DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’ s claim to priority from Provisional Application No. 63/057,258 filed 07/27/2020 and PCT/US2021/043217 filed 07/26/2021 is hereby acknowledged.
Election/Restrictions
Applicant’s election without traverse of Invention and Species in the reply
filed on 10/24/2025 is acknowledged as follow:
Invention Group I, (previous claims 1-4, 8-12, 39, 42, 47-48 and 50; current
claims 2, 65-82) drawn to an isolated recombinant nucleic acid comprising a transgene encoding a NPC1 protein, or a vector, or a viral genome or recombinant AAV particle, or a pharmaceutical composition or a cell comprising the recombinant nucleic acid comprising the transgene encoding a NPC1 protein.:
Species Group A: current claims 2, and 65-70, 76-82, a NPC 1 protein encoding sequence as set forth in:
SEQ ID NO: 1750.
Species Group B: current claims 2, and 65-70, 76-82, a AAV viral genome comprising:
A promoter region and/or variant comprising elements [A]-[B]-[C]-[D]-[E]: Applicant elected [A] is absent, [B] is SEQ ID NO: 1795, [C] is SEQ ID NO: 1797, [D] is SEQ ID NO: 1822, and for [E] is absent.
An ITR construct comprised within SEQ ID NO: 1799.
Applicant’s election of Species A(c) and B(1) and (2) in the reply filed on 10/24/2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 71-75 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/24/2025.
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
Application Status
This Application is a National Entry phase Application under U.S.C.§ 371 of PCT/US2021/043217 filed 07/26/2021.
Amendments to claims filed 10/24/2025 are hereby acknowledged. Claim 2 is currently amended. Claims 1 and 3-64 are cancelled. Claims 65-82 are newly added. Claims 2 and 65-82 are pending. Claims 71-75 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Species. Therefore, claims 2, 65-70 and 76-82 are under consideration in this office action.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 04/27/2023 is hereby acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
However, the listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
Drawing sheets filed on 01/26/2023 are acceptable.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see [0469]). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The use of the term “Pluronic F68” (see [0395],[0431]-[0440]), which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. §103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. §103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or non-obviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 2, 65-66, 70, and 77-82 are rejected under 35 U.S.C. §103 as being unpatentable over Venditti (Venditti, C.P. et al. WO 2018/237066 A1, published December 27, 2018; cited on IDS filed 04/27/2023), in view of Chung (Chung, B. K-S. et al. “Computational codon optimization of synthetic gene for protein expression”. BMC Systems Biology, Vol. 6 (2012), p: 134), Mauro (Mauro, V.P. “Codon optimization in the production of recombinant biotherapeutics: potential risks and considerations”. BioDrugs, Vol. 32 (2018), pp: 69-81) and Farré (Farré, D. et al. “Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN”. Nucleic Acids Research, Vol. 31, No. 13 (2003), pp: 3651-6353; cited on IDS filed 04/27/2023 as NPL#3).
Regarding claims 2, Venditti teaches compositions comprising codon-optimized Human NPC1 genes for the treatment of Niemann-Pick type C deficiency and related conditions (see title and abstract). Venditti claims any codon-optimized NPC1 gene, i.e., “A nucleic acid construct for the expression of a therapeutic amount of NPC1 in a cell, the construct comprising: a human codon-optimized NPC1 gene”. (see claim 1, page 76). Therefore, claim 1 of Venditti encompasses all species in the genus of codon-optimized NPC1 gene contained in a vector. Venditti also teaches the use of “NPC1 protein, derivative, or functional variant thereof” (see [0126]).
Venditti teaches using a recombinant AAV viral vector (see [0105], [0169], [0207], Figure 9 and claims 13-16). Therefore, Venditti teaches any AAV viral genome comprising a codon-optimized NPC1 gene, since the claim 1 of Venditti is broader and encompasses any codon-optimized NPC1 gene contained in an AAV recombinant genome.
Venditti teaches examples of sequences that are 71% identical to SEQ ID NO: 1750 (see examples : SEQ ID NOs: 1-8, claim 8).
Regarding claim 2, Venditti does not specifically teaches SEQ ID NO: 1750. However, Venditti also states that : “Codon optimization" refers to the process of altering a naturally occurring polynucleotide sequence to enhance expression in the target organism, e.g., humans. As described herein, the human NPC1 gene can be altered to replace codons that occur less frequently in human genes with those that occur more frequently and/or with codons that are frequently found in highly expressed human genes. This method involves determining the relative frequency of a codon in the protein-encoding genes in the human genome. For example, isoleucine can be encoded by AUU, AUC, or AUA, but in the human genome, AUC (47%), AUU (36%), and AUA (17%) are variably used to encode isoleucine in proteins. Therefore, in the proper sequence context, AUA would be changed to AUC to allow this codon to be more efficiently translated in human cells. However, any known technique for codon optimization for expression may be utilized”. (see [0127]).
Chung teaches examples of codon optimization of synthetic gene for protein expression and reviews multiple algorithms that are publicly available, and teaches a new approach (see page 2, left column, lines 3-9, page 2, left column, last paragraph of “Background” section). Chung teaches that individual codon usage (ICU), codon pair usage but also codon context (CC) are critical for level of protein expression (see Abstract). Chung teaches that for an average sized protein consisting of 300 amino acids, the total number of codon paths can be as many as 10100 …” (see page 3, left column, lines 27-30). Chung teaches a method using “codon context optimization (CCO)” (see page 2, right column, line 3) that can be adapted to synthetic gene design based on preferred codon usage pattern in specific organism (see Table 1, and page 10, left column).
Mauro teaches that codon optimization is commonly used to increase the expression of biotherapeutic recombinant proteins through the use of synonymous codon mutations in mRNA coding regions (see page 69, “Key Points” section).
Mauro also teaches that a codon-optimized mRNA can be altered by up to 80% from its native form (see page 76, right column, last paragraph). However, Mauro also teaches that the effect of specific mutations can be adverse on the structure of the expressed protein and tissue-specific alterations of expression (see page 77, left column, first paragraph). Therefore, this teaching suggests routine optimization for selection of functional variants has to be performed on potential candidates.
Farré teaches a method to identify conserved sequences in biological sequences, that are transcription factor binding sites (see title and abstract). Therefore, Farré teaches a method to identify positions in a nucleic acid sequences that should be preserved for functionality and expression of synthetic genes comprised in a synthetic viral genome.
It would be obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have used the method of codon-optimization taught by Chung and substituted the codon-optimized NPC1 gene sequence taught by Venditti with a sequence that is 90% identical to SEQ ID NO: 1750, using further rounds of codon-optimization since Mauro teaches that a protein can be altered using codon-optimization up to 80% compared to its native sequence. One with ordinary skills in the art, motivated in optimizing the sequence for higher production in Escherichia coli of functional variants of NPC1, could have further modified the sequence using additional rounds of codon-optimization as taught by Mauro and Farré. One with ordinary skills in the art motivated in selecting species giving rise to correctly structured protein, the most expression level and high tissue-specific expression, would have performed further rounds of mutations followed by routine optimization and experimentation. One with ordinary skills in the art would have performed these additional rounds of codon-optimization as taught by Mauro with a reasonable expectation of success, since Mauro teaches that the method is commonly used.
Regarding claim 65, it recites “wherein the nucleotide sequence encoding the NPC1 protein comprises the nucleotide sequence of SEQ ID NO: 1750”. Venditti claims any nucleic acid construct comprising a codon-optimized NPC1 (see claim 1, page 76). Venditti also teaches that “The nucleic acid molecules or gene therapy construct in certain embodiments comprise one or more therapeutic transgenes, e.g. NPC1, which is codon optimized for expression in humans…” (see [0019]).
The instant specification establishes the definition of SEQ ID NO: 1750 in Table 2, [0255], as “Codon optimized Human NPC1 protein coding sequence 2”. Therefore, the sequence set forth in SEQ ID NO: 1750 is a species in the larger genus claimed by Venditti.
Regarding claim 66, it recites “wherein the promoter comprises a ubiquitous promoter or a tissue specific promoter”. Venditti teaches that in certain embodiments, the promoter is a tissue-specific promoter (see [0019]).
Regarding claim 70, it recites “ The AAV genome of claim 2, which further comprises: (i) a 5’ inverted terminal repeat (ITR) and a 3’ ITR; (ii) an intron region; (iii) an exon region; (iv) a Kozak sequence; (v) a nucleotide sequence encoding a miR binding site; and/ or (vi) a polyadenylation (polyA) sequence”.
The claim is interpreted as requiring at least one of six elements listed in view of the use of the terms “and/or”. Venditti teaches that a “fourth generation” vector includes a short EF1a promoter, a synthetic intron (“intron S”), a codon-optimized NPC1 gene, a rabbit beta globin gene polyA signal (see [0082]-[0085]). Venditti also teaches that in some embodiments, microRNA (miRNA) binding sites are embedded in the 3’ untranslated region of the therapeutic transgene to provide a cell specific inhibition of translation, which can minimize off target expression in cell types other than neurons if needed (see page 53,[0258]).
Regarding claim 77, Venditti teaches an adeno-associated virus (AAV) particle comprising the AAV genome and an AAV capsid protein (see [0209]-[0210]).
Regarding claim 78, Venditti teaches AAV9 as AAV viral capsid (see [0210]). Venditti also teaches serotype of the viral vector can be selected from a larger group comprising AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 (see [0207]).
Regarding claim 79, Venditti teaches viral vector comprising AAV genome containing a codon optimized NPC1 gene and only ITRs components of wild type of AAV genome (see [0221]).
Regarding claim 80 and 81, Venditti teaches that in some embodiments, the AAV particles are produced in expression systems in host cells, such as Escherichia coli, of insect cells (see [0142]), and can be delivered in human cells (see [0259]).
Regarding claim 82, Venditti teaches a pharmaceutical composition comprising an AAV particle comprising the transgene construct and a pharmaceutically acceptable excipient ([0246], [0259], [0280]).
The combinations of references Venditti, Chung, Mauro and Farre' renders elements of claim 2 obvious. Therefore, since Venditti teaches the elements of claims 65-66, 70, and 77-82, the combination of references also renders elements of these claims obvious; the claims are rejected as well.
Claims 67, 68, 69 and 76 are rejected under 35 U.S.C. §103 as being unpatentable over Venditti (Venditti, C.P. et al. WO 2018/237066 A1, published December 27, 2018; cited on IDS filed 04/27/2023), in view of Chung (Chung, B. K-S. et al. “Computational codon optimization of synthetic gene for protein expression”. BMC Systems Biology, Vol. 6 (2012), p: 134), Mauro (Mauro, V.P. “Codon optimization in the production of recombinant biotherapeutics: potential risks and considerations”. BioDrugs, Vol. 32 (2018), pp: 69-81) and Farré (Farré, D. et al. “Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN”. Nucleic Acids Research, Vol. 31, No. 13 (2003), pp: 3651-6353; cited on IDS filed 04/27/2023 as NPL#3), as applied to claim 2 above, and in further view of NCBI- pdf-1 (“Human elongation factor EF-1-alpha gene, complete cds”; GenBank # J04617.1 ; published November 07, 1994).
The rejection of claim 2 is described above. The combination of references Venditti, Chung, Mauro and Farré renders the elements of claim 2 obvious. However, the combination of references fails to teach elements of claims 67-69 and 76 as described below.
Regarding claims 67 and 69, it recites “wherein the promoter comprises an EF-1a promoter variant comprising [A]-[B]-[C]-[D]-[E], wherein: (i) …or [A] is absent; (ii)…or [B] is absent; (iii) …or [C] is absent; (iv)…or [D] is absent; (v) or [E] is absent.”
Therefore, the claim can be interpreted as only requiring an EF-1a promoter variant, when the other elements are absent. Venditti teaches in other embodiments, a promoter that is a mini EF1a promoter (see [0019]).
Venditti, alone or in combination with Chung, Mauro and Farré, does not teach SEQ ID NO: 1792, 1793 or 1794. The combination fails to teach SEQ ID NO: 1795, SEQ ID NO: 1797, SEQ ID NO: 1822 or 1823, nor SEQ ID NO: 1798.
However, an alignment of elected species SEQ ID NO: 1795 + SEQ ID NO: 1797 + SEQ ID NO: 1822 combined with SEQ ID NOs: 1792 and 1798 (modified to maintain 4 nucleotides only, i.e. one modification), shows 100% identity to SEQ ID NO: 1787 of instant application, claimed in claim 69 as the promoter comprises of the AAV genome (claim 69 (i)).
An NCBI BLAST search of SEQ ID NO: 1787 leads to multiple sequences with a 100% identity with SEQ ID NO: 1787, as shown in the image below. Multiple synthetic vectors comprise the sequence of SEQ ID NO: 1787:
PNG
media_image1.png
625
1274
media_image1.png
Greyscale
These vectors comprise the SEQ ID NO: 1787 sequence because they contain sequences present in the gene of Human Elongation Factor EF-1-alpha gene as shown in the alignment below:
See alignment below (Query = SEQ ID NO: 1787; Sbjct (subject) = GenBank # J04617.1, i.e. Human EF1-alpha gene):
Query 1 GCATGCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 368 GCATGCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGA 427
Query 61 GAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 428 GAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAA 487
Query 121 CTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 488 CTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTA 547
Query 181 TATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 548 TATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACA 607
Query 241 G 241
|
Sbjct 608 G 608
Therefore, NCBI-pdf-1 (GenBank # J04617.1; Human EF-1-alpha gene) teaches a promoter sequence presenting with 100% identity with species SEQ ID NOs: 1792 [A] + 1795 [B] + 1797 [C] + 1822 [D] + modified 1798 [E] (modified to maintain 4 nucleotides only, i.e. one modification) as claimed in claim 67 and SEQ ID NO: 1787 as claimed in claim 69 (i).
As taught in NCBI-pdf-1, the 5’ untranslated sequence from nucleotide (nt) 1 to nt 609 comprises the promoter sequence of human EF-1-alpha gene.
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date, to have substituted the minimum promoter sequence in the construct taught by Venditti modified by Chung, Mauro and Farré, with a sequence encoding for the whole promoter of EF-1alpha, or with a modified promoter comprising only one or two Sp1 binding sites instead of the three taught by NCBI-pdf-1. One with ordinary skills in the art, motivated in a minimum promoter to avoid uncontrolled overexpression, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Allowable Subject Matter
Claims 68 and 76 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Claims 68 and 76 contains allowable subject matters:
Claim 68: An AAV genome wherein [A] and [E] are specifically absent from an EF-1-alpha gene promoter region comprised in SEQ ID NO: 1787.
Claim 76: A sequence comprising SEQ ID NO: 1799-1804, 1755,1810,1815, 1816, 1824, 1827, 1828, 1830 and 1831. These sequences combine the EF-1alpha gene modified promoter ([A]+ or [A]-, [B], [C], [D], [E]+ or [E]-) with the codon-optimized NPC1 (SEQ ID NO: 1750), with a extra sequences between region [E] and +1 (start) of codon-optimized NPC1.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636