571) 270-3497. Direct general status inquiries to the Technology Center 1600 receptionist at (571) 272-1600. Information regarding the status of an application may be obtained from the Patent Center. Status information for published applications may be obtained from the Patent Center. Status information for unpublished applications is available through the Patent Center for authorized users only. Should you have questions about access to Patent Center, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Respectfully, /JEFFREY S PARKIN/Primary Examiner, Art Unit 1671 12 August, 2026 Appendix A RESULT 1 (SEQ ID NOS.: 11/16) US-16-809-717-9 Sequence 9, US/16809717 Patent No. 11001901 APPLICANT: INSTITUT PASTEUR APPLICANT: DONATI, Flora APPLICANT: ALBERT, Melanie APPLICANT: BEHILIL, Sylvie APPLICANT: ENOUF, Vincent APPLICANT: VAN DER WERF, Sylvie TITLE OF INVENTION: METHODS AND REAGENTS FOR THE SPECIFIC AND SENSITIVE DETECTION OF SARS-CoV-2 CURRENT APPLICATION NUMBER: US/16/809,717 CURRENT FILING DATE: 2020-03-05 NUMBER OF SEQ ID NOS: 19 SEQ ID NO 9 LENGTH: 26 TYPE: DNA ORGANISM: artificial sequence FEATURE: OTHER INFORMATION: synthetic oligonucleotide (probe E_Sarbeco_P1) Query Match 100.0%; Score 26; Length 26; Best Local Similarity 100.0%; Matches 26; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACACTAGCCATCCTTACTGCGCTTCG 26 |||||||||||||||||||||||||| Db 1 ACACTAGCCATCCTTACTGCGCTTCG 26 Appendix B RESULT 1 (SEQ ID NOS.: 14/15) US-17-274-748A-9 Sequence 9, US/17274748A Patent No. 11976338 APPLICANT: OSANG HEALTHCARE CO., LTD TITLE OF INVENTION: METHOD FOR PREPARING DIAGNOSTIC KIT OF CORONA VIRUS, DIAGNOSTIC KIT OF CORONA VIRUS PREPARED USING THE SAME AND METHOD OF DIAGNOSING CORONA VIRUS USING THE SAME CURRENT APPLICATION NUMBER: US/17/274,748A CURRENT FILING DATE: 2021-03-09 PRIOR APPLICATION NUMBER: PCT/KR2020/005337 PRIOR FILING DATE: 2020-04-22 NUMBER OF SEQ ID NOS: 18 SEQ ID NO 9 LENGTH: 25 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: B_RdRP_P2 PROBE Query Match 100.0%; Score 25; Length 25; Best Local Similarity 100.0%; Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGGTGGAACCTCATCAGGAGATGC 25 ||||||||||||||||||||||||| Db 1 CAGGTGGAACCTCATCAGGAGATGC 25
Read full office action

Prosecution Timeline

Jan 05, 2023
Application Filed
Mar 05, 2026
Non-Final Rejection mailed — §103, §112
Jun 05, 2026
Response Filed
Aug 17, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747454
SELF-INACTIVATING LENTIVIRAL VECTOR COMPRISING A FOXP3 EXPRESSION CASSETTE
2y 3m to grant Granted Sep 29, 2026
Patent 12742216
METHOD FOR DETERMINING TITER OF RNA VIRAL VECTORS
3y 6m to grant Granted Sep 22, 2026
Patent 12709753
HIV IMMUNOTHERAPY WITH NO PRE-IMMUNIZATION STEP
7y 1m to grant Granted Aug 18, 2026
Patent 12708637
IMMUNOGENIC COMPOSITIONS CONTAINING N-GLYCOL YLNEURAMINIC ACID BEARING NANOPARTICLES
5y 2m to grant Granted Aug 18, 2026
Patent 12698316
ENGINEERED IMMUNE-MOBILIZING T-CELL RECEPTORS WITH ENHANCED AFFINITY FOR HIV-1 GAG
4y 0m to grant Granted Aug 04, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
64%
Grant Probability
85%
With Interview (+21.7%)
3y 5m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 874 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month