Prosecution Insights
Last updated: April 19, 2026
Application No. 18/019,449

NUCLEIC ACID CONSTRUCTS AND USES THEREOF FOR TREATING SPINAL MUSCULAR ATROPHY

Non-Final OA §102§103§112
Filed
Feb 02, 2023
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Hangzhou Exegenesis Bio Ltd.
OA Round
1 (Non-Final)
43%
Grant Probability
Moderate
1-2
OA Rounds
4y 2m
To Grant
98%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allow Rate
19 granted / 44 resolved
-16.8% vs TC avg
Strong +54% interview lift
Without
With
+54.4%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
55 currently pending
Career history
99
Total Applications
across all art units

Statute-Specific Performance

§101
6.5%
-33.5% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
35.3%
-4.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 44 resolved cases

Office Action

§102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's preliminary amendment filed on November 14, 2025 is acknowledged. Claims 3, 5-13, 15-19, 21, 23-26, 29, 31, 33-35, 37-40, 42-43, 46-52, 54-57, 60, and 64-70 have been canceled. Claims 1, 2, 4, 14, 20, 22, 27, 28, 30, 32, 36, 41, 44, 45, 53, 58, 59, 61, 62, and 63 are pending. Election/Restrictions Applicant’s election without traverse of Group I (claims 1, 2, 4, 14, 20, 22, 27, 28, 30, 32, 36, 41, 44, 45, 53, 58, 59, and 61) and the following species in the reply filed on November 14, 2025 is acknowledged: PNG media_image1.png 650 730 media_image1.png Greyscale PNG media_image2.png 64 706 media_image2.png Greyscale Claims 62 and 63 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on November 14, 2025. Claims 1, 2, 4, 14, 20, 22, 27, 28, 30, 32, 36, 41, 44, 45, 53, 58, 59, and 61 are examined on the merits herein. Priority PNG media_image3.png 116 786 media_image3.png Greyscale Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Information Disclosure Statement The information disclosure statement (IDS) submitted on August 15, 2023, May 23, 2025, and February 24, 2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Drawings The drawings were received on February 2, 2023. The drawings are objected to because the figure label for FIG. 7B is not oriented in the same direction as the figure. See 37 CFR 1.84(p)(1). In addition, FIGS. 1A, 2A, 2B, 3, 4, 5, 6, 7A, and 8A are blurry. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The disclosure is objected to because of the following informalities: Paragraph [0046] reads in part PNG media_image4.png 74 866 media_image4.png Greyscale and should read “codon optimized constructs” (emphasis added). Paragraph [0051] reads in part “constructes….protomers” and should read “constructs…promoters”. Paragraph [0083] reads in part “Non-liminting examples” and should read “Non-limiting examples”. Appropriate correction is required. Claim Objections Claims 2, 4, 20, 28, 30, 32, 44, 45, and 58 are objected to because of the following informalities: Claim 2 is missing the word “or” before “99% identity”. Claim 2 recites in part “selected from a group consisting of SEQ ID NO: 34 and SEQ ID NO: 35” and should recite “selected from the group” (emphasis added). Claim 4 is missing the word “of” after “The nucleic acid”. Claim 20 is missing the word “of” after “The nucleic acid”. Claim 28 recites in part “SMA protein” and should recite “SMN protein” (emphasis added). Claim 28 is missing the word “or” before “99% identity”. Claim 28 recites in part “selected from a group consisting of SEQ ID NO: 34 and SEQ ID NO: 35” and should recite “selected from the group” (emphasis added). Claim 30 recites in part “selected from a group consisting of” and should recite “selected from the group” (emphasis added). There are three (3) instances of this recitation in the claim. Claim 30 recites parts (a), (b), (c), (e), and (f) and is missing part (d). Claim 32 recites in part “selected from a group consisting of” and should recite “selected from the group” (emphasis added). Claim 44 recites in part “SEQ ID NO: 22 or SEQ ID NO: 23” and should recite “SEQ ID NO: 22, SEQ ID NO: 23” so remove “or” and replace with a comma. Claim 44 is missing the word “or” before “99%”. Claim 44 recites in part “99% identify” and should recite “99% identity”. Claim 45 recites in part “selected from a group consisting of” and should recite “selected from the group” (emphasis added). This limitation is recited in part (i) (Applicant’s election) and two (2) of the three (3) optionally wherein clauses of the claim. Claim 58 is missing the word “or” before “99%”. Claim 58 recites in part “99% identify” and should recite “99% identity”. Appropriate correction is required. Claim Interpretation The claim limitations after the recitation of “optionally” are interpreted by the Examiner as optional and thus are not required. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 2, 4, 14, 20, 22, 27, 28, 30, 32, 36, 41, 44, 45, 53, 58, 59, and 61 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a nucleic acid comprising a first nucleic acid region comprising a nucleic acid sequence encoding a SMN protein and a second nucleic acid region comprising one or more target segments of one or more endogenous miRNAs wherein the second nucleic acid region is at 3’ of the first nucleic acid region, does not reasonably provide enablement for a nucleic acid comprising a first nucleic acid region comprising a nucleic acid sequence encoding a SMN protein or variant thereof and a second nucleic acid region comprising one or more target segments of one or more endogenous miRNAs wherein the second nucleic acid region is at 3’ of the first nucleic acid region. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. There are many factors to be considered when determining whether there is sufficient evidence to support a determination that a disclosure does not satisfy the enablement requirement and whether any necessary experimentation is "undue". These factors include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below. Breadth of claims: Claim 1 is drawn to a nucleic acid comprising (i) a first nucleic acid region comprising a nucleic acid sequence encoding a SMN protein or variant thereof and (ii) a second nucleic acid region comprising one or more target segments of one or more endogenous miRNAs wherein the second nucleic acid region is at 3’ of the first nucleic acid region. The broadest reasonable interpretation of claim 1 is that the nucleic acid encompasses a nucleic acid comprising (i) a first nucleic acid region comprising a nucleic acid sequence encoding any variant of SMN protein and (ii) a second nucleic acid region comprising one or more target segments of one or more endogenous miRNAs. Nature of the invention: The specification envisions a method of treating a disease or disorder in a subject comprising administering to the subject the nucleic acid provided herein. In some embodiments, the disease or disorder is a SMN associated disease or disorder wherein the disease or disorder is associated with insufficient expression of SMN protein, deficient SMN protein, or smn1 gene deletion and/or mutation. Therefore, the nucleic acid comprising (i) a first nucleic acid region comprising a nucleic acid sequence encoding any variant of SMN protein and (ii) a second nucleic acid region comprising one or more target segments of one or more endogenous miRNAs must be capable of providing a therapeutic outcome for a SMN associated disease or disorder. Amount of direction provided by the inventor and existence of working examples: The specification discloses the following: PNG media_image5.png 136 674 media_image5.png Greyscale Specifically, Table 5 discloses that SEQ ID NO: 33 is the SMN protein (wt) amino acid sequence, SEQ ID NO: 34 is the SMN nucleic acid sequence (wt), and SEQ ID NO: 35 is the codon optimized SMN nucleic acid sequence [00373]. The specification envisions that the nucleic acid comprises one or more insertions, deletions, inversions, and/or substitutions. In other embodiments, the nucleic acid construct comprises a nucleic acid region which has been codon optimized [00115]. Further, the specification envisions that the nucleic acid constructs comprises a nucleic acid sequence encoding a SMN protein variant wherein the variant comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 33 [00119]. State of the prior art, level of predictability in the art, and level of one of ordinary skill: Pellizzoni et al. (Proc. Natl. Acad. Sci. 1999) discloses that a number of SMA patients have been shown to have a deletion of at least exon 7, which also is the main product of SMN2, or single-point mutations within the YG box rather than complete deletions of SMN1. As a result of these mutations, SMN has a reduced ability to self-associate, and this defect correlates with SMA severity. The same mutants lack the function of wild-type SMN in regenerating the splicing machinery in vitro, a possible functional defect associated with SMA [page 11167, right column, first paragraph]. Iyer et al. (Human Molecular Genetics 2018) discloses that in SMA patients with one or two copies of the Survival Motor Neuron 2 (SMN2) gene there are a number of SMN missense mutations that result in milder-than-predicted SMA phenotypes. Iyer et al. also discloses that mild SMN missense alleles are not partially functional but rather they are completely non-functional in the absence of wild-type SMN in mammals [abstract]. Thus, as evidenced by Pellizzoni et al. and Iyer et al., variants of SMN will not retain the function of wild-type SMN. Quantity of experimentation: In view of the breadth of the claims which embrace a nucleic acid comprising (i) a first nucleic acid region comprising a nucleic acid sequence encoding any variant of SMN protein and (ii) a second nucleic acid region comprising one or more target segments of one or more endogenous miRNAs that must be capable of providing a therapeutic outcome for a SMN associated disease or disorder, the state and level of predictability in the art, and the failure to provide adequate guidance to overcome the state and level of predictability of the art, one of skill would have to perform undue experimentation in order to practice the invention commensurate in scope with the claims. Improper Markush Grouping Claims 20 and 41 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush grouping of second nucleic acid region sequences is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: the alternatives listed in the claims lack any common structure or obvious common function. Each of the sequences recited in the claims (SEQ ID NOS: 18-21) have a different structure (Table 6 on page 96 reproduced below) and thus a different function. Thus, the Markush grouping of second nucleic acid region sequences is improper because the alternatives listed in the claims do not share a common structure and function. PNG media_image6.png 596 700 media_image6.png Greyscale PNG media_image7.png 202 698 media_image7.png Greyscale PNG media_image8.png 374 708 media_image8.png Greyscale To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 4, 14, 22, 44, 58, 59, and 61 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ma et al. (CN 108795946; reference cited by Applicant). A machine translation of Ma et al. was previously supplied by the Examiner, and references to the various passages of Ma et al. refer to the machine translation. Regarding claims 1 and 4, Ma et al. teaches a SMN1 gene expression cassette structure, a plurality of promoter elements with short sequences and high expression level, and optimization of the sequence of the SMN1 gene coding region. Ma et al. also teaches adding the human miR-122 target sequence to the 3’ UTR of the SMN1 gene expression cassette [page 4, last paragraph]. Regarding claim 14, Ma et al. teaches that a single human miR-122 fully complementary target sequence was added to the 3' end of the SMN1 sequence (SEQ ID NO: 12), resulting in the SMN1-122T sequence (SEQ ID NO: 14) [page 13, second full paragraph]. Ma et al. SEQ ID NO: 14 (designated as Db) has a match to instant SEQ ID NO: 10 (designated as Qy) as shown in the alignment below. PNG media_image9.png 112 590 media_image9.png Greyscale Regarding claim 22, Ma et al. teaches that the AAV vector was chosen to carry the SMN1 gene expression cassette [page 6, first paragraph]. Claim 44 recites in part “A rAAV vector comprising a nucleic acid sequence of SEQ ID NO: 22”. Given the broadest reasonable interpretation, the rAAV vector comprises any sequence of SEQ ID NO: 22 without any limitation on the length of the nucleic acid sequence. Regarding claim 44, Ma et al. teaches that a single human miR-122 fully complementary target sequence was added to the 3' end of the SMN1 sequence (SEQ ID NO: 12), resulting in the SMN1-122T sequence (SEQ ID NO: 14). Ma et al. SEQ ID NO: 14 (designated as Db) has a match to instant SEQ ID NO: 22 (designated as Qy) as shown in the alignment below. PNG media_image10.png 328 536 media_image10.png Greyscale PNG media_image11.png 338 534 media_image11.png Greyscale PNG media_image12.png 214 528 media_image12.png Greyscale Claim 58 recites in part “A rAAV vector comprising a nucleic acid sequence of SEQ ID NO: 51”. Given the broadest reasonable interpretation, the rAAV vector comprises any sequence of SEQ ID NO: 51 without any limitation on the length of the nucleic acid sequence. Regarding claim 58, Ma et al. teaches that a single human miR-122 fully complementary target sequence was added to the 3' end of the SMN1 sequence (SEQ ID NO: 12), resulting in the SMN1-122T sequence (SEQ ID NO: 14). Ma et al. SEQ ID NO: 14 (designated as Db) has a match to instant SEQ ID NO: 51 (designated as Qy) as shown in the alignment below. Query Match 38.3%; Score 864.8; DB 1; Length 915; Best Local Similarity 99.6%; Matches 888; Conservative 0; Mismatches 2; Indels 2; Gaps 2; Qy 894 GCCACCATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCC 953 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GCCACCATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCC 60 Qy 954 GTGCTGTTCCGGCGCGGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAGCA 1013 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 61 GTGCTGTTCCGGCGCGGCACAGGCCAGAGCGATGATTCTGA-ATTTGGGATGATACAGCA 119 Qy 1014 CTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGAC 1073 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 120 CTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGAC 179 Qy 1074 ATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAAT 1133 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 180 ATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAAT 239 Qy 1134 AAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGT 1193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 240 AAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGT 299 Qy 1194 TCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTT 1253 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 300 TCTGCCATTTGGTCAGAAGACGGTTGCATTTA-CCAGCTACCATTGCTTCAATTGATTTT 358 Qy 1254 AAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTG 1313 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 359 AAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTG 418 Qy 1314 TCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAGAATGCTCAAGAG 1373 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 419 TCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAAAATGCTCAAGAG 478 Qy 1374 AATGAAAATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAAT 1433 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 479 AATGAAAATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAAT 538 Qy 1434 AAATCAGATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCC 1493 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 539 AAATCAGATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCC 598 Qy 1494 CCCATGCCAGGGCCAAGACTGGGACCAGGAAAGCCAGGTCTAAAATTCAATGGCCCACCA 1553 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 599 CCCATGCCAGGGCCAAGACTGGGACCAGGAAAGCCAGGTCTAAAATTCAATGGCCCACCA 658 Qy 1554 CCGCCACCGCCACCACCACCACCCCACTTACTATCATGCTGGCTGCCTCCATTTCCTTCT 1613 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 659 CCGCCACCGCCACCACCACCACCCCACTTACTATCATGCTGGCTGCCTCCATTTCCTTCT 718 Qy 1614 GGACCACCAATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGAT 1673 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 719 GGACCACCAATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGAT 778 Qy 1674 GCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATG 1733 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 779 GCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATG 838 Qy 1734 GGTTTTAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAG 1785 ||||| |||||||||||||||||||||||||||||||||||||||||||||| Db 839 GGTTTCAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAG 890 Regarding claim 59, Ma et al. teaches in Example 2 that the three-plasmid packaging system was used to package the recombinant AAV virus, and the cesium chloride density gradient centrifugation method was used to separate, purify and package the AAV virus [page 13]. Ma et al. teaches a SMN1 gene expression cassette structure, a plurality of promoter elements with short sequences and high expression level, and optimization of the sequence of the SMN1 gene coding region. Ma et al. also teaches adding the human miR-122 target sequence to the 3’ UTR of the SMN1 gene expression cassette [page 4, last paragraph]. Further, Ma et al. obtained two new AAV vector serotypes that can be used for SMA gene therapy, AAV5 and AAVrh10 [page 6, sixth paragraph]. Regarding claim 61, Ma et al. evaluated the effect of different administration methods on the therapeutic effect and found that intrathecal, intracerebroventricular, and intravenous injections can all achieve better therapeutic effects in animal models [page 6, sixth paragraph]. Claims 44, 45, 53, and 58 are rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C. 102(a)(2) as being anticipated by Passini et al. (US 2016/0074474). Claim 44 recites in part “A rAAV vector comprising a nucleic acid sequence of SEQ ID NO: 22”. Given the broadest reasonable interpretation, the rAAV vector comprises any sequence of SEQ ID NO: 22 without any limitation on the length of the nucleic acid sequence. Regarding claim 44, Passini et al. teaches a self-complementary recombinant adeno-associated virus (rAAV) viral particle comprising a transgene expressing SMN capable of treating spinal muscular atrophy [abstract]. Further, Passini et al. teaches the AAV viral particle comprises a recombinant viral genome derived from the polynucleotide of SEQ ID NO: 6 [0015]. Passini et al. SEQ ID NO: 6 (designated as Db) has a match to instant SEQ ID NO: 22 (designated as Qy) as shown in the alignment below. Passini et al. SEQ ID NO: 6 is the nucleic acid sequence for pscAAV-minCBA hSMN1 [0026]. Query Match 57.7%; Score 1497.2; Length 2338; Best Local Similarity 91.3%; Matches 1639; Conservative 0; Mismatches 113; Indels 44; Gaps 3; Qy 139 GTGGTACCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCC 198 | | | | |||||||||||||||||||||||||||||||||||||||||||||||||||| Db 232 GAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCC 291 Qy 199 CGCCCATTGACGTCA------------------ATAGTAACGCCAATAGGGACTTTCCAT 240 ||||||||||||||| ||||||||||||||||||||||||||| Db 292 CGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCAT 351 Qy 241 TGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTAT 300 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 352 TGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTAT 411 Qy 301 CATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Db 412 CATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTAT 471 Qy 361 GCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 472 GCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC 531 Qy 421 GCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 532 GCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCC 591 Qy 481 TCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 592 TCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCG 651 Qy 541 GGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 652 GGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCG 711 Qy 601 AGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 712 AGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATG 771 Qy 661 GCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 772 GCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCT 831 Qy 721 GCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 832 GCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCT 891 Qy 781 CTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTG 840 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Db 892 CTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGG-CCTTCTCCTCCGGGCTG 950 Qy 841 TAATTAGCTGAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTT 900 |||||||| | | || || | || | | | | Db 951 TAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGA 1010 Qy 901 TAATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAGGAATTCCCGGGATATCGTCG 960 || ||||| |||| | || | || | | | | | Db 1011 GGGGCTCCGGGAGCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAG 1070 Qy 961 ACCCACGCGTCCGGGCCCCACGCTGCGCACCCGCGGGTTT-------------------- 1000 || | || || || || | | || Db 1071 CTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTTTGGAAC 1130 Qy 1001 -----GCTATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATT 1055 |||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1131 TCGAATTCATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATT 1190 Qy 1056 CCGTGCTGTTCCGGCGCGGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAG 1115 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1191 CCGTGCTGTTCCGGCGCGGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAG 1250 Qy 1116 CACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTG 1175 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1251 CACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTG 1310 Qy 1176 ACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGA 1235 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1311 ACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGA 1370 Qy 1236 ATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAAT 1295 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1371 ATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAAT 1430 Qy 1296 GTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATT 1355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1431 GTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATT 1490 Qy 1356 TTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATC 1415 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1491 TTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATC 1550 Qy 1416 TGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAGAATGCTCAAG 1475 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1551 TGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAGAATGCTCAAG 1610 Qy 1476 AGAATGAAAATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAA 1535 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1611 AGAATGAAAATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAA 1670 Qy 1536 ATAAATCAGATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCAC 1595 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1671 ATAAATCAGATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCAC 1730 Qy 1596 CCCCCATGCCAGGGCCAAGACTGGGACCAGGAAAGCCAGGTCTAAAATTCAATGGCCCAC 1655 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1731 CCCCCATGCCAGGGCCAAGACTGGGACCAGGAAAGCCAGGTCTAAAATTCAATGGCCCAC 1790 Qy 1656 CACCGCCACCGCCACCACCACCACCCCACTTACTATCATGCTGGCTGCCTCCATTTCCTT 1715 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1791 CACCGCCACCGCCACCACCACCACCCCACTTACTATCATGCTGGCTGCCTCCATTTCCTT 1850 Qy 1716 CTGGACCACCAATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTG 1775 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1851 CTGGACCACCAATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTG 1910 Qy 1776 ATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATA 1835 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1911 ATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATA 1970 Qy 1836 TGGGTTTTAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGA 1891 ||||||| |||||||||||||||||||||||||||||||||||||||||||||| | Db 1971 TGGGTTTCAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGAA 2026 Regarding claim 45, Passini et al. teaches an isolated nucleic acid (e.g., a transgene) that encodes an SMN protein, wherein the isolated nucleic acid can be packaged in any AAV viral particle [0077]. In some embodiments, the SMN1 transgene is operably linked to a promoter. An exemplary promoter includes a cytomegalovirus enhancer linked to a chicken β-actin promoter [0080]. Regarding claim 53, Passini et al. teaches a rAAV vector is a vector derived from an AAV serotype, including without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9, AAVrh.8, AAVrh.10, AAV11, or AAV12 or the like. In some embodiments, the nucleic acid in the AAV further encodes any one or more SMN protein [0083]. Claim 58 recites in part “A rAAV vector comprising a nucleic acid sequence of SEQ ID NO: 51”. Given the broadest reasonable interpretation, the rAAV vector comprises any sequence of SEQ ID NO: 51 without any limitation on the length of the nucleic acid sequence. Regarding claim 58, Passini et al. teaches a self-complementary recombinant adeno-associated virus (rAAV) viral particle comprising a transgene expressing SMN capable of treating spinal muscular atrophy [abstract]. Further, Passini et al. teaches the AAV viral particle comprises a recombinant viral genome derived from the polynucleotide of SEQ ID NO: 6 [0015]. Passini et al. SEQ ID NO: 6 (designated as Db) has a match to instant SEQ ID NO: 51 (designated as Qy) as shown in the alignment below. Passini et al. SEQ ID NO: 6 is the nucleic acid sequence for pscAAV-minCBA hSMN1 [0026]. Query Match 51.4%; Score 1160.6; Length 2338; Best Local Similarity 74.7%; Matches 1657; Conservative 0; Mismatches 309; Indels 251; Gaps 6; Qy 134 CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT 193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 240 CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT 299 Qy 194 GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCA 253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 300 GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCA 359 Qy 254 ATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC 313 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Db 360 ATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC 419 Qy 314 AAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA 373 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 420 AAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA 479 Qy 374 CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAC 433 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 480 CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAC 539 Qy 434 CATG-------------------------------------------------------- 437 |||| Db 540 CATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACC 599 Qy 438 ---------------------AGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGG 476 | || | || | | | | | | |||| || Db 600 CCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGG 659 Qy 477 GGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCA 536 ||| | | | | || | | | || || | | | Db 660 GGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAG 719 Qy 537 AATTGC---------------------------------GCATCCCCTATCAGAGAGGGG 563 | ||| | ||| | | |||| | Db 720 AGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCG 779 Qy 564 GAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCGGACAGT 623 | || | || | |||| | || || || | ||| | Db 780 GCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGACGCT 839 Qy 624 GCCTTCGCCCC----------CGCCTGGCGGCGCGCGCCACCGCCGCCTCAGCACTGAAG 673 ||||||||||| | | | || | |||||| || | || | Db 840 GCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGA 899 Qy 674 GCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTTCCCGGCCACCTTGGTCGCG 733 |||| | ||| | | | | | | || | | | | | ||| Db 900 CCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCTTCTCCTCCGGGCTGTAATTAGCG 959 Qy 734 TCCGCGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGGCACG 793 | | |||| | | | | |||| || Db 960 CTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCG 1019 Qy 794 GGCGCG-------------ACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAG 840 || || ||||| | | | | | | | ||| | Db 1020 GGAGCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGC 1079 Qy 841 TCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGAGAGCGCAGGGATACACGCCACCA 900 | | ||| | | | | || | || || || Db 1080 AACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTTTGGAACTCGAATTCA 1139 Qy 901 TGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCCGTGCTGT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1140 TGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCCGTGCTGT 1199 Qy 961 TCCGGCGCGGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1200 TCCGGCGCGGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAA 1259 Qy 1021 AAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1260 AAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTG 1319 Qy 1081 AAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1320 AAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCC 1379 Qy 1141 AAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1380 AAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCA 1439 Qy 1201 TTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1440 TTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAG 1499 Qy 1261 AAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1500 AAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATC 1559 Qy 1321 TACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAGAATGCTCAAGAGAATGAAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1560 TACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAGAATGCTCAAGAGAATGAAA 1619 Qy 1381 ATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAATAAATCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1620 ATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAATAAATCAG 1679 Qy 1441 ATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCCCCCATGC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1680 ATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCCCCCATGC 1739 Qy 1501 CAGGGCCAAGACTGGGACCAGGAAAGCCAGGTCTAAAATTCAATGGCCCACCACCGCCAC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1740 CAGGGCCAAGACTGGGACCAGGAAAGCCAGGTCTAAAATTCAATGGCCCACCACCGCCAC 1799 Qy 1561 CGCCACCACCACCACCCCACTTACTATCATGCTGGCTGCCTCCATTTCCTTCTGGACCAC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1800 CGCCACCACCACCACCCCACTTACTATCATGCTGGCTGCCTCCATTTCCTTCTGGACCAC 1859 Qy 1621 CAATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1860 CAATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGG 1919 Qy 1681 GAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATGGGTTTTA 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Db 1920 GAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATGGGTTTCA 1979 Qy 1741 GACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGAGAAATGCTGGCAT 1800 ||||||||||||||||||||||||||||||||||||||||||||| Db 1980 GACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAG--------------- 2024 Qy 1801 AGAGCAGCACTAAATGACACCACTAAAGAAACGATCAGACAGATCTACAAAGCTTATCGA 1860 Db 2025 ------------------------------------------------------------ 2024 Qy 1861 TACCGTCGACTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTG 1920 | | | | | | ||||||||||||||||||||||||||| Db 2025 -------AATTGCACCACCAGGCCTGATAGGCCCTGTGCCTTCTAGTTGCCAGCCATCTG 2077 Qy 1921 TTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2078 TTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTT 2137 Qy 1981 CCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2138 CCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGG 2197 Qy 2041 GTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGTCTAGAGCAGGCATGCTGGGG 2100 ||||||||||||||||||||||||||||||||||||||| | | ||||||||||| Db 2198 GTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGC----- 2252 Qy 2101 AGAGATCGATCTGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGC 2160 | | | ||||||||||||||||||||||| Db 2253 -------------------------------ACTAGTCCACTCCCTCTCTGCGCGCTCGC 2281 Qy 2161 TCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCG 2217 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2282 TCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCG 2338 Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 2 is rejected under 35 U.S.C. 103 as being unpatentable over Ma et al. (CN 108795946; reference cited by Applicant) as applied to claims 1, 4, 14, 22, 44, 58, 59, and 61 above, and further in view of Passini et al. (US 2016/0074474). A machine translation of Ma et al. was previously supplied by the Examiner, and references to the various passages of Ma et al. refer to the machine translation. Regarding claim 2, the teachings of Ma et al. are discussed above. However, Ma et al. does not teach wherein the SMN protein comprises an amino acid sequence of SEQ ID NO: 33 (claim 2). Passini et al. teaches a self-complementary recombinant adeno-associated virus (rAAV) viral particle comprising a transgene expressing SMN capable of treating spinal muscular atrophy [abstract]. Passini et al. teaches SEQ ID NO: 1 (designated as Db) which has a 100% match to instant SEQ ID NO: 33 (designated as Qy) as shown in the alignment below. Passini et al. SEQ ID NO: 1 is the amino acid sequence of SMN protein [0019]. PNG media_image13.png 560 882 media_image13.png Greyscale It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the nucleic acid of Ma et al. with SEQ ID NO: 1 of Passini et al. because Ma et al. taught a SMN1 gene expression cassette structure, a plurality of promoter elements with short sequences and high expression level, and optimization of the sequence of the SMN1 gene coding region and Passini et al. taught a self-complementary recombinant adeno-associated virus (rAAV) viral particle comprising a transgene expressing SMN and thus it would have amounted to a simple substitution of one known element for another to obtain predictable results. One of ordinary skill in the art would have made such a substitution in order to achieve the predictable result of a nucleic acid capable of treating spinal muscular atrophy. Claims 27, 30, 32, and 36 are rejected under 35 U.S.C. 103 as being unpatentable over Ma et al. (CN 108795946; reference cited by Applicant) in view of Gao et al. (US 2013/0195801; reference cited by Applicant). A machine translation of Ma et al. was previously supplied by the Examiner, and references to the various passages of Ma et al. refer to the machine translation. Regarding claims 27, 30, 32, and 36, Ma et al. teaches a SMN1 gene expression cassette structure, a plurality of promoter elements with short sequences and high expression level, and optimization of the sequence of the SMN1 gene coding region. Ma et al. also teaches adding the human miR-122 target sequence to the 3’ UTR of the SMN1 gene expression cassette [page 4, last paragraph]. Ma et al. teaches designing an SMN1 expression cassette containing the target sequence of human miR-122, and prepared a recombinant AAV vector containing this expression cassette [page 6, fifth paragraph]. Ma et al. also provided AAV drug designs for other serotypes except AAV9, specifically AAV5 and AAVrh10, both of which can effectively deliver the SMN1 expression cassette they carry to the nervous system [page 5, first paragraph]. Ma et al. teaches that a single human miR-122 fully complementary target sequence was added to the 3' end of the SMN1 sequence (SEQ ID NO: 12), resulting in the SMN1-122T sequence (SEQ ID NO: 14) [page 13, second full paragraph]. Ma et al. SEQ ID NO: 14 (designated as Db) has a match to instant SEQ ID NO: 10 (designated as Qy) as shown in the alignment below. PNG media_image9.png 112 590 media_image9.png Greyscale However, Ma et al. does not teach a target segment of an endogenous miRNA in heart (claim 27) wherein the miRNA is hsa-mir-133a-1 (claim 30). Ma et al. also does not teach wherein the second nucleic acid region comprises two or more target segments of hsa-miR-133a-1 (claim 32). Gao et al. teaches that one or more binding sites for one or more miRNAs are incorporated in a transgene of a rAAV vector to inhibit the expression of the transgene in one or more tissues of a subject harboring the transgenes. The binding sites may be selected to control the expression of a transgene in a tissue specific manner. Expression of a transgene in the liver may be inhibited by incorporating a binding site for miR-122 such that mRNA expressed from the transgene binds to and is inhibited by miR-122 in the liver. Expression of a transgene in the heart may be inhibited by incorporating a binding site for miR-133a or miR-1, such that mRNA expressed from the transgene binds to and is inhibited by miR-133a or miR-1 in the heart. The presence of multiple miRNA binding sites may result in the cooperative action of multiple RISCs and provide highly efficient inhibition of expression [0094]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the nucleic acid of Ma et al. by incorporating two or more target segments of an endogenous miRNA in heart wherein the miRNA is hsa-miR-133a because it would have amounted to combining prior art elements to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Ma et al. taught adding a human miR-122 target sequence to the 3’ UTR of the SMN1 gene expression cassette and Gao et al. taught that incorporating multiple miRNA binding sites in a transgene of a rAAV vector provides highly efficient inhibition of expression wherein mRNA expressed from the transgene binds to and is inhibited by miR-122 in the liver and miR-133a in the heart. Claim 28 is rejected under 35 U.S.C. 103 as being unpatentable over Ma et al. (CN 108795946; reference cited by Applicant) in view of Gao et al. (US 2013/0195801; reference cited by Applicant) as applied to claims 27, 30, 32, and 36 above, and further in view of Passini et al. (US 2016/0074474). A machine translation of Ma et al. was previously supplied by the Examiner, and references to the various passages of Ma et al. refer to the machine translation. Regarding claim 28, the teachings of Ma et al. and Gao et al. are discussed above. However, Ma et al. and Gao et al. do not teach a nucleic acid sequence encoding a SMN protein comprising an amino acid sequence of SEQ ID NO: 33. Passini et al. teaches a self-complementary recombinant adeno-associated virus (rAAV) viral particle comprising a transgene expressing SMN capable of treating spinal muscular atrophy [abstract]. Passini et al. teaches SEQ ID NO: 1 (designated as Db) which has a 100% match to instant SEQ ID NO: 33 (designated as Qy) as shown in the alignment below. Passini et al. SEQ ID NO: 1 is the amino acid sequence of SMN protein [0019]. PNG media_image13.png 560 882 media_image13.png Greyscale It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the nucleic acid of Ma et al. and Gao et al. with SEQ ID NO: 1 of Passini et al. because Ma et al. taught a SMN1 gene expression cassette structure, a plurality of promoter elements with short sequences and high expression level, and optimization of the sequence of the SMN1 gene coding region and Passini et al. taught a self-complementary recombinant adeno-associated virus (rAAV) viral particle comprising a transgene expressing SMN and thus it would have amounted to a simple substitution of one known element for another to obtain predictable results. One of ordinary skill in the art would have made such a substitution in order to achieve the predictable result of a nucleic acid capable of treating spinal muscular atrophy. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Christina Tran whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Feb 02, 2023
Application Filed
Mar 15, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
2y 5m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
2y 5m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
2y 5m to grant Granted Feb 10, 2026
Patent 12529057
THERAPEUTICS FOR SYNGAP HAPLOINSUFFICIENCY
2y 5m to grant Granted Jan 20, 2026
Patent 12522818
METHOD FOR INDUCING DELETION IN GENOMIC DNA
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
43%
Grant Probability
98%
With Interview (+54.4%)
4y 2m
Median Time to Grant
Low
PTA Risk
Based on 44 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month