DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant's election with traverse of Invention 1, SEQ ID NO: 26, and Corynebacterium glutamicum ATCC 13032 in the reply filed on 12/08/2025 is acknowledged. The arguments filed have been considered but are not found persuasive.
As previously stated US Patent 7608437 (10/27/2009; reference of record) teaches that a glutamate dehydrogenase (GDH) promoter of Corynebacterium glutamicum ATCC 13032 is mutated to control the expression of a target gene and enhance the production capacity of arginine, wherein the upstream of GDH has a promoter region, the consensus sequences of -35 and -10 regions of the GDH promoter are mutated, sequences 2-6 are mutated sequences of an original sequence 1, the mutated promoter is linked to GDH gene to construct a plasmid, the plasmid is introduced into wildtype corynebacterium, and the activity of GDH can be increased by at least 4.9 times (see entire patent and claims especially claims 1-2). GenBank Accession No. CP025533.1("Corynebacterium glutamicum strain ATCC 13032 chromosome, complete genome," December 20, 2017, 317 pages; IDS filed 01/19/2023) teaches
genome sequence of Corynebacterium glutamicum ATCC 13032, wherein positions 2201859 to 2202657 have 100% sequence identity to SEQ ID NO: 30 of the instant application, and positions 2200515-2201858 next to the above-mentioned region are glutamate dehydrogenase (see record in IDS filed 01/19/2023). Because positions 2201859 to 2202657 have 100% sequence identity to SEQ ID NO: 30 of the instant application, then this region is deemed to be the gene promoter of glutamate dehydrogenase. Therefore, it would have been obvious to one of ordinary skill in the art to modify the glutamate dehydrogenase gene promoter of taught by GenBank Accession No. CP025533.1 to have one or more bases mutated as taught and/or suggested by US Patent 7608437 to obtain the recited gene promoter, and using the modified promoter to enhance or increase expression of a desired protein product. Thus, the same or corresponding technical feature was known in the prior art and therefore cannot make a contribution over the prior art. Since the inventions lack the same or corresponding special technical feature, then Inventions 1-7 are not so linked as to form a single general inventive concept under PCT Rule 13.1.
Claims 9-13, 15-19 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention. The requirement is still deemed proper and is therefore made FINAL.
Claims 1-8, 14, SEQ ID NO: 26, and Corynebacterium glutamicum ATCC 13032 are under consideration in this Office Action.
Nucleotide and/or Amino Acid Sequence Disclosures
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in claim 3, are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the claims, drawings, or in the Brief Description of the Drawings.
Applicant must amend claim 3 to refer to specific SEQ ID NOs.
Claim Rejections - 35 USC § 112(b) or 35 U.S.C. 112 (pre-AIA ) 2nd Paragraph
The following is a quotation of 35 U.S.C. 112(b):
(B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-8, 14 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 1 recites the phrase “at a position corresponding to positions” which renders the claims vague and indefinite since it is unclear if the claim refer to the specific positions 479 to 482 of SEQ ID NO: 30 by recitation of “at a position corresponding to positions”. It is unclear if the promoter is not aattctttgtggtcatatctgtgcgacactgccataattgaacgtg at positions 469 to position 514 of SEQ ID NO: 30 as recited in part (iv) by recitation of “at positions corresponding to position 469 to position 514”. Dependent claims 2-8 and 14 are also rejected because they do not correct the defect. For examination purposes the claims will not be limited to the specific positions 479 to 482 of SEQ ID NO: 30.
Claim 1 recites the phrase “a sequence capable of hybridizing with the nucleotide sequence set forth in (i) or (ii) under high-stringent hybridization conditions or very high-stringent hybridization conditions” which renders the claim vague and indefinite since the specific hybridization conditions are not known and not recited in the claims. For examination purposes the claims will not be limited to any specific hybridization conditions.
Claim 8 recite the phrase “the host cell is genus Enterobacter or genus Corynebacterium” which renders the claim vague and indefinite since the meaning of the phrase is not known and it is uncertain if the claim refers to specific species of Enterobacter or Corynebacterium.
Claim 14 recites the phrase “wherein the genus Corynebacterium is selected from the group consisting of Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and derived strains thereof” which renders the claim vague and indefinite since the meaning of the phrase is not known and it is uncertain if the claim refers to a specific species of Corynebacterium glutamicum.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-8, 14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are drawn to a large and widely varying genus of mutants of a glutamate dehydrogenase gene promoter of Corynebacterium glutamicum, wherein the mutant is any one selected from the group consisting of the following (i) to (iv): (i) a genus of nucleotide sequences of the mutant having one or more bases mutated at a position corresponding to positions 479 to 482 of SEQ ID NO: 30, and having one or more bases mutated at a position corresponding to positions 499 to 501 of SEQ ID NO: 30; (ii) genus of reverse complementary sequences to the nucleotide sequence set forth in (i); (iii) genus of reverse complementary sequences to a sequence capable of hybridizing with the nucleotide sequence set forth in (i) or (ii) under any high-stringent hybridization conditions or any very high-stringent hybridization conditions; and (iv) a genus of nucleotide sequences having at least 90% sequence identity to the nucleotide sequence set forth in (i) or (ii), wherein the nucleotide sequence of the mutant set forth in any one of (i) to (iv) is not aattctttgtggtcatatctgtgcgacactgccataattgaacgtg at positions corresponding to position 469 to position 514 of the sequence set forth in SEQ ID NO: 30; and the mutant set forth in any one of (i) to (iv) has an enhanced promoter activity as compared to a glutamate dehydrogenase gene promoter having the sequence set forth in SEQ ID NO: 30. According to MPEP 2163:
“For each claim drawn to a genus: The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice (see i)(A), above), reduction to drawings (see i)(B), above), or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus (see i)(C), above). See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
A "representative number of species" means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014)…”
According to MPEP 2163.02:
“The courts have described the essential question to be addressed in a description requirement issue in a variety of ways. An objective standard for determining compliance with the written description requirement is, "does the description clearly allow persons of ordinary skill in the art to recognize that he or she invented what is claimed." In re Gosteli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989). Under Vas-Cath, Inc. v. Mahurkar, 935 F.2d 1555, 1563-64, 19 USPQ2d 1111, 1117 (Fed. Cir. 1991), to satisfy the written description requirement, an applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention, and that the invention, in that context, is whatever is now claimed. The test for sufficiency of support in a parent application is whether the disclosure of the application relied upon "reasonably conveys to the artisan that the inventor had possession at that time of the later claimed subject matter." Ralston Purina Co. v. Far-Mar-Co., Inc., 772 F.2d 1570, 1575, 227 USPQ 177, 179 (Fed. Cir. 1985) (quoting In re Kaslow, 707 F.2d 1366, 1375, 217 USPQ 1089, 1096 (Fed. Cir. 1983)).”
The specification as originally filed does not disclose a representative number of species of the genus of mutants of a glutamate dehydrogenase gene promoter of Corynebacterium glutamicum by actual reduction to practice. The specification as originally filed does not provide a correlation between function and structure to enable one of ordinary skill in the art to predict which nucleotide sequences and structures correlate with enhanced promoter activity as compared to a glutamate dehydrogenase gene promoter having the sequence set forth in SEQ ID NO: 30.
Hence, the specification does not provide sufficient written description to inform one of ordinary skill in the art that applicants at the time the application was filed were in possession of the claimed genus of mutants of a glutamate dehydrogenase gene promoter of Corynebacterium glutamicum, wherein the mutant is any one selected from the group consisting of the following (i) to (iv): (i) a genus of nucleotide sequences of the mutant having one or more bases mutated at a position corresponding to positions 479 to 482 of SEQ ID NO: 30, and having one or more bases mutated at a position corresponding to positions 499 to 501 of SEQ ID NO: 30; (ii) genus of reverse complementary sequences to the nucleotide sequence set forth in (i); (iii) genus of reverse complementary sequences to a sequence capable of hybridizing with the nucleotide sequence set forth in (i) or (ii) under any high-stringent hybridization conditions or any very high-stringent hybridization conditions; and (iv) a genus of nucleotide sequences having at least 90% sequence identity to the nucleotide sequence set forth in (i) or (ii), wherein the nucleotide sequence of the mutant set forth in any one of (i) to (iv) is not aattctttgtggtcatatctgtgcgacactgccataattgaacgtg at positions corresponding to position 469 to position 514 of the sequence set forth in SEQ ID NO: 30; and the mutant set forth in any one of (i) to (iv) has an enhanced promoter activity as compared to a glutamate dehydrogenase gene promoter having the sequence set forth in SEQ ID NO: 30.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-8, 14 are rejected under 35 U.S.C. 103 as being unpatentable over GenBank Accession No. CP025533.1("Corynebacterium glutamicum strain ATCC 13032 chromosome, complete genome," December 20, 2017, 317 pages; IDS filed 01/19/2023) in view of US Patent 7608437 (10/27/2009; PTO 892), US20060003424 (01/05/2006; PTO 892)
GenBank Accession No. CP025533.1("Corynebacterium glutamicum strain ATCC 13032 chromosome, complete genome," December 20, 2017, 317 pages; IDS filed 01/19/2023) teaches
genome sequence of Corynebacterium glutamicum ATCC 13032, wherein positions 2201859 to 2202657 have 100% sequence identity to SEQ ID NO: 30 of the instant application, and positions 2200515-2201858 next to the above-mentioned region are glutamate dehydrogenase (see record in IDS filed 01/19/2023). Because positions 2201859 to 2202657 have 100% sequence identity to SEQ ID NO: 30 of the instant application, then this region is deemed to be the gene promoter of glutamate dehydrogenase.
The teachings of the reference differ from the claims in that the reference does not teach the claimed mutant of a glutamate dehydrogenase gene promoter of Corynebacterium glutamicum.
US Patent 7608437 (10/27/2009; PTO 892) teaches that a glutamate dehydrogenase (GDH) promoter of Corynebacterium glutamicum ATCC 13032 is mutated to control the expression of a target gene and enhance the production capacity of arginine, wherein the upstream of GDH has a promoter region, the consensus sequences of -35 and -10 regions of the GDH promoter are mutated, sequences 2-6 are mutated sequences of an original sequence 1, the mutated promoter is linked to GDH gene to construct a plasmid, the plasmid is introduced into wildtype corynebacterium, and the activity of GDH can be increased by at least 4.9 times (see entire patent and claims especially claims 1-2).
US20060003424 teaches method of producing coryneform bacteria having an improved amino acid- or nucleic acid-productivity comprises the steps of introducing a mutation in a promoter sequence of amino acid- or nucleic acid-biosynthesizing genes on a chromosome of a coryneform bacterium to make it close to a consensus sequence or introducing a change in a promoter sequence of amino acid- or nucleic acid-biosynthesizing genes on a chromosome of a coryneform bacterium by gene recombination to make it close to a consensus sequence, to obtain mutants of the coryneform amino acid d- or nucleic acid-producing microorganism, culturing the mutants and select a mutant capable of producing the intended amino acid or nucleic acid in a large amount (see entire publication and claims especially paragraphs [0009]- [0021]. US20060003424 teaches the following coryneform glutamic acid producing microorganism in paragraph [0026]:
Corynebacterium acetoacidophilum ATCC13870
Corynebacterium acetoglutamicum ATCC15806
Corynebacterium callunae ATCC15991
Corynebacterium glutamicum ATCC13032
Brevibacterium divaricatum ATCC14020
Brevibacterium lactofermentum ATCC13869
Corynebacterium lilium ATCC15990
Brevibacterium flavum ATCC14067
Corynebacterium melassecola ATCC17965
Brevibacterium saccharolyticum ATCC14066
Brevibacterium immariophilum ATCC14068
Brevibacterium roseum ATCC13825
Brevibacterium thiogenitalis ATCC19240
Microbacterium ammoniaphilum ATCC15354
Corynebacterium thermoaminogenes AJ12310(FERM 9246)
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the glutamate dehydrogenase gene promoter of taught by GenBank Accession No. CP025533.1 to have one or more bases mutated as taught and/or suggested by US Patent 7608437 to obtain the recited mutant glutamate dehydrogenase gene promoter having the recited nucleotide sequence including SEQ ID NO: 26,
constructing an expression vector to comprise the mutant glutamate dehydrogenase gene promoter as taught by US Patent 7608437, and transforming corynebacterium of US Patent 7608437 or Corynebacterium glutamicum ATCC 13032 of US20060003424 to comprise the mutant glutamate dehydrogenase gene promoter. One of ordinary skill in the art before the effective filing date of the claimed invention would have been motivated to do this in order to use the modified mutant glutamate dehydrogenase gene promoter to enhance or increase expression of a desired protein product as taught by US Patent 7608437 where the modified mutant glutamate dehydrogenase gene promoter has enhanced promoter activity of 2-47 fold or more compared to wild type glutamate dehydrogenase gene having the nucleotide sequence of SEQ ID NO: 30. One of ordinary skill in the art at the time the invention was made would have a reasonable expectation of success because genetically modifying gene promoter to enhance or increase expression of a desired protein product is known in the art as shown by reference teachings. Hence, the claimed invention as a whole is prima facie obvious.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Christian L Fronda whose telephone number is (571)272 0929. The examiner can normally be reached Monday-Thursday and alternate Fridays between 9:00AM-5:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached on (408)918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CHRISTIAN L FRONDA/Primary Examiner, Art Unit 1652