Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Request for Continued Examination
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 03/09/2026 has been entered.
Status of Application/Amendment/Claims
Applicant's response filed 03/09/2026 has been considered. Rejections and/or objections not reiterated from the previous office action mailed 12/09/2025 are hereby withdrawn. The following rejections and/or objections are either newly applied or are reiterated and are the only rejections and/or objections presently applied to the instant application. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
With entry of the amendment filed on 03/09/2026, claims 1, 2 and 9 are pending in the application. Claims 3-8 and 10-20 are canceled.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1, 2 and 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over McSwiggen et al. (US Application 2003030190635) and Fakhr et al. ("Precise and efficient siRNA design: a key point in competent gene silencing." Cancer gene therapy 23.4 (2016): 73-82).
Regarding claim 1, McSwiggen et al. teach an siRNA wherein each strand has 18 nucleotides in length wherein one strand is shown below and has 18 nucleotides identical to the claimed SEQ ID No. 16 (see alignment below). McSwiggen et al. teach the siRNA can vary in length generally 18-30 base pairs (para. 31). The instant claims define the oligonucleotide is a gene expression modulator which can be a siRNA (0025). McSwiggen et al. teach the sequences target the BACE gene (see Table 1) and teach the gene is involved in Alzheimer’s disease and describes methods of inhibiting expression in an effort to find a therapeutic (0014). McSwiggen et al. teach a target site was identified in the BACE RNA target region and the siRNA was designed to bind to the region and teach varying the length the of siRNA molecules to optimize activity (see 0246). McSwiggen et al. does not teach the full length of the claimed SEQ ID No. 16 having 21 nucleotides.
The prior art of Fakhr et al. is a reference outlining the precise and efficient siRNA designs for gene silencing and found there is a range of sizes of siRNA that has been used. Fakhr et al. states there has been some controversy over the best length for siRNAs as some have worked with siRNA 19 nucleotides in length with efficient silencing and others in the field have found good results using siRNAs 21 to 29 nucleotides in length (see page 75 first para.) Fakhr et al. states shorter siRNAs may lead to an unspecified binding of the target but others have found siRNA 19 to 25 nucleotides have shown the same efficiency in silencing.
Because of the differences found with the siRNA lengths, one of skill in the art would have wanted to try and improve on the design of the siRNA of McSwiggen et al. and increase the lengths to try and find the optimal length that is most efficient against the target sequence. The sequence of McSwiggen et al. is targeted to a known gene sequence and increasing the length would amount to adding the next complementary nucleotide to the siRNA to test that length for improved activity. Given Fakhr et al. teach it was known that siRNA has been designed with 19-29 base pairs in length, it would have been obvious to try and increase the length of the siRNA of McSwiggen et al. because there was a finite number of identified sizes of siRNA and a predictable outcome of finding a size with efficient silencing of the BACE gene. One of skill would have good reason to pursue these known options within their technical grasp.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Regarding claims 2 and 9, McSwiggen et al. teach the siRNA can be in a pharmaceutic composition comprising buffers and stabilizers for delivery to a cell or subject. The limitation of a cerebrospinal fluid compatible diluent is defined in the specification at [0053] as a sterile isotonic solution.
SEQ 16
Publication No. US20030190635A1
SEQ ID NO 69
LENGTH: 19
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Description of Artificial Sequence: Target sequence/siNA sense region
Query Match 78.1%; Score 16.4; Length 19;
Best Local Similarity 94.4%;
Matches 17; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
SEQ 16 4 GUGGUAUUAUGAGGUGAU 21
SEQ 69 1 GUGGUAUUAUGAGGUCAU 18
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 1, 2 and 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al. (US Patent 8,090,542) and Fakhr et al. ("Precise and efficient siRNA design: a key point in competent gene silencing." Cancer gene therapy 23.4 (2016): 73-82).
Regarding claim 1, Khvorova et al. teach siRNA wherein each strand has 19 nucleotides in length wherein one strand is shown below and has 19 nucleotides identical to the claimed SEQ ID Nos.18 and 20 having 21 nucleotides (see alignment below). Khvorova et al. teach the siRNA can vary in length generally 19-30 base pairs (claims). The instant claims define the oligonucleotide is a gene expression modulator which can be a siRNA (0025). Khvorova et al. teach the siRNA is targeted to a BACE1 gene (col. 158) and teach methods of identifying hyperfunctional siRNA to find one with optimal activity (col. 161). Khvorova et al. do not teach the expression modulators have the entire claimed sequences.
The prior art of Fakhr et al. is a reference outlining the precise and efficient siRNA designs for gene silencing and found there is a range of sizes of siRNA that has been used. Fakhr et al. states there has been some controversy over the best length for siRNAs as some have worked with siRNA 19 nucleotides in length with efficient silencing and others in the field have found good results using siRNAs 21 to 29 nucleotides in length (see page 75 first para.) Fakhr et al. states shorter siRNAs may lead to an unspecified binding of the target but others have found siRNA 19 to 25 nucleotides have shown the same efficiency in silencing.
Because of the differences found with the siRNA lengths, one of skill in the art would have wanted to try and improve on the design of the siRNA of Khvorova et al. and increase the lengths to try and find the optimal length that is most efficient against the target sequence. The sequence of Khvorova et al. is targeted to a known gene sequence and increasing the length would amount to adding the next complementary nucleotide to the siRNA to test that length for improved activity. Given Fakhr et al. teach it was known in the siRNA has been designed with 19-29 base pairs in length, it would have been obvious to try and increase the length of the siRNA of Khvorova et al. because there was a finite number of identified sizes of siRNA and a predictable outcome of finding a size with efficient silencing. One of skill would have good reason to pursue these known options within their technical grasp.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Regarding claims 2 and 9, Khvorova et al. teach the siRNA can be in a composition of a universal buffer for delivery to cells for transfection. The limitation of a cerebrospinal fluid compatible diluent is defined in the specification at [0053] as a sterile isotonic solution and thus the universal buffer would meet the claim limitations.
SEQ 18
Patent No. 8090542
GENERAL INFORMATION
APPLICANT: Khvorova, Anastasia
SEQ ID NO 2346
LENGTH: 19
TYPE: DNA
ORGANISM: Homo sapiens
Query Match 90.5%; Score 19; Length 19;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAGAAAGGAGAUCAUUUA 19
Db 1 GCAGAAAGGAGAUCAUUUA 19
SEQ 20
Patent No. 8090542
APPLICANT: Khvorova, Anastasia
SEQ ID NO 848769
LENGTH: 19
TYPE: DNA
ORGANISM: Homo sapiens
Query Match 76.0%; Score 19; Length 19;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 3 CAACAUUGCUGCCAUCACU 21
Db 1 CAACAUUGCUGCCAUCACU 19
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 1, 2 and 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over McSwiggen et al. (US Patent 7662951) and Fakhr et al. ("Precise and efficient siRNA design: a key point in competent gene silencing." Cancer gene therapy 23.4 (2016): 73-82).
Regarding claim 1, McSwiggen et al. teach an siRNA wherein each strand has 19 nucleotides in length wherein one strand is shown below and has 19 nucleotides identical to the claimed SEQ ID Nos. 19, 25 and 28 (see alignment below). McSwiggen et al. teach the siRNA can vary in length generally 18-30 base pairs (para. 31). The instant claims define the oligonucleotide is a gene expression modulator which can be a siRNA (0025). McSwiggen et al. teach a target site was identified in the BACE RNA target region and the siRNA was designed to bind to the region and teach varying the length the of siRNA molecules to optimize activity (Ex 4). McSwiggen et al. do not teach the expression modulators have the entire claimed sequences.
The prior art of Fakhr et al. is a reference outlining the precise and efficient siRNA designs for gene silencing and found there is a range of sizes of siRNA that has been used. Fakhr et al. states there has been some controversy over the best length for siRNAs as some have worked with siRNA 19 nucleotides in length with efficient silencing and others in the field have found good results using siRNAs 21 to 29 nucleotides in length (see page 75 first para.) Fakhr et al. states shorter siRNAs may lead to an unspecified binding of the target but others have found siRNA 19 to 25 nucleotides have shown the same efficiency in silencing.
Because of the differences found with the siRNA lengths, one of skill in the art would have wanted to try and improve on the design of the siRNA of McSwiggen et al. and increase the lengths to try and find the optimal length that is most efficient against the target sequence. Given Fakhr et al. teach it was known in the siRNA has been designed with 19-29 base pairs in length, it would have been obvious to try and increase the length of the siRNA of McSwiggen et al. because there was a finite number of identified sizes of siRNA and a predictable outcome of finding a size with efficient silencing. One of skill would have good reason to pursue these known options within their technical grasp.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Regarding claims 2 and 9, McSwiggen et al. teach the siRNA can be in a pharmaceutic composition comprising buffers and stabilizers for delivery to a cell or subject. The limitation of a cerebrospinal fluid compatible diluent is defined in the specification at [0053] as a sterile isotonic solution.
SEQ 19
Patent No. 7662951
GENERAL INFORMATION
APPLICANT: McSwiggen, James
NUMBER OF SEQ ID NOS: 709
SEQ ID NO 300
LENGTH: 19
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 90.5%; Score 19; Length 19;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 3 AUCCCAAGAUCAUUCUACA 21
Db 1 AUCCCAAGAUCAUUCUACA 19
SEQ 25
Patent No. 7662951
GENERAL INFORMATION
APPLICANT: McSwiggen, James
NUMBER OF SEQ ID NOS: 709
SEQ ID NO 91
LENGTH: 19
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 68.0%; Score 17; Length 19;
Best Local Similarity 100.0%;
Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CGGGCACUGUUAUGGGA 17
Db 3 CGGGCACUGUUAUGGGA 19
SEQ 28
Patent No. 7662951
APPLICANT: McSwiggen, James
SEQ ID NO 101
LENGTH: 19
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 76.0%; Score 19; Length 19;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 6 GACAGAUGAGUCAACCCUC 24
Db 1 GACAGAUGAGUCAACCCUC 19
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 1, 2 and 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al. (US Patent 7,807,820) and Fakhr et al. ("Precise and efficient siRNA design: a key point in competent gene silencing." Cancer gene therapy 23.4 (2016): 73-82).
Regarding claim 1, Khvorova et al. teach an siRNA wherein each strand has 19 nucleotides in length wherein one strand is shown below and has 19 nucleotides identical to the claimed SEQ ID No. 23 having 25 nucleotides (see alignment below). Khvorova et al. teach the siRNA can vary in length generally 19-30 base pairs (claims). The instant claims define the oligonucleotide is a gene expression modulator which can be a siRNA (0025). Khvorova et al. do not teach the expression modulator has the entire sequence.
The prior art of Fakhr et al. is a reference outlining the precise and efficient siRNA designs for gene silencing and found there is a range of sizes of siRNA that has been used. Fakhr et al. states there has been some controversy over the best length for siRNAs as some have worked with siRNA 19 nucleotides in length with efficient silencing and others in the field have found good results using siRNAs 21 to 29 nucleotides in length (see page 75 first para.). Fakhr et al. states shorter siRNAs may lead to an unspecified binding of the target but others have found siRNA 19 to 25 nucleotides have shown the same efficiency in silencing.
Because of the differences found with the siRNA lengths, one of skill in the art would have wanted to try and improve on the design of the siRNA of Khvorova et al. and increase the lengths to try and find the optimal length that is most efficient against the target sequence. Given Fakhr et al. teach it was known in the siRNA has been designed with 19-29 base pairs in length, it would have been obvious to try and increase the length of the siRNA of Khvorova et al. because there was a finite number of identified sizes of siRNA and a predictable outcome of finding a size with efficient silencing. One of skill would have good reason to pursue these known options within their technical grasp.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Regarding claims 2 and 9, Khvorova et al. teach the siRNA can be in a composition of a universal buffer for delivery to cells for transfection. The limitation of a cerebrospinal fluid compatible diluent is defined in the specification at [0053] as a sterile isotonic solution and thus the universal buffer would meet the claim limitations.
SEQ 23
Patent No. 7807820
APPLICANT: KHVOROVA, Anastasia
SEQ ID NO 596
LENGTH: 19
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Synthetic
Query Match 76.0%; Score 19; Length 19;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 7 UUACAAGUUUGCCAUCUCA 25
Db 1 UUACAAGUUUGCCAUCUCA 19
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 1, 2 and 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over Kaemmerer et al. (US Application 20040220132) and Fakhr et al. ("Precise and efficient siRNA design: a key point in competent gene silencing." Cancer gene therapy 23.4 (2016): 73-82).
Regarding claim 1, Kaemmerer et al.. teach an siRNA wherein each strand has 21 nucleotides in length wherein one strand is shown below and has 21 nucleotides identical to the claimed SEQ ID No. 53 having 27 nucleotides (see alignment below). Kaemmerer et al. teach the siRNA can vary in length generally 15-30 base pairs (0065). The instant claims define the oligonucleotide is a gene expression modulator which can be a siRNA (0025). Kaemmerer et al. do not teach the expression modulator has the entire sequence.
The prior art of Fakhr et al. is a reference outlining the precise and efficient siRNA designs for gene silencing and found there is a range of sizes of siRNA that has been used. Fakhr et al. states there has been some controversy over the best length for siRNAs as some have worked with siRNA 19 nucleotides in length with efficient silencing and others in the field have found good results using siRNAs 21 to 29 nucleotides in length (see page 75 first para.) Fakhr et al. states shorter siRNAs may lead to an unspecified binding of the target but others have found siRNA 19 to 25 nucleotides have shown the same efficiency in silencing.
Because of the differences found with the siRNA lengths, one of skill in the art would have wanted to try and improve on the design of the siRNA of Kaemmerer et al. and increase the lengths to try and find the optimal length that is most efficient against the target sequence. Given Fakhr et al. teach it was known in the siRNA has been designed with 19-29 base pairs in length, it would have been obvious to try and increase the length of the siRNA of Kaemmerer et al. because there was a finite number of identified sizes of siRNA and a predictable outcome of finding a size with efficient silencing. One of skill would have good reason to pursue these known options within their technical grasp.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Regarding claims 2 and 9, Kaemmerer et al. teach the siRNA can be in a composition of a sterile grade water or pH buffer for delivery to cells for transfection (0102-0103). The limitation of a cerebrospinal fluid compatible diluent is defined in the specification at [0053] as a sterile isotonic solution and thus the universal buffer would meet the claim limitations.
SEQ 27
Publication No. US20040220132A1
APPLICANT: Kaemmerer, William F.
NUMBER OF SEQ ID NOS: 53
SEQ ID NO 25
LENGTH: 21
TYPE: DNA
ORGANISM: Mus Musculus
FEATURE:
NAME/KEY: misc_feature
LOCATION: (1663)..()
OTHER INFORMATION: Starting position within mouse BACE1 cDNA
Query Match 84.0%; Score 21; Length 21;
Best Local Similarity 66.7%;
Matches 14; Conservative 7; Mismatches 0; Indels 0; Gaps 0;
Qy 3 AAUUGGCUUUGCUGUCAGCGC 23
Db 1 AATTGGCTTTGCTGTCAGCGC 21
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 1, 2 and 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over Naito et al. (US Application 20080113351) and Fakhr et al. ("Precise and efficient siRNA design: a key point in competent gene silencing." Cancer gene therapy 23.4 (2016): 73-82).
Regarding claim 1, Naito et al. teach siRNA wherein each strand has 19 nucleotides in length wherein one strand is shown below and has 17 nucleotides identical to the claimed SEQ ID No. 17 having 19 nucleotides and has 19 nucleotides identical to SEQ ID No. 24 having 27 nucleotides (see alignment below). Naito et al. teach the siRNA can vary in length, preferably 30 base pairs or less (0080). The instant claims define the oligonucleotide is a gene expression modulator which can be a siRNA (0025). Naito et al. do not teach the expression modulator has the entire sequence.
The prior art of Fakhr et al. is a reference outlining the precise and efficient siRNA designs for gene silencing and found there is a range of sizes of siRNA that has been used. Fakhr et al. states there has been some controversy over the best length for siRNAs as some have worked with siRNA 19 nucleotides in length with efficient silencing and others in the field have found good results using siRNAs 21 to 29 nucleotides in length (see page 75 first para.). Fakhr et al. states shorter siRNAs may lead to an unspecified binding of the target but others have found siRNA 19 to 25 nucleotides have shown the same efficiency in silencing.
Because of the differences found with the siRNA lengths, one of skill in the art would have wanted to try and improve on the design of the siRNA of Naito et al. and increase the lengths to try and find the optimal length that is most efficient against the target sequence. Given Fakhr et al. teach it was known in the siRNA has been designed with 19-29 base pairs in length, it would have been obvious to try and increase the length of the siRNA of Khvorova et al. because there was a finite number of identified sizes of siRNA and a predictable outcome of finding a size with efficient silencing. One of skill would have good reason to pursue these known options within their technical grasp.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Regarding claims 2 and 9, Naito et al. teach the siRNA can be in a composition of suitable for delivery to cells for transfection (0269-0276). The limitation of a cerebrospinal fluid compatible diluent is defined in the specification at [0053] as a sterile isotonic solution and thus the universal buffer would meet the claim limitations.
SEQ 17
Publication No. US20080113351A1
APPLICANT: NAITO, Yuki
SEQ ID NO 407289
LENGTH: 19
TYPE: DNA
ORGANISM: Homo sapiens
Query Match 81.1%; Score 15.4; Length 19;
Best Local Similarity 88.2%;
Matches 15; Conservative 1; Mismatches 1; Indels 0; Gaps 0;
Qy 3 CCCAAGACGACUUACAA 19
Db 1 CCCAAGACGACGTACAA 17
SEQ 24
Publication No. US20080113351A1
APPLICANT: NAITO, Yuki
SEQ ID NO 579259
LENGTH: 19
TYPE: DNA
ORGANISM: Mus musculus
Query Match 76.0%; Score 19; Length 19;
Best Local Similarity 73.7%;
Matches 14; Conservative 5; Mismatches 0; Indels 0; Gaps 0;
Qy 7 CAUCCACGGGCACUGUUAU 25
Db 1 CATCCACGGGCACTGTTAT 19
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 1, 2 and 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over Cox et al. (US Application 20210002648) and Fakhr et al. ("Precise and efficient siRNA design: a key point in competent gene silencing." Cancer gene therapy 23.4 (2016): 73-82) and .
The claimed sequences are taught as capable targeting the FAAH gene (see 0008). Cox et al. teach [f]atty-acid amide hydrolase (FAAH) is the major catabolic enzyme for a range of bioactive lipids, including the N-acyl ethanolamines (such as anandamide (AEA), palmitoylethanolamide (PEA) and oleoylethanolamine (OEA)) and N-acyltaurines..sup.1, 2 Anandamide, an endogenous ligand for cannabinoid receptors (i.e. an endocannabinoid), has been shown to have roles in nociception, fear extinction memory, anxiety and depression (0002).
Cox further teach [a]lthough FAAH is therefore an attractive drug target for treating pain, as well as anxiety and depression, recent clinical trials with FAAH inhibitors have however proven unsuccessful… [and]… describes routes to inhibiting FAAH function using gene therapy which are expected to have none of the side effect problems of small molecule FAAH antagonists (0004).
Regarding claims 2 and 9, Cox et al. further teach isotonic solutions for delivery to a subject (0102). The limitation of a cerebrospinal fluid compatible diluent is defined in the specification at [0053] as a sterile isotonic solution and thus the universal buffer would meet the claim limitations. Cox et al. do not teach the instantly claimed SEQ ID Nos.
The prior art of Fakhr et al. is a reference outlining the precise and efficient siRNA designs for gene silencing and found there is a range of sizes of siRNA that have been used. Fakhr et al. states there has been some controversy over the best length for siRNAs as some have worked with siRNA 19 nucleotides in length with efficient silencing and others in the field have found good results using siRNAs 21 to 29 nucleotides in length (see page 75 first para.). Fakhr et al. states shorter siRNAs may lead to an unspecified binding of the target but others have found siRNA 19 to 25 nucleotides have shown the same efficiency in silencing. Fakhr et al. teach there are online software available that can help design siRNA to a known sequence and methods of analysis to find the optimal sequence (see Table 2).
Given the sequence of the FAAH gene is known (SEQ ID No. 1 of Cox et al.) and methods are known to generate siRNA sequences to known targets and target regions, it would have been obvious to make the claimed sequences comprising any of SEQ ID Nos. 14, 16-20, 23-25, 27 and 28. One of skill in the art would have been motivated to try making the siRNA to target FAAH because Cox et al. identified a problem of drug trials using small molecule inhibitors that proved unsuccessful and would have been motivated to try given there is a finite number of predictable identified sizes of siRNA and a predictable outcome of finding a size with efficient silencing that could be designed using known methods.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Response to Applicant’s Arguments
Applicant's arguments have been considered but do not overcome the rejections of record. Applicant argues that because none of the references teach the exact sequence and because Fakir indicates that siRNA 21 to 29 nucleotides have shown good results in gene silencing, one of ordinary skill in the art would be faced with creating 5,592,404 different nucleotide sequence combinations to ensure the claimed sequences were produced.
In the 103 rejection citing McSwiggen et al. (US 2003030190635), page 3 of the Final and referred to by Applicant, McSwiggen et al. teach SEQ ID No. 69 which has 18 nucleotides of the 21 nucleotides of instantly claimed SEQ ID No. 16. McSwiggen et al. teach the sequences target the BACE gene (see Table 1) and teach the gene is involved in Alzheimer’s disease and describes methods of inhibiting BACE gene expression in an effort to find a therapeutic (0014). McSwiggen et al. teach a target site was identified in the BACE RNA target region and the siRNA was designed to bind to the region and teach varying the length the of siRNA molecules to optimize activity (see 0246).
In following the guidance of Fakir et al. regarding siRNA sequences being optimal starting at 21 nucleotides in length, one of skill in the art would try increasing SEQ ID No. 69 to a minimum of 21 nucleotides, which is only adding 3 nucleotides to a known target gene to arrive at the claimed sequence. One of skill in the art would have made a siRNA of 21, 22 and 23 nucleotides in length to the known target gene of BACE to test for target specificity and function, particularly given McSwiggen et al. actually suggests varying the length of the siRNA to find an optimal siRNA.
It is unclear how Applicant arrives at the over 5 million combinations of nucleotides based on the teachings of Fakir et al. Therefore the addition of at least a three nucleotide combination would be considered a finite number and would have been obvious to try based on recommendations of Fakir regarding design of efficient siRNA and the teachings of tools to make and evaluate the different siRNAs.
Applicant did not present arguments for all the 103 rejections but cited McSwiggen et al. as an example. Therefore this argument would hold true for the remaining 103 rejections which are drawn to specific targets of known sequence. Moreover the claims are not drawn to any specific amount of inhibition of the claimed target or any functional requirements and thus one of skill in the art would have wanted to try different sized siRNA to find an optimal sequence for inhibition of gene expression.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a).
706.07(a) Final Rejection, When Proper on Second Action [R-07.2015]
PNG
media_image1.png
18
19
media_image1.png
Greyscale
Second or any subsequent actions on the merits shall be final, except where the examiner introduces a new ground of rejection that is neither necessitated by applicant’s amendment of the claims, nor based on information submitted in an information disclosure statement filed during the period set forth in 37 CFR 1.97(c) with the fee set forth in 37 CFR 1.17(p). Where information is submitted in an information disclosure statement during the period set forth in 37 CFR 1.97(c) with a fee, the examiner may use the information submitted, e.g., a printed publication or evidence of public use, and make the next Office action final whether or not the claims have been amended, provided that no other new ground of rejection which was not necessitated by amendment to the claims is introduced by the examiner. See MPEP § 609.04(b).
Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KIMBERLY CHONG at 571-272-3111. The examiner can normally be reached Monday thru Friday 9-5 pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/Primary Examiner, Art Unit 1636