Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Acknowledgement is hereby made of receipt and entry of the communication filed on Jan. 5, 2026. Claims 1-6, 10-14, 16, 19-25 and 27 are pending. Claims 1-6, 10-14, 16 and 19-22 are withdrawn. Claims 23-25 and 27 are currently examined.
Election/Restrictions
Applicant's election without traverse of Group II (Claims 23-25 and 27), directed to a composition comprising forward and reverse primers, in the reply filed on Jan. 5, 2026, is acknowledged.
Claims 1-6, 10-14, 16 and 19-22 are withdrawn as being directed to a nonelected Group of invention.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 25 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 25 specifies a composition comprising a forward primer and a reverse primer comprising a nucleotide sequence having at least 90% identity respectively to SEQ ID NO: 1 and SEQ ID NO: 2……” This claim recites SEQ ID NOs: 1-60 altogether, with the conjunction word “and”. It is not clear how to correlate the forward and reverse primers “respectively” to the recited sequences.
It appears that the claims are intended to specify pairs of primer sequences each comprising a forward primer and a reverse primer comprising a pair of sequences (e.g., SEQ ID NO: 1 and SEQ ID NO: 2), with the first sequence in the pair as forward primer and the second as reverse primer. Applicant is required to clarify.
If the above interpretation is true, Applicant may consider using a Markush format and specify pairs of primers.
Claim Rejections - 35 USC § 101
35 U.S.C. §101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 23-24 are rejected under 35 U.S.C. §101 because the claimed invention is directed to non-statutory matter. The instant claims are directed to a naturally-occurring nucleic acid sequence or fragment thereof, whether isolated or not, that is not patent-eligible pursuant to the Supreme Court decision in Association for Molecular Pathology v. Myriad Genetics, Inc., 56 U.S. ____, 133 S. Ct. 2107, 2116, 106 USPQ2d 1972 (June 13, 2013) (Myriad), which expresses the Supreme Court’s long-standing “rule against patents on naturally occurring things” as in its earlier precedent including Diamond v. Chakrabarty, 447 U.S. 303 (1980) (Charkrabarty) and Mayo Collaborative Services v. Prometheus Laboratories, Inc., 566 U.S. ___, 132 S. Ct. 1289, 101 USPQ2d 1961 (2012) (Myriad). While the holding in Myriad was limited to nucleic acids, Myriad is a reminder that claims reciting or involving natural products should be examined for a marked difference under Chakrabarty.
The claimed invention is directed to “A composition comprising: (a) a forward primer comprising, from 5' to 3', a nucleic acid sequence encoding a ribosome binding site (RBS), a start codon, and a nucleic acid sequence of a first portion of a target nucleic acid sequence; and (b) a reverse primer comprising, from 5' to 3', a reverse complement of a stop codon in-frame with the reverse complement of the sequence encoding a first peptide reporter in frame with a nucleic acid sequence complementary to a second portion of the target nucleic acid sequence.”
The claims recite the limitation of “a target nucleic acid sequence”, which appears to read on a generic nucleic acid sequence encoding a polypeptide linked in-frame with “the sequence encoding a first peptide reporter”. However, the claims do not specify that the target nucleic acid sequence and the nucleic acid sequence encoding the first peptide reporter are from different genes. The specification does not clearly define the term “peptide reporter”. Therefore, it reads on any polypeptide that can be used as a reporter, e.g., a naturally occurring lacZ peptide, a luciferase peptide, or any C-terminus of a naturally occurring protein that can be detected by a process (e.g., a C-terminus that contains a B-cell epitope which can be detected by an antibody). Therefore, the primer sequences in these claims read on two nucleotide sequences existing in naturally occurring genome sequences, i.e., the claimed forward primer correlates to a naturally occurring region of sequence of a gene comprising a 5’- region (i.e., a control sequence, a start codon and a 5’ coding region of the gene), and the reverse primer correlates to a naturally occurring region at the 3’ end of the gene.
Accordingly, claims 23-24 do not qualify as eligible subject matter.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 23-24 and 27 are rejected under 35 U.S.C. 103 as being unpatentable over Feng et al. (Nature Communications, volume 8, Article number: 370 (2017)) and Protocol Online ("PCR primers for introducing tag"; https://www.protocol-online.org/biology-forums/posts/39765.html# Dated 2008).
These claims are directed to a composition comprising: (a) a forward primer comprising, from 5' to 3', a nucleic acid sequence encoding a ribosome binding site (RBS), a start codon, and a nucleic acid sequence of a first portion of a target nucleic acid sequence; and (b) a reverse primer comprising, from 5' to 3', a reverse complement of a stop codon in-frame with the reverse complement of the sequence encoding a first peptide reporter in frame with a nucleic acid sequence complementary to a second portion of the target nucleic acid sequence.
As indicated in the 101 rejection above, the claimed forward and reverse primers encompass sequences at the 5’ and the 3’ sequences of a naturally occurring gene, respectively. Here, to expediate examination, the claims are examined for forward and reverse primers that are potentially useful for PCR construction of a fusion protein expression cassette containing, from 5’ to 3’, a ribosome binding site (RBS), a start codon, a coding sequence of the fusion protein (i.e. the polypeptide sequence encoded by the “target nucleic acid sequence” fused to “the first peptide reporter” sequence (e.g., a C-terminal tag)), and a stop codon.
Feng teaches a study wherein the authors have demonstrated dual-color endogenous protein tagging with sfCherry211 and GFP11, revealing that endoplasmic reticulum translocon complex Sec61B has reduced abundance in certain peripheral tubules. These new split FPs not only offer multiple colors for imaging interaction networks of endogenous proteins, but also hold the potential to provide orthogonal handles for biochemical isolation of native protein complexes. See Abstract.
Fig. 1a of Feng shows schematically a construct of a cassette for expression of a fusion protein, comprising a promoter sequence (T7), a sequence region encoding a FP1-10 and a 32aa spacer (reading on the first protein sequence described above), and a sequence encoding FP11 (reading on the C-terminal tag described above). See below:
PNG
media_image1.png
378
650
media_image1.png
Greyscale
Feng further teaches that to test sfCherry211 as a fluorescent tag for live-cell imaging, the authors constructed mammalian expression vectors encoding target proteins tagged with sfCherry211 at either the N or C terminus and co-expressed each with cytoplasmic sfCherry21–10 in HeLa cells (Fig. 3b–i). See para bridging pages 5 and 6.
Feng teaches that the DNAs of mNG211 and sfCherry211 were PCR amplified from identified pET28a constructs (final mutants) using Phusion High-Fidelity DNA Polymerase. The DNAs of histone H2B, clathrin light chain A, keratin, β-actin, zyxin, heterochromatin protein 1, TOMM20, vimentin, laminB, mIFP were subcloned from mEmerald, sfGFP or mIFP fusion plasmids. The P2A sequence used for all mIFP constructs are GCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGG AGAACCCTGGACCT. They performed the following restriction enzyme digestion (amino acid linker length shown in parentheses for each): histone H2B (10 a.a.): sfGFP
sequence between AgeI and BglII (sfGFP-H2B-C-10); clathrin light chain A (15 a.a.): mEmerald sequence between AgeI and BglII (mEmerald-Clathrin-15); keratin (18 a.a): mEmerald sequence between BamHI and NotI (mEmerald- Keratin14-N-18); b-actin (18 a.a.): mEmerald sequence between AgeI and BglII (mEmerald-Actin-C-18); zyxin (6 a.a.): sfGFP sequence between BamHI and NotI (sfGFP-Zyxin-6); TOMM20 (20 a.a.): mEmerald sequence between BamHI and NotI (mEmerald-TOMM20-N-10); vimentin (9 a.a.): mEmerald sequence between BamHI and NotI (mEmerald-Vimentin-N-18); laminB (10 a.a.): mEmerald sequence between AgeI and BglII (mEmerald-LaminB1-10). PCR amplified mNG211 and sfCherry211 were then ligated with the digested vectors using In-Fusion HD Cloning kit (Clontech). For the mammalian expression and lentiviral production, DNAs of mNG21–10 or sfCherry21–10 were directly PCR amplified from identified pET28a constructs (final mutants) and cloned into pcDNA3.1 vectors (HindIII/BamHI) as well as lentiviral pHR-SFFV vector (BamHI/NotI). See page 9, left column, para 4.
Accordingly, Feng teaches a study involving cassettes for expression of fusion proteins, e.g., a fusion protein comprising a host protein and a fluorescent tag (sfCherry211) fused to the C-terminus of the host protein. Feng further teaches using PCR amplification and restriction enzymes in the production of the fusion protein expression constructs. However, Feng does not teach or suggest using primers with the claimed features.
Protocol Online shows an internet publication of question and answers about using primers for introducing tag. The question was about how to introduce HA tags right before the gene or right after the gene of interest by PCR. The answer was: “It’s really easy! The HA tag is about 27-30 bp, isn’t it? Just order longer oligos then. Forward primer: 5’ (3random bp)-(restriction enzyme site)-(HA tag)-(start of your gene (20-30bp)); Reverse primer: 3’-(end of gene)-(HA tag)-(RE site)-(3 random bp)-. After the PCR cut the product with restriction enzymes and paste in the place of your unmodified gene. Usually the region, complementary to the gene is around 23-26bp. You can add your Kozak in front of the HA tag. Take care of the START and STOP codons if you want the tags to be translated. I do it like this all the time. I have added tags as long as 60bp with primers. In such a case I just ordered a 85bp oligo (HPLC purified) and no problem. I usually use Pfu for such PCR.”
These teachings indicate that it was known and commonly practiced at the time of invention in the field of biotech studies to introduce desired sequence features into a gene construct via primer sequences.
It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to combine the teachings of Feng and Protocol Online to arrive at the invention as claimed. One would have been motivated to do so to include sequence elements known to facilitate gene expression, such as a promoter sequence, a ribosome binding site (RBS), Kozak sequence, start codon, stop codon, and a sequence encoding a tag peptide, etc., in the sequences of forward and reverse primers designed for PCR amplification of a gene expression cassette for the construction of fusion protein disclosed in the study of Feng, so that all of the desired sequence features can be introduced in one PCR reaction.
Regarding claim 27, the recited reagents are generic and routine for PCR reactions and well as reporter analysis in the studies of Feng. It would have been obvious to those of ordinary skill in the art to produce a kit by combining the known ingredients with instructions for use as recited in the claims for the purpose of shipping and handling and/or commercialization. The combination of the known elements would have predictable results to one of ordinary skill in the art since all the claimed elements would continue to operate in the same manner that is no more than the predictable use of prior-art elements according to their established functions. Where the only difference between a prior art product and a claimed product is printed matter that is not functionally related to the product, the content of the printed matter will not distinguish the claimed product from the prior art. In re Ngai, 367 F.3d 1336, 1339, 70 USPQ2d 1862, 1864 (Fed. Cir. 2004). See MPEP 2112.01 III.
Conclusion
No claims are allowable.
Claim 25 contains allowable subject matter.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to NIANXIANG (NICK) ZOU whose telephone number is (571)272-2850. The examiner can normally be reached on Monday - Friday, 8:30 am - 5:00 pm, EST. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, MICHAEL ALLEN, on (571) 270-3497, can be reached. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/NIANXIANG ZOU/
Primary Examiner, Art Unit 1671