DETAILED ACTION
Election/Restrictions
Applicant's election with traverse of Group I and nucleic acids in the reply filed on June 15 2026 is acknowledged. The traversal is on the ground(s) that the instant claims are drawn to decreasing the level or activity of ZNF410. Chakraborty neither teaches or suggests a connection between ZNF410 levels and fetal hemoglobin levels or hemoglobinopathies. The examiner’s argument that the special technical feature is based on Chakraborty allegedly being directed to materials and method for treatment of hemoglobinopathies by administering one or more sgRNAs. This argument inappropriately relies on distilling the invention down to the gist or thrust of the invention, which disregards the requirement of analyzing the subject matter as a whole and refers to MPEP 2141.02. It is argued that the instant application is drawing in part to the discover of zinc finer protein as a repressor of fetal hemoglobin. This is not found persuasive because while the methods claim treatment of hemoglobinopathies, the product claims merely require nucleic acid sequences. This technical feature is not required of Group I. Thus, the groups lack unity a priori as indicated in the restriction requirement. This position is also supported by the international searching authority as they indicated the groups lacked unity for the same reasons. The examiner cited Chakraborty if the position was that administration of nucleic acids, specifically sgRNA, are useful in treatment of hemoglobinopathies was the special technical feature then this concept in general was known in the art before Applicants invention. Finally, even if the sequences as claimed are the special technical feature, which the examiner does not agree, Chen et al. (Journal of Cellular Physiology, Epub 2018 Aug 5, cited on PTO Form 1449) teaches knockdown of APA1 (aka ZNF410) by shRNAs
The requirement is still deemed proper and is therefore made FINAL.
Claims 1-16, 28-29 and 35-36 are pending in the application. Claims 9-11 and 16, 28-29 and 35-36 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention (species), there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on June 15 2026. Accordingly, claims 1-8 and 12-15 are being examined on the merits herein.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application is a 371 of PCT/US2021/042152 07/19/2021 which claims benefit of 63/053,308 (07/17/2020) and claims benefit of 63/068,150 (08/20/2020) as reflected in the filing receipt issued August 16 2023.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on January 13 2023 and July 9 2024 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Objections
Claim 13 is objected to because of the following informalities: the claim should recite β-hemoglobinopathy in line 1 for consistency. Appropriate correction is required.
Claim Rejections - 35 USC § 112-Improper Markush
Claims 4-5 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of agent or nucleic acid agent is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: with regards to claim 4: this claim recites a nucleotide sequence, an anti-ZNF410 antibody, a zinc finger inhibitor (which could be a small molecule) or a dominant negative ZNF410 polypeptide. Firstly, these species all have different structures as a nucleotide sequence and an antibody for example are structurally distinct as one contains nucleotides and the other contains amino acids. The recitation zinc finger inhibitor encompasses any zinc finger inhibitor including zinc fingers which are not ZNF410. The compounds do not appear to belong to a recognized class of chemical compounds. Regarding claim 5, while the claim is directed to nucleic acid agent and while nucleic acid agents which comprise a nucleotide sequence complementary to at least a portion of a nucleic acid encoding ZNF410 would be an example of a proper Markush grouping, the examiner cannot agree that all of the nucleic acid agents share a similar structure or the same function. The manner in which a guide RNA or aptamer function to inhibit are different. The nucleic acids of ribozyme and DNAzyme are enzymes which function completely different than a gRNA or siRNA. The nucleotide sequences of these respective species would all be different. Therefore, the recitation nucleic acid is not sufficient to establish the grouping is a proper Markush grouping.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-5 and 12-15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The specification discloses chemicals, such as SEQ ID NO: 1-SEQ ID NO: 183 which meet the written description and enablement provisions of 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph. However, claim(s) 1-5 is(are) directed to encompass any agent or any nucleic acid agent which is capable of decreasing the level or activity of zinc finger 410, which only correspond in some undefined way to specifically instantly disclosed chemicals. None of these agents meet the written description provision of 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, due to lacking chemical structural information for what they are and chemical structures are highly variant and encompass a myriad of possibilities. The specification provides insufficient written description to support the genus encompassed by the claim possessing the claimed function. Note: MPEP 2163.
Vas-Cath Inc. v. Mahurkar, 19 USPQ2d 1111, (Fed. Cir. 1991), makes clear that "applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the 'written description' inquiry, whatever is now claimed." (See page 1117.) The specification does not "clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed." (See Vas-Cath at page 1116.)
Univ. of Rochester v. G.D. Searle, 69 USPQ2d 1886, 1892 (CAFC 2004), further supports this by stating that:
The appearance of mere indistinct words in a specification or a claim, even an original claim, does not necessarily satisfy that requirement. A description of an anti-inflammatory steroid, i.e., a steroid (a generic structural term) described even in terms of its functioning of lessening inflammation of tissues fails to distinguish any steroid from others having the same activity or function. A description of what a material does, rather than of what it is, usually does not suffice…. The disclosure must allow one skilled in the art to visualize or recognize the identity of the subject matter purportedly described. (Emphasis added).
With the exception of the above specifically disclosed chemical structures, the skilled artisan cannot envision the detailed chemical structure of the encompassed agents, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method for isolating it. The chemical structure itself is required. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Circ. 1993) and Amgen Inc. V. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016, (Fed. Cir. 1991). In Fiddes v. Baird, 30 USPQ2d 1481, 1483, (Bd. Pat. App. & Int. 1993), claims directed to mammalian FGF's were found unpatentable due to lack of written description for the broad class. The specification provided only the bovine sequence. Finally, University of California v. Eli Lilly and Co., 43 USPQ2d 1398, 1404, 1405 (Fed. Cir. 1997) held that:
...To fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that "the inventor invented the claimed invention." Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997); In re Gosteli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) (" [T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed."). Thus, an applicant complies with the written description requirement "by describing the invention, with all its claimed limitations, not that which makes it obvious," and by using "such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention." Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966.
Furthermore, to the extent that a functional description can meet the requirement for an adequate written description, it can do so only in accordance with PTO guidelines stating that the requirement can be met by disclosing “sufficiently detailed, relevant identifying characteristics,” including “functional characteristics when coupled with a known or disclosed correlation between function and structure.” Univ. of Rochester v. G.D. Searle, 68 USPQ2d 1424, 1432 (DC WNY 2003).
Looking to the instant specification, the only inhibitors actually shown with any experimental data are the sgRNAs which target ZNF410 (see Fig. 1B, Table 2). The specification shows knockout of the ZNF410 gene reduces CHD4 enough to de-repress Hbf (fetal hemoglobin) (examples). But the instant specification does not describe any other particular inhibitors or their corresponding effect on ZNF410.
Other inhibitors disclosed include a zinc finger inhibitor, which could be small molecules that doesn’t even bind to ZNF410 but other zinc fingers. Since the specification does not describe any effects with any of these molecules, the claims lack written description for which zinc finger inhibitors which would be effective in increasing fetal hemoglobin or treating a hemoglobinopathy as required by the claims. Nor does the specification teach what particular structure is required to achieve the claimed function.
The specification discloses anti-ZNF410 antibodies. While the antibodies could be used to detect the human zinc finger protein, the specification never describes how they can be used to decrease the level or activity of ZNF410. While the specification teaches a variety of commercially available antibodies, the specification does not teach or disclose that these antibodies can inhibit or reduce the level or activity ZNF410 as required by the claims.
Since the specification only describes actual ZNF410 inhibition with the sgRNAs as recited in SEQ ID NO: 1-183, only the above chemically structurally defined chemicals, but not the full breadth of the claim(s) meet the written description provision of 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph. The species specifically disclosed are not representative of the genus because the genus is highly variant. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 USC § 112 is severable from its enablement provision. (See page 1115.)
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-5 and 12-15 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 47-52 of copending Application No. 18707354 (USPGPUB NO. 20250034568). Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
The instant application claims a method of increasing fetal hemoglobin level in a subject, the method comprising: administering to a subject in need thereof an agent that decreases the level or activity of zinc finger 410 (ZNF410).
The instant application claims a method of treating a hemoglobinopathy in a subject, the method comprising: administering to a subject in need thereof an agent that decreases the level or activity of ZNF410.
Copending ‘354 claims a method for treating or reducing at least one symptom of hemoglobinopathy, the method comprising administering a vector or any one of claims 1-19 or an RNA transcript of any one of claims 20-37 to a subject in need thereof. Hemoglobinopathy is sickle cell anemia, SCD or thalassemia. Claimed is a shRNA comprising a ZNF410 targeting sequence (claim 17). As claimed the first ZNF410 sequence comprises the sequence of: GCTGAGCACTTAGTGTTTGTA (SEQ ID NO: 10) and the second ZNF410 sequence comprises the sequence of: TACAAACACTAAGTGCTCAGC (SEQ ID NO: 11), wherein the first and second ZNF410 sequence are complementary (claim 21).
Therefore, copending ‘354 claims administration to the same patient population the same agent (shRNA of ZNF410).
Claims 1-5 and 12-15 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 59-63 of copending Application No. 18845136 (USPGPUB NO. 20250235480). Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
The instant claims are set forth above.
Copending ‘136 claims a method of treating a sickle cell disease, in a subject, said method comprising transducing a stem cell and/or progenitor cell from said subject with a vector and transplanting said transduced cell or cells into a subject wherein said cells express said anti-sickling human beta globin gene. The vector as claimed comprises an expression cassette that encodes an anti-sickling beta-globin gene wherein said vector includes an shRNA that inhibits expression of a ZNF410 gene.
Therefore, copending ‘136 claims administration to the same patient population the same agent (shRNA of ZNF410).
Allowable Subject Matter
Claims 6-8 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ABIGAIL VANHORN whose telephone number is (571)270-3502. The examiner can normally be reached M-Th 6 am-4 pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ABIGAIL VANHORN/ Primary Examiner, Art Unit 1636