Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Acknowledgement is hereby made of receipt and entry of the communication filed on Jan. 27, 2023. Claims 1-8, 17-24 and 26-28 are pending and currently examined.
Sequence Analysis
SEQ ID NOs: 1-4 of instant application are identical. An alignment between instant SEQ ID NO: 1 and the nucleotide sequence shown in GenBank: MN908947.3 (Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome; dated Mar. 18, 2020) is presented below, the claim-recited nucleotide positions 137, 146, 272 and 380 are bolded and underlined:
SEQ1 1 GTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genba 15431 GTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAG 15490
Query 61 ATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTCACGGCCAATG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 15491 ATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTCACGGCCAATG 15550
Query 121 TTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAATTTAC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 15551 TTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAATTTAC 15610
Query 181 AACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 15611 AACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATG 15670
Query 241 AGTTTTACGCATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 15671 AGTTTTACGCATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTG 15730
Query 301 TGTGTTTCAATAGCACTTATGCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 15731 TGTGTTTCAATAGCACTTATGCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGT 15790
Query 361 CAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGGACTGAGACTG 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 15791 CAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGGACTGAGACTG 15850
Query 421 ACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTG 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 15851 ACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTG 15910
Query 481 ATGATTATGTGTACC 495
|||||||||||||||
Sbjct 15911 ATGATTATGTGTACC 15925
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1-8, 17-24 and 26-28 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
These claims are not clear in at least the following aspects:
A. Claim 1 specifies analysing at least a portion of a SARS-CoV-2 viral RNA-dependent RNA polymerase (RdRP) gene or gene product for the presence or absence of at least one single nucleotide polymorphism (SNP) at one of the specified positions. However, the claim does not give a reference sequence for comparison with the sequence obtained for the tested sample to determine whether nucleotide(s) at the specified position contain(s) SNP or not. Additionally, the limitation “wherein SARS-CoV-2 is detected in the sample based on the presence or absence of the at least one SNP” is not clear. Since both presence and absence of the at least one of the SNPs can indicate the detection of SARS-CoV-2 in the test sample, the analysis step appears to be unnecessary. Therefore, it is not clear how the recited analyzing step further limit the claimed method.
To facilitate examination, claim 1 is interpreted as reading on any assay comprising obtaining a SARS-CoV-2 nucleic acid sequence that includes at least one of the recited positions (positions 137, 146, 272 and 380 of the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-4).
B. Claim 17 recites “such as cells, blood, serum, plasma, saliva, cerebrospinal fluid, urine, stool, sputum, nasopharyngeal aspirates or swabs”. This limitation appears to be listing examples of the claimed “biological sample.” It is not clear whether the listed sample types are required or not.
C. Claims 19 and 20 specify “a fragment or variant thereof” of oligonucleotide or primer comprising, consisting of or consisting essentially of a nucleic acid sequence as set forth in any one of SEQ ID NOs: 24, 25, 27 and 28. First, the phrase “a nucleic acid as set forth in any one of SEQ ID NOs: 24, 25, 27 and 28” renders the claims not clear since it is not clear if “a nucleic acid” as claimed must contain the entirety of one of the sequences set forth by SEQ ID NO: 24, 25, 27 or 28, or if a fraction of the recited sequences may suffice. Additionally, the term “variant thereof” renders to claims indefinite. The specification teaches “As used herein, "variant" nucleic acids refer to nucleic acids that comprise nucleotide sequences of naturally occurring (e.g., allelic) variants and orthologs (e.g., from a different strain or isolate) of SARS-CoV-2. Preferably, nucleic acid variants share at least 70% or 75%, preferably at least 80% or 85% or more preferably at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with a nucleotide sequence disclosed herein.” See [0154]. By using the word “preferably”, this teaching does not appear to require (only “prefers”) that “variant” nucleic acids share the stated (e.g., at least 70%) sequence identity to the recited ones. Therefore, the term “variant thereof” is not clearly defined.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-3, 5-8, 17-23 and 26-28 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wang et al. (Small, 2020, 16(32): e2002169. Epub 2020 Jun 24).
Base claim 1 is directed to a method for detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in a sample, comprising the step of analysing at least a portion of a viral RNA-dependent RNA polymerase (RdRP) gene or gene product from the sample for the presence or absence of at least one single nucleotide polymorphism (SNP), wherein the at least one SNP in the at least a portion of the viral RdRP gene or gene product is at a position corresponding to at least one of positions 137, 146, 272 and 380 of the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-4; wherein SARS-CoV-2 is detected in the sample based on the presence or absence of the at least one SNP.
Base claim 18 is directed to an isolated probe, tool or reagent capable of detecting SARS-CoV-2 in a sample, wherein the probe, tool or reagent is capable of binding, detecting or identifying the presence or absence of at least one SNP in at least a portion of a viral RdRP gene or gene product, wherein the at least one SNP in the at least a portion of the viral RdRP gene or gene product is at a position corresponding to at least one of positions 137, 146, 272 and 380 of the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-4.
Base claim 20 is directed to an isolated oligonucleotide or primer comprising, consisting of or consisting essentially of a nucleic acid sequence as set forth in any one of SEQ ID NOs: 24, 25, 27 and 28, a nucleotide sequence complementary thereto or a fragment or variant thereof.
Wang teaches a study on detection of SARS-CoV-2 and other respiratory viruses using nanopore targeted sequencing. Wang compared with its specificity for five common respiratory viruses, the specificity of nanopore targeted sequencing (NTS) for SARS-CoV-2 reaches 100%. Parallel testing with approved real-time reverse transcription-polymerase chain reaction kits for SARS-CoV-2 and NTS using 61 nucleic acid samples from suspected COVID-19 cases show that NTS identifies more infected patients (22/61) as positive, while also effectively monitoring for mutated nucleic acid sequences, categorizing types of SARS-CoV-2, and detecting other respiratory viruses in the test sample. See Abstract.
Wang teaches that NTS is based on the amplification of 11 virulence-related gene fragments and one specific gene fragment (orf1ab) of SARS-CoV- 2 using a primer panel developed in-house, followed by sequencing of the amplified fragments on a nanopore platform. Since this method can precisely determine nucleic acid sequences, positive infection can be confirmed by analyzing output sequence identity, coverage, and read number. See page 3, left column, para 1. Wang teaches that regions including SARS-CoV-2 virulent genes as well as the RNA-dependent RNA polymerase (RdRP) region in ORF1ab were analyzed. Twenty six primers were combined to develop the SARS-CoV-2 primer panel (Table S1, Supporting Information), including two primer pairs amplifying 300-500 bp regions to improve the sensitivity of the orf1ab region amplification by RT-qPCR. See page 3, left column, para 2. A nanopore platform capable of sequencing long nucleic acid fragments was used and data output was analysed in real-time (Figure 1). See page 3, right column, para 2.
Wang teaches that mutation screening of 50 NTS positive samples following the Medaka variant calling process for haploid genomes, filtered by quality values ≥30 and sequencing depth ≥10, identified a total of 42 single base mutations among 27 samples (Ref. NC_045512.2), 14 of which were synonymous and 28 of which were nonsynonymous mutations (Table 1). Table 1 is partially shown below:
PNG
media_image1.png
202
988
media_image1.png
Greyscale
The SNP at genome position 15484 (T to G) is located in the region set forth in instant SEQ ID NO: 1, correlating to nt 15431 - nt 15925 in the sequence shown in NC_045512.2 (the genome sequence in NC_045512.2 is identical to that of GenBank: MN908947 disclosed in Wu above).
In summary, Wang teaches a method for detecting SARS-CoV-2 in a sample, comprising sequencing regions of the viral genome, including the region of RdRP genome, by PCR and nanopore targeted sequencing (NTS). Wang teaches that sequencing results are analyzed for SNPs, showing presence of SNPs in the sequenced regions in Table 1. Table 1 of Wang also indicates the absence of SNPs at the positions of specified in the instant claims.
Regarding claims 8, 19 and 20, Wang is silent on primers comprising, consisting of or consisting essentially of SEQ ID NO: 24, 25, 27 or 28. However, by reciting “a fragment or a fragment thereof”, claim 8 abolishes the sequence limitation (a “fragment” here reads on any consecutive nucleotides of two or more in numbers). Wang teaches primers used in the amplification of SARS-CoV-2 fragments for NTS in Table S1, including two pairs used in amplifying the RdRP gene: Orf1ab-F1, Orf1ab-R1, Orf1ab-F2 and Orf1ab-R2.
Regarding claims 21-22 and 26-27, which specify a chip or array comprising an probe (primer), tool or reagent capable of detecting SARS-CoV-2 as required by the claimed method, Wang teaches that the samples underwent targeted amplification and sequencing performed on a MinION sequencer chip (see page 3, right column, para 3), that two rounds of PCR (target PCR and barcoding PCR) were introduced, for using 96 barcodes to 96 samples that were sequenced on a single chip (Figure 3) (see page 5, left column, para 2). Here, the “chips” used in the study are expected to comprise “arrays” of reagents (e.g., primers/probes), and thus, are also considered to be arrays.
Accordingly, Wang teaches each and every aspect of claims 1-3, 5-8, 17-23 and 26-28.
Claims 1-3, 5-7, 17-20, 23-24 and 28 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wu et al. (Nature, 2020, 579: 265-269; published online Feb. 3, 2020).
Wu teaches a study characterizing a new coronavirus associated with human respiratory disease in China. The authors studied a single patient who was a worker at the market and who was admitted to the Central Hospital of Wuhan on 26 December 2019 while experiencing a severe respiratory syndrome that included fever, dizziness and a cough. Metagenomic RNA sequencing of a sample of bronchoalveolar lavage fluid from the patient identified a new RNA virus strain from the family Coronaviridae, which is designated here ‘WH-Human 1’ coronavirus (and has also been referred to as ‘2019-nCoV’). Phylogenetic analysis of the complete viral genome (29,903 nucleotides) revealed that the virus was most closely related (89.1% nucleotide similarity) to a group of SARS-like coronaviruses (genus Betacoronavirus, subgenus Sarbecovirus) that had previously been found in bats in China. See Abstract.
Wu teaches that, to investigate the possible aetiological agents associated with this disease, the authors collected bronchoalveolar lavage fluid (BALF) and performed deep meta-transcriptomic sequencing. Total RNA was extracted from 200 μl of BALF and a meta-transcriptomic library was constructed for pair-end (150-bp reads) sequencing using an Illumina MiniSeq. Wu teaches that the genome sequence of this virus, as well as its termini, were determined and confirmed by reverse-transcription PCR (RT–PCR) and 5′/3′ rapid amplification of cDNA ends (RACE), respectively. This virus strain was designated as WH-Human 1 coronavirus (WHCV) (and has also been referred to as ‘2019-nCoV’) and its whole genome sequence (29,903 nt) has been assigned GenBank accession number MN908947. Remapping the RNA-sequencing data to the complete genome of WHCV resulted in an assembly of 123,613 reads, providing 99.99% genome coverage at a mean depth of 6.04× (range, 0.01–78.84×) (Extended Data Fig. 3). See page 266, left column.
In summary, Wu teaches a study of detecting SARS-CoV-2 virus in a sample from an infected patient comprising obtaining the entire genome sequence of the virus. The obtaining and depositing of the genome sequence (GenBank accession number MN908947) imply that the sequence of the virus isolate was analyzed for all of the nucleotide positions in the genome, including presence or absence of SNPs. E.g., based on the sequence alignment above, nucleotides corresponding to the recited positions do not vary in the sequence obtained for the virus from the patient of the study.
Accordingly, Wu anticipates claims 1-3, 5-7, 17-20, 23-24 and 28.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al. (Small, 2020, 16(32): e2002169. Epub 2020 Jun 24), as applied above, in view of Pryor et al. (Real-Time Polymerase Chain Reaction and Melting Curve Analysis. In: Lo, Y.M.D., Chiu, R.W.K., Chan, K.C.A. (eds) Clinical Applications of PCR. Methods in Molecular Biology™, vol 336. Humana Press; 2006).
Claim 4 specify that the step of analysing of claim 3 comprises determining the presence or the absence of the at least one SNP using high resolution melt analysis.
Relevance of Wang is set forth above. However, Wang is silent on determining the presence or absence of the at least one SNP using high resolution melt analysis.
Pryor teaches about real-time PCR and melting curve analysis. It teaches that single-nucleotide polymorphism (SNP) can demonstrated in a nucleic acid fragment by melting analysis. See Fig. 4, showing high-resolution melting curves of polymerase chain reaction amplicons from the HTR2A gene locus carrying an SNP.
Accordingly, teachings of Pryor indicate that it is known and practiced to detect SNPs high-resolution melting analysis for PCR amplicons.
It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to introduce the high-resolution melting curve method of detecting SNPs in PCR amplicons into the study of Wang. One of have been motivated to do so, e.g., to evaluate the accuracy of the method in detecting SNPs in the PCR amplicons in Wang.
Claim 24 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al. (Small, 2020, 16(32): e2002169. Epub 2020 Jun 24), as applied above, in view of GenBank: MN908947.3 (Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome. Dated Mar. 18, 2020), and further in view of Marshall (Graphical design of primers with PerlPrimer. Methods Mol Biol. 2007:402:403-14. doi: 10.1007/978-1-59745-528-2_21).
Claim 24 is directed to a kit comprising a pair of oligonucleotides, wherein at least one of the pair of oligonucleotides comprises, consists of or consists essentially of the nucleic acid sequence as set forth in any one of SEQ ID NOs: 24, 25, 27 and 28. These sequences are derived from the RdRP gene of SARS-CoV-2.
Relevance of Wang is set forth above. However, even though it discloses primer sequences targeting the RdRP gene of SARS-CoV-2, it is silent on the primer sequences recited in claim 24.
GenBank: MN908947.3 discloses the complete genome sequence of a SARS-CoV-2 isolate which is identical to the reference sequence, disclosed in NC_045512.2, used in the sequencing study of Wang. GenBank: MN908947.3 comprises amino acid sequence of SEQ ID NO: 24 (forward primer sequence) and the reverse and complement sequence of SEQ ID NO: 25 (reverse primer sequence). Teachings of GenBank: MN908947.3 indicate that the sequence information used in designing primers comprising SEQ ID NOs: 24 or 25 are available at the time of invention.
Marshall teaches that PerlPrimer is a cross-platform application for the design of standard PCR, bisulfite PCR, realtime PCR, and sequencing primers. The program combines accurate primer-design algorithms with powerful interfaces to commonly used Internet databases, such as sequence retrieval from the Ensembl genome databases and the ability to BLAST search primer pairs. The use of PerlPrimer for designing primers is described, together with a synopsis of the primer search and primer-dimer algorithms. See Abstract. Accordingly, teachings of Marshall indicate that it is routine in the fields of PCR and sequencing to design primers based on known nucleic acid sequences.
It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to combine the teachings of Wang, GenBank: MN908947.3 and Marshall to arrive at the invention as claimed through routine experimental optimization unless there is evidence that the claims primer sequences are critical.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to NIANXIANG (NICK) ZOU whose telephone number is (571)272-2850. The examiner can normally be reached on Monday - Friday, 8:30 am - 5:00 pm, EST. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JANET ANDRES, on (571) 272-0867, can be reached. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/NIANXIANG ZOU/
Primary Examiner, Art Unit 1671