The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s election of Group II, claims 14-22, to SEQ ID NO: 28, in the reply filed on December 19, 2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Applicants’ remarks regarding rejoinder of the Group III method claims are acknowledged.
Claims 1-13, 23-36 have been currently withdrawn from consideration by the examiner because they are drawn to non-elected inventions. Claims 19-21 are also currently withdrawn from consideration because they do not read on the elected SEQ ID NO: 28. Claims 14-18, 22, to SEQ ID NO: 28, are under consideration.
Priority: This application is a 371 of PCT/US2021/045184, filed August 9, 2021, which claims benefit of provisional application 63/063689, filed August 10, 2020.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 22 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 22 recites the biological vector comprises a nucleotide sequence having greater than 80% identity to SEQ ID NO: 28. It is not clear whether identity is referring to sequence identity or some other type of identity or characteristic. Further clarification and/or correction is requested.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 14-16, 18 are rejected under 35 U.S.C. 103 as being unpatentable over Merkx et al. (WO 2019164402; IDS 03.20.24). Merkx et al. disclose split luciferase is an effective tool for examination of protein interactions and detection of analytes both in vitro and in vivo (p. 4 lines 8-9). Merkx et al. disclose NanoLuc (an engineered luciferase derived from a deep-sea shrimp) is split into two fragments, an 18 kDa large bit (LBit) and a 1.3 kDa small bit (SBit) for the study of protein interactions (p. 4 lines 12-15). Merkx et al. disclose a protein construct comprising a linker where a first end of the linker is fused to one terminus of a first luciferase domain via a first binding domain and the second end of the linker is fused to a second luciferase domain via a second binding domain and a third luciferase domain fused to the other terminus of the first luciferase domain via a spacer (at least p. 4-5). Merkx et al. disclose the spacer is a polypeptide and may include at least four, six, eight, or at least ten GGS repeats (at least p. 7). Merkx et al. disclose the binding domains are any kind of binding domain, where both binding domains comprise epitopes, where epitopes refer to a polypeptide which bind to the antigen-binding site of an antibody (p. 8). Merkx et al. disclose a protein construct comprising at least the components SBit-linker-LBit-epitope-linker-epitope-SBit (at least p. 23 lines 4-10, Fig. 1A, 1B). Therefore, Merkx et al. can be deemed to disclose a protein construct comprising a polypeptide having a linker and region comprising LBit fused to a linker and a SBit. Merkx et al. disclose plasmids comprising nucleic acid sequences encoding the protein construct (at least p. 29).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to arrive at the claimed biological vector encoding a protein construct comprising a (target) polypeptide, a linker, a LBit (i.e. LgBiT) fragment, a linker, and a SBit (i.e. HiBiT) fragment because Merkx et al. disclose a protein construct comprising the same features and/or components recited and a vector encoding the protein construct (instant claim 14). One of ordinary skill would have a reasonable expectation of success because utilizing NanoLuc to make constructs comprising split luciferase fragments, linkers, and polypeptides was known and available in the prior art.
Regarding instant claim 15, since Merkx et al. disclose a plasmid, i.e. pET28a (p. 29), it would be obvious to one of ordinary skill that the plasmid comprises a promoter for driving expression in a cell, including a mammalian cell.
Regarding instant claim 16, since Merkx et al. disclose a plasmid, i.e. pET28a (p. 29), it would be obvious to one of ordinary skill that such a plasmid is reasonably a universal acceptor plasmid.
Regarding instant claim 18, Merkx et al. disclose the split luciferase or NanoBit technology can be utilized for applications, including viral entry and release (p. 4). Therefore, it would be obvious to one of ordinary skill that the carrier comprising the nucleic acid molecules encoding the protein construct can be a viral vector.
Claims 14-16, 17, 18 are rejected under 35 U.S.C. 103 as being unpatentable over Merkx et al. (WO 2019164402; IDS 03.20.24) in view of Martinez et al. (2018 Scientific Reports 8:9472, 16 pages; IDS 03.20.24). The teachings of Merkx et al. over at least instant claims 14-16, 18 are noted above.
Regarding instant claim 17, Martinez et al. disclose pcDNA3.1-based vectors are suitable for assays using split Nano luciferase (p. 1, 12). Therefore, it would have been obvious to one of ordinary skill before the effective filing date of the claimed invention to incorporate the pcDNA3.1-based vector disclosed in Martinez et al. for the plasmid comprising nucleic acid molecules encoding the protein construct of Merkx et al. noted above. One of ordinary skill would have reasonable expectation of success because the pcDNA3.1-based vector of Martinez et al. would have the same purpose as the plasmids of Martinez et al., for encoding a protein construct comprising the NanoLuc fragments, linker, and polypeptide.
Claims 14-16, 18, 22 are rejected under 35 U.S.C. 103 as being unpatentable over Merkx et al. (WO 2019164402; IDS 03.20.24) in view of Hall et al. (WO 2019241438). The teachings of Merkx et al. over at least instant claims 14-16, 18 are noted above.
Regarding instant claim 22, Hall et al. disclose compositions for assembly of a tripartite or multipartite luciferase and/or bioluminescent complex (p. 1). Hall et al. disclose exemplary peptide and polypeptide sequences, including NanoLuc, LgBit, and SmBit (at least Table 1). Hall et al. disclose SEQ ID NO: 12 (encoding a LgBit), which has 85.8% sequence identity and 100% local similarity with instant SEQ ID NO: 28 (see appendix 1). Therefore, it would have been obvious to one of ordinary skill before the effective filing date of the claimed invention to incorporate the nucleic sequence SEQ ID NO: 12 encoding a LgBit of Hall et al. in the plasmid comprising nucleic acid molecules encoding the protein construct of Merkx et al. including a LgBit fragment noted above. One of ordinary skill would have a reasonable expectation of success because split luciferase fragments, linkers, and polypeptides were known and available in the prior art.
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Marsha Tsay whose telephone number is (571)272-2938. The examiner can normally be reached M-F.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath N. Rao can be reached at 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Marsha Tsay/Primary Examiner, Art Unit 1656
Appendix 1
DE Recombinant luciferase beta-1-9-like peptide construct DNA LgBit, SEQ 12.
XX
KW LUC gene; coding sequence; ds; luciferase; luminescence;
KW protein detection; protein interaction; protein localization;
KW recombinant protein.
XX
OS Synthetic.
OS Unidentified.
XX
CC PN WO2019241438-A2.
XX
CC PD 19-DEC-2019.
XX
CC PF 12-JUN-2019; 2019WO-US036844.
XX
PR 12-JUN-2018; 2018US-0684014P.
XX
CC PA (PRMG ) PROMEGA CORP.
XX
CC PI Hall M, Encell LP, Killoran M, Wood K, Smith T, Kincaid V;
CC PI Kirkland T, Dart M;
XX
CC PT New peptide useful in composition for detecting interaction between first
CC PT molecular entity and second molecular entity, or detecting interaction
CC PT between first protein or peptide entity and second protein or peptide
CC PT entity with cell.
XX
CC PS Disclosure; SEQ ID NO 12; 478pp; English.
XX
CC The present invention relates to a novel peptide, useful in preparing a
CC composition for detecting the interaction between first molecular entity
CC and second molecular entity. The peptide comprises amino acid sequences
CC of SEQ ID NOs: 6, 9, 23 and 29 (see BHB40004, BHB40007, BHB40021 and
CC BHB40027), wherein a bioluminescent signal produced in the presence of a
CC coelenterazine or its analog substrate is substantially increased when
CC the peptide contacts a second peptide of SEQ ID NO: 25 (see BHB40023) and
CC a polypeptide complement of SEQ ID NO: 17 (see BHB40015) when compared to
CC a bioluminescent signal produced by the peptide and the coelenterazine
CC substrate alone. The invention also provides: a nucleic acid sequence
CC encoding the peptide; a fusion polypeptide comprising the peptide and an
CC additional amino acid sequence; a nucleic acid sequence encoding the
CC fusion polypeptide; a composition comprising the nucleic acid sequence; a
CC bioluminescent complex comprising (a) a polypeptide of SEQ ID NOs: 5, 8,
CC 17, 21 or 302 (see BHB40003, BHB40006, BHB40015, BHB40019 or BHB40282),
CC (b) a first peptide of SEQ ID NOs: 6, 9, or 23 (see BHB40004, BHB40007 or
CC BHB40021), and (c) a second peptide of SEQ ID NOs: 7, 10 or 25 (see
CC BHB40005, BHB40008 or BHB40023); a method for (a) combining a first and
CC second peptide, a polypeptide component, and coelenterazine or its analog
CC substrate, and (b) detecting the luminescence; a method for detecting an
CC interaction between a first molecular entity and a second molecular
CC entity; a method for detecting an interaction between the first protein
CC or peptide entity and the second protein or peptide entity with a cell; a
CC method for detecting co-localization of a first molecular entity and a
CC second molecular entity; a method for detecting the co-localization of
CC the first protein or peptide entity and the second protein or peptide
CC entity with a cell; a kit comprising a first binding moiety and a second
CC binding moiety; a method for detecting a target molecule; a method for
CC detecting a target molecule; a beta-9/beta-10-like dipeptide comprising
CC an amino acid sequence of SEQ ID NO: 17, 21, 35, 205, 206, or 302 (see
CC BHB40015, BHB40019, BHB40031, BHB40185, BHB40186 or BHB40282); a method
CC for performing a competition assay for detecting an interaction between
CC the first molecular entity and the second molecular entity; and a system
CC or kit comprising the polypeptide and one or more complementary peptides,
CC dipeptides, and/or tripeptide. Note: SEQ ID NO: 33 is mentioned in page
CC 134 but the sequence is not shown in the patent.
XX
SQ Sequence 495 BP; 127 A; 135 C; 128 G; 105 T; 0 U; 0 Other;
Query Match 85.8%; Score 476; Length 495;
Best Local Similarity 100.0%;
Matches 476; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGGAACAGACAGCCGCCTACAACCTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGGAACAGACAGCCGCCTACAACCTG 60
Qy 61 GACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGCTGCAGAATCTCGCCGTGTCCGTA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGCTGCAGAATCTCGCCGTGTCCGTA 120
Qy 121 ACTCCGATCCAAAGGATTGTCCGGAGCGGTGAAAATGCCCTGAAGATCGACATCCATGTC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 ACTCCGATCCAAAGGATTGTCCGGAGCGGTGAAAATGCCCTGAAGATCGACATCCATGTC 180
Qy 181 ATCATCCCGTATGAAGGTCTGAGCGCCGACCAAATGGCCCAGATCGAAGAGGTGTTTAAG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 ATCATCCCGTATGAAGGTCTGAGCGCCGACCAAATGGCCCAGATCGAAGAGGTGTTTAAG 240
Qy 241 GTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCCCTATGGCACACTGGTA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 GTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCCCTATGGCACACTGGTA 300
Qy 301 ATCGACGGGGTTACGCCGAACATGCTGAACTATTTCGGACGGCCGTATGAAGGCATCGCC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 ATCGACGGGGTTACGCCGAACATGCTGAACTATTTCGGACGGCCGTATGAAGGCATCGCC 360
Qy 361 GTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 GTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATC 420
Qy 421 GACGAGCGCCTGATCACCCCCGACGGCTCCATGCTGTTCCGAGTAACCATCAACAG 476
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 GACGAGCGCCTGATCACCCCCGACGGCTCCATGCTGTTCCGAGTAACCATCAACAG 476