DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1, 4-13, 15-20 and 28 are pending.
Claims 18-20 and 28 are withdrawn from examination as being part of non-elected inventions.
Claims 1, 4-13 and 15-17 are being examined.
All previous objections and rejections not set forth below have been withdrawn in view of applicant’s amendments to the claims.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 15-16 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. This is a new rejection necessitated by the claim amendments.
Claim 15 depends on claim 1 and recites, “… the target RNA or DNA is prokaryotic or eukaryotic.” Claim 15 does not further restrict (amended) claim 1, because claim 1 is directed to bacterial (i.e., prokaryotic) target.
Similarly, claim 16 also depends on claim 1 and recites, “… the target RNA or DNA comprises a nucleic acid associated with gene expression in the insect, the insect microbiome, or a pathogen harbored therein.” Claim 16 also does not further restrict (amended) claim 1.
Applicant may cancel the claims, amend the claims to place the claims in proper dependent form, rewrite the claims in independent form, or present a sufficient showing that the dependent claims complies with the statutory requirements.
Claim Rejections - 35 USC § 103
Claims 1, 4 and 7-13 and 15-17 are rejected under 35 U.S.C. 103 as being unpatentable over Hunter et al. (b) (Emerging RNA Suppression Technologies to Protect Citrus Trees From Citrus Greening Disease Bacteria, 2018, Advances in Insect Physiology, 55:163-199) in view of Hunter et al. (a) (Antisense oligonucleotides, FANA, for treatment of microbes and arthropod pests of agricultural and medical importance. W069, 2018, in Plant & Animal Genome XXVI Conference, San Diego, CA) and in evidence of Sun et al. (Citrus Genetic Engineering for Disease Resistance: Past, Present and Future, 2019, International Journal of Molecular Sciences, 20:5256), Damha et al. (US 9902953 B2, published in 2018), and Horn et al. (Design and evaluation of genome-wide libraries for RNA interference screens, 2010, Genome Biology, 11:R61).
Amended claim 1 is drawn to a method of decreasing target RNA or DNA expression in a plant-chewing or piercing-sucking plant-feeding insect using an antisense oligonucleotide to the insect or a member of its microbiome, wherein the oligonucleotide comprises at least one 2'-deoxy-2'-fluoroarabinonucleotide (2'F-ANA)-modified nucleotide and at least one 2'-deoxyribonucleotide wherein the target RNA comprises bacterial RNA encoding DNA gyrase subunit A from Candidatus Liberibacter asiaticus (CLs) or Candidatus Liberibacter solanacearum (CLso).
The Applicant describes that FANA (2'-Deoxy-2'-Fluoro-o-D-Arabinonucleic Acid) antisense oligonucleotides (ASO) are nucleic acids with a phosphorothioate backbone with modified flanking nucleotides in which the 2'-OH group of the ribose sugar is substituted by a fluorine atom. The modifications in the flanking nucleotides increase the resistance of the ASOs to degradation and enhance binding to targeted mRNA(s). The FANA/RNA duplex is recognized by ribonuclease H (RNase H), an enzyme that catalyzes the degradation of duplexed mRNA (Spec, page 3, para 0009).
Hunter et al.(b) teaches that Asian citrus psyllid (ACP), Diaphorina citri (as recited in claim 4) is a vascular/phloem feeding (as recited in claims 7 and 9) insect and the most economically important pest of citrus (as recited in claim 10) including orange (as recited in claim 11) (page 172, para 1, last 2 lines, Fig. 2) because of its status as the main psyllid vector of the bacteria associated with citrus greening or Huanglongbing (HLB) (page 165, last para, line 20-23). One of the three endosymbiotic bacteria in ACP is a Liberibacter species, Candidatus Liberibacter asiaticus (CLas or Las), as recited in claim 1 (page 165, last para, line 24-26). Hunter et al.(b) also describes methods to reduce Asian citrus psyllid (ACP) infection by suppressing another endosymbiont (one of the three, as mentioned above), Wolbachia-Diaphorina, wDi, by using Morpholino-based bactericides, PPMOs (page 178, last para, line 1-5; page 179, para 1, line 7-9). PPMOs are synthetic and stable molecules (with no reported enzyme able to degrade it) (page 177, last para, last 3 lines) that mimic DNA/RNA with a different sugar-phosphate backbone allowing them to bind target RNA. Hunter et al.(b) teaches silencing or inactivating prokaryotic (as recited in claim 15) bacterial DNA gyrase A, including wDi gyrase A, using PPMOs (page 179, para 1, line 1-9).
Hunter et al.(b) teaches ingestion (reads on to feeding plant parts like leaves, roots flower and/or fruit) of non-canonical nucleosides (dsRNA) by the psyllid (Asian citrus psyllid, ACP), as recited in claims 7-8, overcome the problems with normal or canonical dsRNA molecules applied as topical sprays on when orally ingested by the insect pest (page 171, para 2, last 3 lines; page 172, last para, first 2 lines; page 175, para 2, first 2 lines). Besides citrus, the method is equally effective in various plants including Solanaceous plants like potato and tomato, as recited in claim 12 (page 180, para 1, line 2-3). Hunter et al.(b) describes foliar spray and soil applied solution (treatments) (as recited in claim 13) of oligonucleotide (dsRNA) to reduce ACP by significantly suppressing target gene expression by targeting specific mRNAs via RNAi (page 177, para 1, last 5 lines) in the insect pest and/or at least one of its endosymbionts (as recited in claim 16).
Hunter et al.(b) describes both canonical and noncanonical oligonucleotides to knockdown specific gene(s) in a bacterium (page 173, last para; page 173, para 2) using dsRNA and RNAi (page 170, para 3). Use of Noncanonical oligonucleotides resulted in significant increase in ACP mortality compared to equivalent canonical (traditional) oligonucleotides (page 173, para 1, line 1-6). Hunter et al.(b) does not explicitly describe the noncanonical oligonucleotides, although noncanonical oligonucleotides are known in the art (before the effective filing date of the invention) to include FANA-ASO (Sun et al.; page 9, para 3, line 9-12).
However, Hunter et al.(b) does not explicitly describe a 2'-deoxyribonucleotide targeting bacterial RNA encoding DNA gyrase subunit A from Candidatus Liberibacter asiaticus (CLas).
Hunter et al.(a) describes sequence specific gene silencing (i.e., decreasing target RNA or DNA expression) using sequence specific antisense FANA oligonucleotides, FANA-ASO [(2'-deoxy-2'-fluoro-D- arabinonucleic acid)-(antisense oligonucleotides)] to reduce insect endosymbiont bacterial pathogens in woody fruit crops, as well as suppressing mRNA expression in arthropod vectors (i.e., providing an antisense oligonucleotide to the insect or a member of its microbiome) (abstract). Hunter et al.(a) teaches that FANA-ASO is a useful plant-derived treatment to reduce plant pathogens and insect pests in fruit trees and other crops (last 2 lines).
The inherent property including the chemistry and construction of FANA oligonucleotide comprising at least one 2'-deoxy-2'-fluoroarabinonucleotide (2' FANA) and at least one 2'-deoxyribonucleotide to reduce/silence endogenous gene expression is known in the art (Damha et al., column 3, line 50-65; column 4, line 1-12).
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to modify the method to silence/inhibit the expression of target gene(s) in an insect endosymbiont bacterial pathogen, as described by Hunter et al.(a), in the ACP endosymbiont bacteria Candidatus Liberibacter asiaticus (CLas), by targeting the DNA gyrase subunit A (DNA gyrase A) of CLas, by targeting its mRNA transcript using non-canonical oligonucleotide, as described by Hunter et al. (b), using more effective gene silencing method comprising FANA-ASO, as taught by Hunter et al (a).
Before the effective filing date, an ordinarily skilled artisan would have been motivated to use FANA-ASO to silence/inhibit a bacterial DNA gyrase A by targeting its mRNA transcript in the bacteria Candidatus Liberibacter asiaticus (CLas), with a realistic goal to address the commercially devastating citrus greening or Huanglongbing (HLB) disease in citrus plants.
Regarding claim 17, Designing suitable oligonucleotides for RNAi based gene silencing comprise more than 80% or 99% sequence identity to the complementary sequence to the target sequence, is a well-known and standard practice in the art and also routinely used by publicly available software programs (e.g., NEXT-RNAi) to design such oligonucleotides (Horn et al.; abstract). Horn et al. teaches that 100% sequence identity or an imperfect/partial sequence identity (of at least 1 mismatch for a 19 nucleotide long target site, i.e., 94%, is very effective to silence 90.7% of the target genes (p.5, right column, para 2, line 10-13).
Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Hunter et al. (b) in view of Hunter et al.(a) as applied to claims 1, 4, 7-13 and 15-17 above, and further in view of Xu et al. (CN109706255 A, published in 2019).
Claim 5 depends from claim 1 and is drawn to instant SEQ ID NO: 13.
Hunter et al.(b) in view of Hunter (a) describe a method of decreasing expression of a target gene (DNA gyrase A) in an insect endosymbiont bacterial pathogen (CLas) in woody fruit crops (citrus) by using FANA-ASO, as discussed above. Hunter et al.(b) describes silencing or inactivating bacterial DNA gyrase A in bacterial species including Wolbachia-Diaphorina, wDi (page 179, para 1, line 2-9), one of the bacteria (endosymbiont) in the psyllid, D. citri.
However, Hunter et al.(b) in view of Hunter (a) do not explicitly describe downregulating or silencing a gene consisting of SEQ ID NO: 13.
Xu et al. teaches a nucleotide sequence (SEQ ID NO: 9) of DNA gyrase, subunit A (gyrA) gene in Candidatus Liberibacter asiaticus (abstract). SEQ ID NO: 9 as described by Xu et al. is having 100% identity to instant SEQ ID NO: 13, as shown below.
RESULT 2
ID BGI60797 standard; DNA; 2733 BP.
AC BGI60797;
DT 11-JUL-2019 (first entry)
DE Candidatus Liberibacter asiaticus gyrA DNA, SEQ ID 9.
KW bacterial infection; crop plant pathogen; dna detection; ds; fluorescence; genetic marker; gyrA gene; microorganism detection; plant bacterial disease.
OS Candidatus Liberibacter asiaticus.
CC PN CN109706255-A.
CC PD 03-MAY-2019.
CC PF 18-JAN-2019; 2019CN-10104175.
PR 18-JAN-2019; 2019CN-10104175.
CC PA (USCG ) UNIV SOUTH CHINA AGRIC.
CC PI Xu M, Zheng Y, Zheng Z, Deng X;
DR WPI; 2019-42658D/50.
CC PT New internal reference gene combination useful in RTqPCR analysis of Candidatus Liberibacter asiaticus or preparing RT-qPCR analysis kit for Candidatus Liberibacter asiaticus.
CC PS Claim 1; SEQ ID NO 9; 25pp; Chinese.
CC The present invention relates to a novel internal reference gene selected
CC from SEQ ID NO: 9 (see BGI60797) and SEQ ID NO: 10 (see BGI60798). The
CC invention further claims: (1) a primer selected from SEQ ID NO: 2 (see
CC BGI60790), SEQ ID NO: 3 (see BGI60791), SEQ ID NO: 5 (see BGI60793) and
CC SEQ ID NO: 6 (see BGI60794); (2) a fluorescence real-time quantitative
CC PCR (RT-qPCR) method for detecting the internal reference gene; and (3) a
CC kit comprising the primer. The internal reference gene of the present
CC invention can be used for detecting Candidatus Liberibacter asiaticus and
CC its infection (Citrus Huanglongbing) in citrus plants. The present
CC sequence represents a Candidatus Liberibacter asiaticus gyrA DNA which is
CC specifically claimed and can be used as a target for detecting Candidatus
CC Liberibacter asiaticus.
SQ Sequence 2733 BP; 856 A; 669 C; 433 G; 775 T; 0 U; 0 Other;
Query Match 100.0%; Score 21; Length 2733; Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGAAGGACAAGGAAATTTTGG 21
|||||||||||||||||||||
Db 2401 TGAAGGACAAGGAAATTTTGG 2381
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to modify the method to silence/inhibit the expression of a target gene in the insect endosymbiont bacterial pathogen by using FANA-ASO, as described by Hunter et al.(a) while targeting the DNA gyrase, subunit A (DNA gyrase A) in Candidatus Liberibacter asiaticus, CLas), as described by Hunter et al.(b), using the DNA gyrase A sequence as described by Xu et al. Designing suitable antisense RNA to silence specific target gene is a well-known and standard practice in the art, as discussed above. Using any specific sequence within the DNA gyrase A gene is an experimental design choice of an ordinarily skilled artisan, without negatively affecting the outcome.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to use FANA-ASO technique to silence/inhibit the DNA gyrase A gene in Candidatus Liberibacter asiaticus (CLas), using a sequence complementary to the gyrase A gene including a sequence comprising SEQ ID NO: 13, with a realistic goal to address the citrus greening or Huanglongbing (HLB) disease caused by CLas.
Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Hunter et al. (b), Hunter et al.(a) and Xu et al. as applied to claim 5 above, and further in view of Damha et al. (US 9902953 B2, published in 2018).
Claim 6 depends from claim 5 and is drawn to a 2' F-ANA oligonucleotide according to any of the Formulas including formula 14 (as rejoined by the Examiner, as mentioned in the previous Office action; p.2 and p11).
The Applicant describes various formulas depending on positions of sugar-modified nucleotides (2’ F-ANA) vis-à-vis unmodified deoxyribonucleotides (page 20, para 0063; Table -2). Formula 14 shows alternate arrangement of sugar-modified nucleotides (2’ F-ANA) and unmodified deoxyribonucleotides (Table 2).
Hunter et al.(b) in view of Hunter et al.(a) and further in view of Xu et al. describe using FANA-ASO technique to inhibit the DNA gyrase A gene in Candidatus Liberibacter asiaticus (CLas) comprising instant SEQ ID NO: 13, with a realistic goal to address the citrus greening or Huanglongbing (HLB) disease in citrus caused by CLas, as discussed above.
However, Hunter et al.(b) in view of Hunter et al.(a) and further in view of Xu et al. do not describe any formula to design the FANA oligonucleotides.
Damha et al. describes various structures or formula to arrange sugar-modified nucleotides (2’ F-ANA) vis-à-vis unmodified deoxyribonucleotides (column 3, line 50-67; column 4, line 1-12). Damha et al. also teaches the specific formula comprising alternate arrangement of sugar-modified nucleotides (2’ F-ANA) vis-à-vis unmodified deoxyribonucleotides (column 3, line 50), similar to formula 14 in the instant description.
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to use various formulas including structure 1, as described by Damha et al., which is similar to instant formula 14, to design the 2’F-ANA oligonucleotides, to inhibit the DNA gyrase A gene in Candidatus Liberibacter asiaticus (CLas), with a realistic goal to address the citrus greening or Huanglongbing (HLB) disease caused by CLas, as described by Hunter et al. (a) in view of Hunter et al. (b) and Xu et al., above. Using any specific design or structure of the FANA-ASO including Structure I (as described by Damha et al.) or formula 14 (as described by the Applicant and as recited in claim 6) is an experimental design choice of an ordinarily skilled artisan without affecting the final outcome.
Before the effective filing date, to an ordinarily skilled artisan would have been motivated to use various formulas including formula 14 for designing the 2’F-ANA oligonucleotides with a realistic goal to inhibit the DNA gyrase A gene in Candidatus Liberibacter asiaticus (CLas), to address the citrus greening or Huanglongbing (HLB) disease caused by CLas.
Double Patenting
Nonstatutory Double Patenting Rejection
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 4-13, 15-17 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 5-7, 9-10 of U.S. Patent No. 11254945 B2 (subsequently referred as ‘945B) in view of Hunter et al.(b).
Amended claim 1 is drawn to a method of decreasing target RNA or DNA expression in a plant-chewing or piercing-sucking plant-feeding insect using an antisense oligonucleotide to the insect or a member of its microbiome, wherein the oligonucleotide comprises at least one 2'-deoxy-2'-fluoroarabinonucleotide (2'F-ANA)-modified nucleotide and at least one 2'-deoxyribonucleotide wherein the target RNA comprises bacterial RNA encoding DNA gyrase subunit A from Candidatus Liberibacter asiaticus (CLas).
Claims 1 and 7 in ‘945B recites, “a method of controlling bacteria, wherein the bacteria are present in an insect, and wherein the bacteria are Candidatus Liberibacter asiaticus or Candidatus Liberibacter solanacearum, …. with an oligonucleotide comprising at least one 2'F-ANA modified nucleotide that targets a mRNA present in the bacteria, wherein the 2'F-ANA - modified nucleotides are positioned according to any of Formulas 2-16; allowing the insect to feed on the food source….; inducing RNA silencing…”.
Considering the reference claim 1, it becomes obvious to an ordinarily skilled artisan that the oligonucleotide “comprising at least one 2'F-ANA” and “according to formula 2-16” (which reads on to instant claim 6) would contain at least at least one 2'-deoxyribonucleotide, which is also evident from the inherent property including the chemistry and construction of FANA oligonucleotides as discussed above (Damha et al., column 3, line 50-65; column 4, line 1-12). The target bacteria, a prokaryote (as recited in instant claim 15) (Candidatus Liberibacter asiaticus) in reference claim 1 is recited in instant claim 1, while the target insect pest comprising Diaphorina citri (D citri), as recited in reference claim 6, is also recited in instant claim 4. Recitation of “inducing RNA silencing” in reference claim 1 reads on to “target DNA or RNA comprises a nucleic acid associated with gene expression…” in instant claim 16.
However, no claims of ‘945B recite targeting RNA encoding a DNA gyrase subunit A from CLas.
Hunter et al.(b) describes a method of decreasing expression of a target gene (DNA gyrase A) in an insect endosymbiont bacterial pathogen (CLas) in woody fruit crops (citrus) by using FANA-ASO, as discussed above while rejecting claim 1 under 35 U.S.C. 103.
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to modify the method to silence/inhibit the expression of a target gene in the insect endosymbiont bacterial pathogen (CLas) by using FANA-ASO, as recited in reference claim 1, wherein the target gene is a DNA gyrase subunit A (DNA gyrase A), as described by Hunter et al.(b). It is an experimental design choice of an ordinarily skilled artisan to target a specific gene including DNA gyrase A which is known to inhibit a target insect pest and/or an endosymbiont bacterial pathogen in the insect pest.
Before the effective filing date, the artisan would have motivated to target the DNA gyrase A gene in the endosymbiont bacterial pathogen CLas in commercially important plants using FANA oligonucleotide(s).
Regarding claims 5 and 17; instant SEQ ID NO: 13, as recited in instant claims 5 and 17 has more than 99% (100%) sequence identity to SEQ ID NO: 11 in the reference claim 2, as shown below.
RESULT 1
US-16-412-735-50/c
Sequence 50, US/16412735
Patent No. 11001842
GENERAL INFORMATION
APPLICANT: HUNTER, WAYNE B.
APPLICANT: PELZ-STELINSKI, KIRSTEN
TITLE OF INVENTION: PEPTIDE PHOSPHORODIAMIDATE MORPHOLINO OLIGIMERS PLANT DELIVERY TO
TITLE OF INVENTION: REDUCE PATHOGENS AND INSECT PESTS
FILE REFERENCE: 0040.17
CURRENT APPLICATION NUMBER: US/16/412,735
CURRENT FILING DATE: 2019-05-15
NUMBER OF SEQ ID NOS: 61
SEQ ID NO 50
LENGTH: 2733
TYPE: DNA
ORGANISM: Candidatus Liberibacter asiaticus
Query Match 100.0%; Score 21; Length 2733; Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGAAGGACAAGGAAATTTTGG 21
|||||||||||||||||||||
Db 2401 TGAAGGACAAGGAAATTTTGG 2381
Moreover, using any specific oligonucleotide, as recited in instant claim 5, to silence specific target gene, as recited in instant claims 2, comprising a specific complementary target sequence is a well-known standard process in the art (as discussed above) and would have been an experimental design choice of an ordinarily skilled artisan.
Regarding instant claims 7, 9 and 13; reference claim 9 recites, “…the oligonucleotide is contacted with the plant by root soak, injection or foliar spray” (i.e. via leaves).
Regarding instant claim 8, reference claim 3 recites, “…the food source is a plant”.
Regarding instant claims 10-12, reference claim 5 recite, “a citrus plant” while reference claim 10 recites “plant is citrus or potato”.
Response to Applicant’s Arguments
The Applicant’s response dated 05/05/2026 is fully considered but not found persuasive. Regarding 35 U.S.C.103 rejection, the Applicant argues, “Hunter et al.(b) discusses targeting gyrase A, that disclosure is limited to morpholino-based oligonucleotides (PPMOs) and is exemplified in the context of E. coli and Wolbachia (wDi), not CLas or CLso” (response, p.7, last para, line 1-3). The Applicant continues to argue, “Moreover, Hunter et al. (b) distinguishes morpholino/PPMO methods from other oligonucleotide chemistries, noting that morpholinos require conjugation (e.g., to cell-penetrating peptides) to effectuate cellular uptake. This contrasts with the presently claimed FANA antisense oligonucleotides, which employ a different chemical structure and mode of delivery. The Examiner's position that PPMOs and FANA-ASOs are interchangeable "functional equivalents" is not supported by the cited references, which instead demonstrate meaningful differences in structure and delivery. Accordingly, Hunter et al. (b) does not provide a basis to substitute FANA-ASOs for PPMOs in targeting bacterial gyrase A, especially in the specific biological context of CLas or CLso within a plant-feeding insect or its microbiome” (p.8, para 2).
The Examiner disagrees. As discussed in the previous Office action dated 01/05/2026 and above, targeting DNA gyrase A is shown to be effective for several bacterial pathogen including Wolbachia (wDi) which belongs to the same Liberibacter genus and infecting the same insect pest as wDi. The Applicant does not provide any evidence to support the opinion that the method described by Hunter et al.(b) targeting gyrase A would not work for CLas. Applicant’s opinion cannot take the place of evidence (MPEP 716.01(c)(II), 2145(I)).
As described in the previous Office action (p.9), unlike PPMO molecules that need help of a cell-penetrating peptide to enter into the host cell ((Hunter (b), p. 180, para 1, line 7-9)), the FANA oligos do not need any cell-penetrating peptide but bind to the target RNA sequence(s) (Sandoval‑Mojica et al., Antibacterial FANA oligonucleotides as a novel approach for managing the Huanglongbing pathosystem, 2021, Scientific Reports, 11:2760; abstract). Both FANA and PPMO molecules are not found in nature, made synthetically, and very stable inside a cell especially resistant to nuclease degradation. It is an experimental design choice of an ordinarily skilled artisan to use FANA-ASO technique especially considering FANA’s simple design that does not need any cell penetrating peptide attached to the oligonucleotide, to silence/inhibit a bacterial RNA encoding DNA gyrase A, as described by Hunter et al. (b).
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662