DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
The report on patentability of the IPEA and/or ISA has been considered by the examiner.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-6, 8, 9 and 11-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Kim et al. (Appl. Matter Interfaces 13, 9390-9401 and Supporting Information, pages 1-12, published on 11/6/20).
Kim et al. teach a polymer/aptamer gold nanoconstruct coated with an ATP aptamer and TNF-α DNA aptamer polymeric phenylboronic acid (pPBA) (pages 9390-9399). The mixture of pPBA and ATP formed a phenylboronic ester that was connected to the TNF-α aptamer. The gold nanoparticle in nanoconstruct had a size of 10-200 nm (page 9393). The nucleotide sequences for the ATP aptamer and TNF-α aptamer taught by Kim et al. are identical to the nucleotide sequences for the aptamers in instant claims 8-9. The term “a sequence of SEQ ID NO: 1 or 2” reads on one sequence of SEQ ID NO: 1 or 2. See Supporting information, pages 1-12.
PNG
media_image1.png
138
605
media_image1.png
Greyscale
SEQ ID NO: 1 recited in instant claims 8 and 9 set forth below:
1 acctggggga gtattgcgga ggaaggtttt ttttggtgga tggcgcagtc ggcgacaattttttt 65
The pre-amble in instant claims 12-14 are directed to an intended use of the claimed product and do not have patentable weight over the nanoconstruct taught in the prior art. See MPEP 2122 “Utility need not be disclosed in reference”.
The rejection is applicable because the applicant has not filed a certified English translation of the foreign priority document. Thus, the instant claims only enjoy priority to 10/5/21. Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 2, and 11-14 are rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Biomaterials 75 (2016) 102-111) taken with Davis (US 20140249202) and Cai et al. (Nanotechnology, Science and Applications I: 17-32, 2008).
Kim et al. teach phenylbonoronic acid (PBA) can be used for target-specific delivery of a cancer drug because it specifically binds to sialylated epitopes that are overexpressed on the surface of various types of tumor (page 103). In addition PBA has low immunogenicity and can be easily modified. Kim et al. produced PBA-PEG-Cross PEI vector carrying a VEGF antagonist (Figure 1). Exposure of the vector to the intracellular pH and ATP in a tumor cell resulted in VEGF release. In another experiment ATP production was blocked to study gene transfection by CrossPEI/pDNA polyplex (Page 107).
However, Kim does not specifically teach a nanoconstruct consisting of a gold nanoparticle having an aptamer conjugated to the nanoparticle, wherein the aptamer is coated with a polymerized PBA.
Davis teaches targeted nanoparticles comprising a nucleic acid-containing polymer, a therapeutic agent, a polymer containing a phenylboronic acid, said phenylboronic acid being coupled to the nucleic acid polymer with a reversible covalent linkage, said targeted nanoparticle being configured to present the polymer containing the phenylboronic acid to an environment external to the nanoparticle, wherein the polymer containing the phenylboronic acid is conjugated to a targeting ligand at its terminal end opposite the nanoparticle, wherein said targeted nanoparticle has only one single targeting ligand, wherein the targeting ligand is an aptamer (pages 1-10, 14 and 46-48).
In addition, gold nanoparticles were well known to one of ordinary skill in the art for use in drug delivery as taught by Cai. Gold nanospheres of 2 nm to 100 nm can be synthesized (pages 18 and 20-27).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Kim taken with Davis and Cai to make a nanoconstruct consisting of a gold nanoparticle and an aptamer conjugated to the exterior of the nanoparticle and a polymerized PBA coats the aptamer, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to deliver a therapeutic agent using the nanoparticle to a cell. See MPEP 2143(I)A. Davis teaches that nanoparticles can be 10-200 nm (paragraphs 50 and 68). It would have been obvious to one of ordinary skill in the art to use a hydrophilic polymer comprising the PBA to coat the aptamer because a person of ordinary skill in the art would possess the knowledge that PBA is a hydrophilic polymer. MPEP 2141 II.C. Rationales to support rejections under 35 U.S.C. 103 recites, “Prior art is not limited to the references being applied, but includes the understanding of one of ordinary skill in the art. See MPEP 2141. Factors to consider in determining level of ordinary skill.
With respect to the limitation “polymerized phenylboronic acid coated on the aptamer through ATP as a mediator’, the claimed invention is directed to a product and not a method of making the product. Thus, the limitation does not have patentable weight over any method of coating the aptamer with polymerized PBA because absence evidence of the contrary, any method of coating the aptamer with polymerized PBA would result in the same structure. Where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971). Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
The pre-amble and limitation “active ingredient” in instant claims 12-14 are directed to an intended use of the claimed product and do not have patentable weight over the nanoconstruct made obvious by Kim taken with Davis and Cai because the limitations do not add any additional structural limitations to the claimed product.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 3-5 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Biomaterials 75 (2016) 102-111) taken with Davis (US 20140249202) and Cai et al. (Nanotechnology, Science and Applications I: 17-32, 2008) as applied to claims 1, 2, and 11-14 above, and further in view of Kim et al. (WO 2018084562 in Japanese, see English translation U.S. Patent No. 11236343, NOTE’ ‘343 is an issued U.S. Patent based on the international published as WO 2018084562).
Kim, Davis and Cai do not specifically teach the aptamer is a single stranded DNA VEGF aptamer and an aptamer for ATP.
However, DNA aptamers are short single stranded oligonucleotides (columns 1, 2, and 15-16 of ‘343). VEGF DNA aptamers and ATP DNA aptamers were known in the prior art for treating cancer as taught by ‘343 (See columns 1, 2, and 15-16).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Kim taken with Davis and Cai in further view of ‘343 to use a VEGF DNA aptamer with an ATP DNA aptamer in the nanoconstruct, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to study cancer therapy using the nanoconstruct since targeting ATP can reduce ATP concentration in the cancer cells by reducing ATP available to the cells or assist in regulating the aptamer being released in the cancer cells. See MPEP 2143(I)E. ATP concentration is higher in cancer cells compared to non-cancerous cells. In addition, VEGF DNA aptamers can be used to treat cancer in a patient having cancer, it would have been obvious to attach either aptamer in addition to the ATP aptamer to the nanoparticle. Furthermore, it would have been obvious to add an ATP DNA aptamer to the first aptamer to observe an additive effect for treating cancer or regulating the release of the VEGF aptamer in the cancer cells.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Biomaterials 75 (2016) 102-111) taken with Davis (US 20140249202) and Cai et al. (Nanotechnology, Science and Applications I: 17-32, 2008) and Kim et al. (WO 2018084562, see English translation U.S. Patent No. 11236343, NOTE’ ‘343 is an issued U.S. Patent based on the international published as WO 2018084562) as applied to claims 3-5 and 7 above, and further in view of Zhang et al. (US 20170137389)
Kim, Davis, Cai and ‘343 do not specifically teach the aptamer is a single stranded DNA having a TNF-α aptamer and an aptamer for ATP.
However, DNA aptamers targeting VEGF or TNF-alpha were well known in the prior art as exemplified by Zhang (page 12).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Kim taken with Davis and Cai and ‘343 in further view of Zhang to use either a VEGF DNA aptamer or TNF-alpha DNA aptamer with an ATP DNA aptamer in the nanoconstruct, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to study cancer therapy using the nanoconstruct since targeting ATP can reduce ATP concentration in the cancer cells by reducing ATP available to the cells or assist in regulating the aptamer being released in the cancer cells. See MPEP 2143(I)E. ATP concentration is higher in cancer cells compared to non-cancerous cells. In addition, VEGF DNA aptamers and TNF-alpha DNA aptamers can be used to treat cancer in a patient having cancer, it would have been obvious to attach either aptamer in addition to the ATP aptamer to the nanoparticle. Furthermore, it would have been obvious to add an ATP DNA aptamer to the first aptamer to observe an additive effect for treating cancer or regulating the release of the VEGF or TNF-alpha aptamer in the cancer cells.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Appl. Matter Interfaces 13, 9390-9401 and Supporting Information, pages 1-12, published on 11/6/20) as applied to claims 1-6, 8, and 11-14 and in further view of Zhang et al. (US 20170137389).
Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216.
Kim does not specifically teach the aptamer is a single stranded DNA having a VEGF aptamer and an aptamer for ATP.
However, DNA aptamers targeting VEGF or TNF-alpha were well known in the prior art as exemplified by Zhang (page 12).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Kim taken with Zhang to use either a either a VEGF aptamer or a TNF-alpha DNA aptamer with an ATP DNA aptamer in the nanoconstruct, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to study cancer therapy using the nanoconstruct since targeting ATP can reduce ATP concentration in the cancer cells by reducing ATP available to the cells or assist in regulating the aptamer being released in the cancer cells. See MPEP 2143(I)E. ATP concentration is higher in cancer cells compared to non-cancerous cells. In addition, VEGF DNA aptamers and TNF-alpha DNA aptamers can be used to treat cancer in a patient having cancer, it would have been obvious to attach either aptamer in addition to the ATP aptamer to the nanoparticle. Furthermore, it would have been obvious to add an ATP DNA aptamer to the first aptamer to observe an additive effect for treating cancer or regulating the release of the VEGF or TNF-alpha aptamer in the cancer cells.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 10 is rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Appl. Matter Interfaces 13, 9390-9401 and Supporting Information, pages 1-12, published on 11/6/20) as applied to claims 1-6, 8-9, and 11-14 and in further view of Kim et al. (WO 2018084562, see English translation U.S. Patent No. 11236343, NOTE’ ‘343 is an issued U.S. Patent based on the international published as WO 2018084562).
Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216.
Kim et al. teach a DNA sequence comprising an ATP aptamer and a TNF-alpha aptamer. The term “a sequence of SEQ ID NO: 2” reads on one sequence of SEQ ID NO: 2.
PNG
media_image1.png
138
605
media_image1.png
Greyscale
Kim et al. do not specifically teach the aptamer comprising SEQ ID NO: 2.
NOTE: Instant SEQ ID NO: 2 (Qy) comprises the thiol VEGF aptamer sequence in place of the thiol TNF-alpha aptamer in the DNA sequence taught by Kim et al.
However, ‘343 teaches a thiol VEGF aptamer comprising the nucleotide sequence. See SEQ ID NO: 3 (Db). VEGF DNA aptamers and ATP DNA aptamers were known in the prior art for treating cancer as taught by ‘343 (See columns 1, 2, and 15-16).
Qy 30 TTTTCCCGTCTTCCAGACAAGAGTGCAGGG 59
||||||||||||||||||||||||||||||
Db 1 TTTTCCCGTCTTCCAGACAAGAGTGCAGGG 30
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to try a simple substitution of replacing the TNF-alpha aptamer in the DNA sequence taught by Kim et al. with the sequence for the VEGF aptamer comprising SEQ ID NO: 3 taught by ‘343 to make the nanoconstruct. One of ordinary skill in the art would have been motivated to combine the teaching to study cancer therapy using the nanoconstruct since targeting ATP can reduce ATP concentration in the cancer cells by reducing ATP available to the cells or assist in regulating the aptamer being released in the cancer cells. See MPEP 2143(I)E. In addition, since VEGF and TNF-alpha aptamers can both be used to treat cancer, it would have been obvious to one of ordinary skill in the art to use either aptamer with the ATP aptamer to treat cancer.
Therefore, the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Allowable Subject Matter
The prior art rejections for claims 8-10 are based on Kim et al. (Appl. Matter Interfaces 13, 9390-9401 and Supporting Information, pages 1-12, published on 11/6/20), which is a 102(a)(1) reference. The 102(a)(1) reference can be overcome by applicant filing a certified English translation of the foreign priority document. If applicant does this, then claims 8-10 are free of the prior art of record. Other than Kim et al., the prior art does not teach or suggest an aptamer comprising SEQ ID NO: 1 or 2.
The closest prior art for instant SEQ ID NO: 1 is SEQ ID NO: 10 (Db) taught by Soh et al. (US 20210355496). Soh teaches nucleotides 1-33 of instant SEQ ID NO: 1, but does not teach or suggest making nucleotides 34-60 to arrive at instant SEQ ID NO: 1 (Qy).
PNG
media_image2.png
101
493
media_image2.png
Greyscale
The closest prior art for instant SEQ ID NO: 2 is Kim (US 11236343), which was cited in a 103 rejection. Kim teaches nucleotides 30-59 of instant SEQ ID NO: 2, but does not teach or suggest making nucleotides 1-29 and adding nucleotide 60 of the SEQ ID NO: 2 to arrive at instant SEQ ID NO: 2
Conclusion
See attached PTO-326 for disposition of claims.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Wang (US 9096856) make and use aptamers containing boronic acid groups, but does not teach or suggest making a nanoconstruct comprising a gold nanoparticle, wherein an aptamer is conjugated to the nanoparticle and the aptamer is coated with polymerized phenylboronic acid.
Kataoka et al. (US 20150051347) teach a block copolymer having phenylboronic acid group.
Jiang et al. (Microchim Acta (2017) 184:4305-4312) disclose that the boronic acid in the presence of ATP binds to the 2’, 3’-hydroxy group of ATP to form a stable boronate ester.
Matsumoto et al. (Polymer Journal 46, 483-491, 2014) is directed to a review of phenylboronate-functionalized polymers for diagnostic and therapeutic applications.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636