DETAILED CORRESPONDENCE
Application Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
2. Applicant’s amendment to the claims filed on 11/14/2025 in response to the Non-Final Rejection mailed on 08/14/2025 is acknowledged. This listing of claims replaces all prior listings of claims in the application.
3. Claims 6 and 17 are cancelled.
4. New claims 26-28 are added.
5.. Claims 1-5, 7-16, 18-20 and 26-28 are pending.
6. Applicant’s remarks filed on 11/14/2025 in response to the Non-Final Rejection mailed on 08/14/2025 have been fully considered and are deemed persuasive to overcome at least one of the rejections and/or objections as previously applied.
The text of those sections of Title 35 U.S. Code not included in the instant action can be found in the prior Office Action.
Nucleotide and/or Amino Acid Sequence Disclosures
7. The objection to the disclosure for nucleotide and/or amino acid sequences appearing in the drawings/specification is hereby withdrawn in view of applicants’ amendment to the specification filed on 11/14/2025 to incorporate sequence identifiers in the Description of the Drawings and the filing of a CRF and text file containing said sequences.
Specification
8. The objection to the disclosure for embedded hyperlinks is withdrawn in view of applicants’ amendment to the specification filed on 11/14/2025 to remove said hyperlinks.
Claim Rejections - 35 USC § 112(b)
9. The rejection of claims 2 and 15 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, for the relative term “about” is withdrawn in view of applicants’ amendment to the claims to remove said term.
10. The rejection of claim 2 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, for lack of antecedent basis is withdrawn in view of applicants’ amendment to the claims to recite “a protein”.
11. The rejection of claims 11-13 and 19-20 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in view of applicants’ amendment to the claims to recite “at least one nucleic acid sequence selected from the group consisting of”.
Claim Rejections - 35 USC § 112(a)
12. The written description rejection of claims 1-20 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, is withdrawn in view of applicants’ amendment to the claims to recite “wherein the base editing comprises subretinal injecting at least one vector encoding an adenine base editor and a guide RNA…” and remarks. Briefly, applicants remarks that one of skill in the art would recognize from the disclosure and art that adenine base editors comprise an adenosine deaminase domain and a catalytically inactive Cas moiety for targeted gene editing is found to be persuasive.
13. The scope of enablement rejection of claims 1-20 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, is withdrawn in view of applicants’ amendment to the claims to recite “wherein the base editing comprises subretinal injecting at least one vector encoding an adenine base editor and a guide RNA…” and remarks. Briefly, applicants remarks that one of skill in the art would recognize from the disclosure and art that adenine base editors comprise an adenosine deaminase domain and a catalytically inactive Cas moiety for targeted gene editing is found to be persuasive.
Claim Rejections - 35 USC § 102
14. The rejection of claims 6, 11-13, 17 and 19-20 under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Bryson et al. (WO 2019/217943 A1, priority to 05/11/2018; cited on IDS filed on 06/06/2023) is withdrawn in view of applicants’ amendment to the claims to cancel claims 6 and 17 and amendment to claims 11-13 and 19-20 to recite “one nucleic acid sequence selected from the group consisting of…” limiting the sequence to the full length sequences recited in the claims.
15. The rejection of claims 1-5, 7-10, 14-15, and 18 under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Bryson et al. (WO 2019/217943 A1, priority to 05/11/2018; cited on IDS filed on 06/06/2023) is maintained for the reasons of record and the reasons set forth below. The rejection has been modified in order to address applicants’ amendment to the claims and to incorporate new claims 27 and 28, which is necessitated by applicants’ amendment to the claims to add new claims 27 and 28.
Claims 1-5, 7-10, 14-15, 18, and 27-28 are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Bryson et al. (WO 2019/217943 A1, priority to 05/11/2018; cited on IDS filed on 06/06/2023).
16. As amended, claims 1-5, 7-10 and 28 are drawn to a method of treating an inherited retinal disease (IRD) associated with a pathogenic point mutation in a mutant allele of an IRD-related gene in the retina or the retinal pigment epithelium (RPE) of a subject in need thereof, the method comprising: base editing the pathogenic point mutation in the retinal cell or retinal pigment epithelium cell to correct the pathogenic mutation, generate a non-pathogenic point mutation, or modulate expression of an IRD-related gene and restore visual function of the subject, wherein the base editing comprises subretinal injecting at least one vector encoding an adenine base editor and a guide RNA that hybridizes to or is complementary to a target nucleic acid sequence of the mutant allele of the IRD-related gene, which includes the point mutation.
As amended, claims 14-15, 18, and 27 are drawn to a method of restoring cone function or prolonging cone survival in a subject with an IRD-related cone or cone-rod dystrophy associated with a pathogenic point mutation in a mutant allele of an IRD-related gene in the retina or the retinal pigment epithelium (RPE), the method comprising: base editing the pathogenic point mutation in the retinal cell or retinal pigment epithelium cell to correct the pathogenic mutation, generate a non-pathogenic point mutation, or modulate expression of an IRD-related gene and restore visual function of subject, wherein the base editing comprises subretinal injecting at least one vector encoding an adenine base editor and a guide RNA that hybridizes to or is complementary to a target nucleic acid sequence of the mutant allele of the IRD-related gene, which includes the point mutation.
17. With respect to claim 1, Bryson et al. teach a method of treating an inherited retinal disease associated with a pathogenic point mutation in a mutant allele of an IRD-related gene in the retina or retinal pigment epithelium of a subject in need thereof comprising base editing the pathogenic point mutation to correct the pathogenic mutation, generate a non-pathogenic point mutation, or modulate expression of an IRD-related gene and restore visual function of subject [see Abstract; paragraphs 0002, 0019, 0022, 0033]. Bryson et al. teach the method wherein the base editing comprises subretinal injecting at least one vector encoding a base editor comprising an adenosine deaminase and gRNA that hybridizes or is complementary to a target nucleic acid sequence which includes the point mutation in the IRD-related gene [see Abstract; paragraphs 0002, 0019, 0037, 0022, 0033, 0081, 0503].
With respect to claim 2, Bryson et al. teach the method wherein the pathogenic mutation is a nonsense or missense mutation and the base editing increases expression of the protein by at least 10% [see paragraphs 0079, 0128].
With respect to claim 3, Bryson et al. teach the method wherein the pathogenic mutation is a nonsense or missense mutation of ABCA4 or RPE65 [see Abstract; paragraphs 0002, 0019, 0022, 0033].
With respect to claims 4-5, Bryson et al. teach the method wherein the IRD includes Leber congenital amaurosis, retinitis pigmentosa, Stargardt disease, and macular degeneration [see paragraphs 0022, 0033, 0540].
With respect to claim 7, Bryson et al. teach the method wherein the base editing results in less than 3% indel formation [see paragraph 0041].
With respect to claim 8, Bryson et al. teach the method wherein the pathogenic mutation is a nonsense or missense mutation of an RPE65 gene [see Abstract; paragraphs 0002, 0019, 0022, 0033].
With respect to claim 9, Bryson et al. teach the method wherein the guide RNA that hybridizes to or is complementary to a target nucleic acid sequence of the mutation RPE65 [see Abstract; paragraphs 0002, 0019, 0022, 0033, 0081, 0503].
With respect to claim 10, Bryson et al. teach the method wherein the pathogenic mutation comprises a C to T missense or nonsense mutation of the RPE65 gene and base editing by deamination of the A complementary to the T by the base editor and the gRNA corrects the C to T mutation [see Abstract; paragraphs 0002, 0019, 0022, 0033, 0081, 0296-297, 0503].
With respect to claim 14, Bryson et al. teach a method of restoring cone function or prolonging cone survival in a subject with an IRD-related cone or cone rod dystrophy associated with a pathogenic point mutation in a mutant allele of an IRD-related gene in the retina or retinal pigment epithelium of a subject in need thereof comprising base editing the pathogenic point mutation to correct the pathogenic mutation, generate a non-pathogenic point mutation, or modulate expression of an IRD-related gene and restore visual function of subject [see Abstract; paragraphs 0002, 0019, 0022, 0033]. Bryson et al. teach the method wherein the base editing comprises subretinal injecting at least one vector encoding a base editor an adenosine deaminase and gRNA that hybridizes or is complementary to a target nucleic acid sequence which includes the point mutation in the IRD-related gene [see Abstract; paragraphs 0002, 0019, 0022, 0033, 0037, 0081, 0503].
With respect to claim 15, Bryson et al. teach the method wherein the pathogenic mutation is a nonsense or missense mutation of RPE65 and the base editing increases expression of the protein by at least 10% [see paragraphs 0002, 0019, 0022, 0033, 0079, 0128].
With respect to claim 16, Bryson et al. teach the method wherein the base editing results in less than 3% indel formation [see paragraph 0041].
With respect to claim 18, Bryson et al. teach the method wherein the pathogenic mutation comprises a C to T missense or nonsense mutation of the RPE65 gene and base editing by deamination of the A complementary to the T by the base editor and the gRNA corrects the C to T mutation [see Abstract; paragraphs 0002, 0019, 0022, 0033, 0081, 0296-297, 0503].
With respect to claims 27 and 28, Bryson et al. teach the method wherein the adenine base editor comprises a fusion protein of a nucleic acid programmable DNA binding protein fused to an adenosine deaminase [see paragraphs 0037 and 0083].
Claim Rejections - 35 USC § 103
18. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
19. Claim(s) 11-13, 19-20 and 26 is/are newly rejected under 35 U.S.C. 103 as being unpatentable over Bryson et al. (WO 2019/217943 A1, priority to 05/11/2018; cited on IDS filed on 06/06/2023) in view of Song et al. (WO 2019/066549, published 04/04/2019 with US Patent Application Publication 2020/0277630 serving as English translation; examiner cited). This new grounds of rejection is necessitated by applicants’ amendment to the claims to limit the target and guide sequences to the full length sequences.
20. The relevant teachings of Bryson et al. as applied to claims 1-5, 7-10, 14-15, 18, and 27-28 are set forth in the 102(a)(1) rejection above.
With respect to claims 11-13, 19-20 and 26, Bryson et al. teach a method of treating an inherited retinal disease associated with a pathogenic point mutation in a mutant allele of an IRD-related gene in the retina or retinal pigment epithelium of a subject in need thereof comprising base editing the pathogenic point mutation to correct the pathogenic mutation, generate a non-pathogenic point mutation, or modulate expression of an IRD-related gene and restore visual function of subject [see Abstract; paragraphs 0002, 0019, 0022, 0033]. Bryson et al. teach the method wherein the base editing comprises subretinal injecting at least one vector encoding a base editor comprising an adenosine deaminase and gRNA that hybridizes or is complementary to a target nucleic acid sequence which includes the point mutation in the IRD-related gene [see Abstract; paragraphs 0002, 0019, 0037, 0022, 0033, 0081, 0503].
However, Bryson et al. does not teach the specific target sequences in claims 11 and 19 and the specific guide sequences of claims 12-13, 20, and 26.
Song et al. teach methods for gene manipulation for targeting a retinal function forming gene and treating or improving a disease caused by retinal dysfunction comprising a guide nucleic acid and Cas9 protein for targeting RPE65 [see Abstract; paragraphs 0004-0030] wherein the target sequence is 100% identical to SEQ ID NO: 1 [see alignment attached as APPENDIX A] and guide sequences that are 100% identical to SEQ ID NO: 15 and SEQ ID NO: 25 [see alignments attached as APPENDIX B]. It is acknowledged that Song et al. alignment of SEQ ID NO: 25 shows a uracil in place of a thymine; however, this is still considered to be 100% identical given that it is known that uracil replaces thymine in RNA.
Before the effective filing date of the claimed invention, it would have been obvious for one of ordinary skill in the art to combine the teachings of Bryson et al. and Song et al. to include the target sequences and guide sequences of Song et al. in the adenine base editors of Bryson et al. because Bryson et al. teach methods of using adenine base editors and guide RNA for the treatment of inherited retinal disease associated with a pathogenic point mutation. Song et al. teach similar methods targeting specific sequences using guide RNA Cas9 in the RPE65 gene for the treatment treating or improving a disease caused by retinal dysfunction. One of ordinary skill in the art would have had a reasonable expectation of success and a reasonable level of predictability to combine the teachings of Bryson et al. and Song et al. because Song et al. acknowledges that these target sites are useful in the treating or improving a disease caused by retinal dysfunction. Therefore the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Response to Remarks Regarding Prior Art Rejections
21. Beginning on p. 30 of applicants’ remarks, applicants contend that Bryson et al. does not anticipate the claimed invention because Bryson et al. does not show an embodiment specifically showing where the base editing comprises subretinal injecting at least one vector encoding an adenine base editor. Applicants contend the examples merely show in vitro base editing of HEK293T cells.
These arguments are found to be not persuasive because MPEP 2123 states “[t]he use of patents as references is not limited to what the patentees describe as their own inventions or to the problems with which they are concerned. They are part of the literature of the art, relevant for all they contain." In re Heck, 699 F.2d 1331, 1332-33, 216 USPQ 1038, 1039 (Fed. Cir. 1983) (quoting In re Lemelson, 397 F.2d 1006, 1009, 158 USPQ 275, 277 (CCPA 1968)).
A reference may be relied upon for all that it would have reasonably suggested to one having ordinary skill in the art, including nonpreferred embodiments. Merck & Co. v. Biocraft Labs., Inc. 874 F.2d 804, 10 USPQ2d 1843 (Fed. Cir. 1989), cert. denied, 493 U.S. 975 (1989). See also Upsher-Smith Labs. v. Pamlab, LLC, 412 F.3d 1319, 1323, 75 USPQ2d 1213, 1215 (Fed. Cir. 2005) (reference disclosing optional inclusion of a particular component teaches compositions that both do and do not contain that component); Celeritas Technologies Ltd. v. Rockwell International Corp., 150 F.3d 1354, 1361, 47 USPQ2d 1516, 1522-23 (Fed. Cir. 1998) (The court held that the prior art anticipated the claims even though it taught away from the claimed invention. "The fact that a modem with a single carrier data signal is shown to be less than optimal does not vitiate the fact that it is disclosed."). In the instant case, one of ordinary skill in the art would readily see from the teachings of Bryson et al. the methods as claimed. As stated above, Bryson et al. teach a method of treating an inherited retinal disease associated with a pathogenic point mutation in a mutant allele of an IRD-related gene in the retina or retinal pigment epithelium of a subject in need thereof comprising base editing the pathogenic point mutation to correct the pathogenic mutation, generate a non-pathogenic point mutation, or modulate expression of an IRD-related gene and restore visual function of subject [see Abstract; paragraphs 0002, 0019, 0022, 0033]. Bryson et al. teach the method wherein the base editing comprises subretinal injecting at least one vector encoding a base editor comprising an adenosine deaminase and gRNA that hybridizes or is complementary to a target nucleic acid sequence which includes the point mutation in the IRD-related gene [see Abstract; paragraphs 0002, 0019, 0037, 0022, 0033, 0081, 0503].
Conclusion
22. Status of the claims:
Claims 1-5, 7-16, 18-20 and 26-28 are pending.
Claims 1-5, 7-16, 18-20 and 26-28 are rejected.
No claims are in condition for an allowance.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to PAUL J HOLLAND whose telephone number is (571)270-3537. The examiner can normally be reached Monday to Friday from 8AM to 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath Rao can be reached at 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/PAUL J HOLLAND/Primary Examiner, Art Unit 1656
APPENDIX A
Song et al. with SEQ ID NO: 1
Query Match 100.0%; Score 30; Length 72;
Best Local Similarity 100.0%;
Matches 30; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTCACTGGCAGTCTCCTCTGATGTGGGCCA 30
||||||||||||||||||||||||||||||
Db 43 CTCACTGGCAGTCTCCTCTGATGTGGGCCA 72
APPENDIX B
Song et al. with SEQ ID NO: 15
Query Match 100.0%; Score 20; Length 72;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATCAGAGGAGACTGCCAGTG 20
||||||||||||||||||||
Db 64 ATCAGAGGAGACTGCCAGTG 45
Song et al. with SEQ ID NO: 25
Query Match 100.0%; Score 20; Length 72;
Best Local Similarity 85.0%;
Matches 17; Conservative 3; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AUCAGAGGAGACUGCCAGUG 20
|:||||||||||:|||||:|
Db 64 ATCAGAGGAGACTGCCAGTG 45