Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Election/Restrictions
Applicant’s election without traverse of Group I and species SEQ ID NO: 1, 21, and 36, as well as probe that hybridize to SEQ ID NO: 2, 22, and 37 in the reply filed on 2/12/26 is acknowledged.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 3-10 and 15-17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
It is unclear what is meant by the text in parentheticals. First, the moniker “mASCL2” is not a term of art, nor are the other two monikers. ASCL2, LDHB, and LGALS3 are genes that are known and understood in the prior art, but it is unclear what is meant or required by adding the “m” before the gene names. Furthermore, ASCL2 is broader than SEQ ID NO: 1, encompassing polymorphic variants, for example, whereas SEQ ID NO: 1 appears to be a singular fixed genetic sequence, and it is not clear if the broader recitation in the parenthetical is meant to be optional or how it is meant to be related to SEQ ID NO: 1. A similar argument applies to the parentheticals after SEQ ID NO: 21 and SEQ ID NO: 36.
Further, the recitation “the genomic DNA may comprise DNA derived from liver cancer (LC) cells” is indefinite because it is unclear whether the limitation following “may” is part of the claimed invention. See MPEP § 2173.05(d).
Regarding claim 6, the phrase "preferably" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claims 8, 9, 10, are indefinite when they refer to “the absence of detected methylation” because claim 1 requires detecting methylation and does not encompass methods in which DNA methylation is not detected. Therefore, this phrase lacks proper antecedent basis. As a consequence, is not clear if the independent claim is intended to encompass detecting whether or not there is methylation within the recited genomic sequences, or whether the independent claim is intended to require detecting methylation is present. For the purposes of compact prosecution, the claims are interpreted to mean the former in light of the dependent claims but should be clarified.
Claims 15-17 are indefinite because they recite a method for detecting liver cancer, or monitoring liver cancer in the preamble, but the body of the claims do not include any steps related to detecting or monitoring liver cancer. It is unclear if the claims are meant to require some step of detecting or monitoring liver cancer, or if mere practice of the method steps as written is sufficient to practice the method. If it is the former, it appears the claim is missing steps to elucidate this requirement and these should be added.
Regarding claim 16, the phrase "preferably" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
With regard to claim 16, the claim is confusing because it recites the use of “an oligonucleotide” that comprises a sequence substantially identical to a stretch of contiguous nucleotides of SEQ ID NO: 2, SEQ ID NO: 22, and SEQ ID NO: 37. It is not clear how “an oligonucleotide” would be structured that comprises a sequence substantially identical to all three of these, or if in fact the oligonucleotide must comprise a sequence substantially identical to only one of these or if in fact applicant intended to require three oligonucleotides, one comprising sequence substantially identical to each of these. Claim 17 is similarly indefinite because the claim requires use of a kit comprising “at least a first oligonucleotide and a second oligonucleotide” comprising a sequence substantially identical to a stretch of contiguous nucleotides of SEQ ID NO: 2, SEQ ID NO: 22, and SEQ ID NO: 37. The claims must be clarified, and were interpreted so as to require one or two oligonucleotides wherein the oligonucleotide or oligonucleotides each independently comprise a sequence substantially identical to a stretch of contiguous nucleotide of one of the three recited SEQ ID NO.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 8, 9, 10, 15, 16, and 17 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a law of nature without significantly more. The claim(s) recite(s) that methylated genomic DNA indicates the presence of liver cancer and unmethylated genomic DNA indicates the absence of liver cancer. This judicial exception is not integrated into a practical application because the claims do not use or apply the judicial exception in any way. There is no treatment or other use of the judicial exception. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the steps in addition to the judicial exception, namely detecting DNA methylation in a sample are data gathering steps recited at an extremely high level of generality that employ well established and routine steps to gather the data. This is evidenced by the instant specification teach teaches using routine real-time PCCR methods for detecting methylation markers (p. 39, line 23, and also the Revill reference cited herein which exemplifies measuring methylation in the recited genes using a commercially available bead array using probes that hybridize to the bisulfite treated sequences).
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1, 3, 4, 5, 6, 7, 8, 10, 15, 16 and 17 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Revill et al. (GASTROENTEROLOGY 2013; 145:1424–1435, including supplementary materials), as evidenced by Geo Platform Record having accession GPL8490 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL8490).
Revill teaches performing array-based analysis on primary hepatocellular carcinoma samples and nondiseased normal tissues (p. 1424, col. 2). Namely whole genome methylation analysis was performed using the HumanMethylation27 BeadChip (p. 1425, Methylation Profiling), which included bisulfite converting genomic DNA and then hybridizing genomic DNA to a BeadChip to detect DNA methylation within the genomic DNA of the biological sample (p. 1435e.1, DNA Methylation Analysis). The reference reports detecting methylation in ASCL2, LDHB and LGALS3, see Supplementary Table 1, with all three genes having increased methylation in tumors.
Revill further teaches obtaining AFP levels from the patients (Table 1).
Revill quantifies the amount of methylated genomic DNA, see Supplementary Table 1. (p. 1435e.1, DNA Methylation Analysis).
Revill teaches a biological sample that is liver tissue (Methylation profiling, p. 1425).
Revill teaches detecting methylation from subjects that have Liver Cancer.
Regarding claims 8 and 10, the reference teaches increased methylation in the genes was present in Liver Cancer, and that patients with liver cancer had increased AFP. The “wherein” clauses in the claims state an inherent property of the observation, it does not instruct any further action or activity.
Regarding claims 16 and 17, the HumanMethylation27 bead array taught by the reference inherently uses oligonucleotides comprising a sequence that is substantially identical to a stretch of contiguous nucleotides of SEQ ID NO: 2, SEQ ID NO: 22 and SEQ ID NO: 27. The supplemental table in the reference gives the “cg” identifier for the CpG assayed and detected as differentially methylated in each of the genes. The data supporting the HumanMethylation27 bead array including the probes present on the array for each CpG site assayed. The data was accessed online, and the probes for the relevant CpG are below, with an alignment of the first probe in each set to the respective SEQ ID NO from the claim:
ASCL2 cg06263495
AAAACTCACAAATTTCACCAATTAAACACACTAAAAATCTATAAACTACA AAAACTCGCAAATTTCGCCAATTAAACGCACTAAAAATCTATAAACTACG
PNG
media_image1.png
182
588
media_image1.png
Greyscale
LDHB cg03243946
AAACTCTTCAATACAAAAACCAAATTATTTATAAAACTTACCCATCCCCA AAACTCTTCAATACGAAAACCAAATTATTTATAAAACTTACCCATCCCCG
PNG
media_image2.png
71
466
media_image2.png
Greyscale
LGALS3 cg19099850
AAAAAAACAAACCAAACAAAACTAAAAATATTTAAAACTCAAAACCACCA AAAAAAACGAACCGAACGAAACTAAAAATATTTAAAACTCGAAACCACCG
PNG
media_image3.png
126
509
media_image3.png
Greyscale
With regard to anticipation of claim 16, the claim is extremely broadly drawn to require that the probe “comprises” a sequence that is “substantially identical to” the SEQ ID NO. In teach case the probe of the prior art “comprises” such a sequence.
With regard to anticipation of claim 17, the reference teaches using the commercially available bead array (i.e. a kit) that comprises first and second probes that comprise a sequence substantially identical to each of the SEQ ID NO. See above.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over Revill et al. (GASTROENTEROLOGY 2013; 145:1424–1435, including supplementary materials).
Revill teaches the method according to claim 8, as discussed fully in this Office action and fully incorporated here.
Revill teaches measuring the methylation status of patients but does not teach carrying out the method more than once, i.e. “repeatedly,” as claimed.
Revill teaches that patients had recurrence (Table 1).
It would have been obvious to have modified the method taught by Revill so as to have additionally measured methylation using the HumanMethylation27 BeadChip in tissue from the recurrent tumors in order to further study the methylation patterns in recurrent tumors.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Juliet Switzer whose telephone number is (571)272-0753. The examiner can normally be reached Monday to Thursday, 8:00 AM-3:30 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at (571)-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Juliet Switzer
Primary Examiner
Art Unit 1682
/JULIET C SWITZER/ Primary Examiner, Art Unit 1682