DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I in the reply filed on 11/12/2025 is acknowledged.
In response to the requirement for election of a species in the event of electing Group I, Applicant elects the following species without traverse pertaining to Group I:
a) Bacterial RNA
b) DNA Gyrase (subunit-A)
c) Candidatus Liberibacter asiaticus (CLas)
d) Diaphorina citri (D. citri)
e) SEQ ID NO: 13
f) Formula 1
g) Citrus plant
h) Orange
i) nightshade
However, Formula 14 (in claim 6), potato and tomato (in claim 12) are rejoined for faster and compact prosecution.
The election is made FINAL.
Claim Status
Claims 1-20 and 28 are pending.
Claims 18-20 and 28 are withdrawn from examination as being part of non-elected inventions.
Claims 1-17 are being examined.
Claim Objections
Claim 17 is objected to under 37 CFR 1.75 as being a substantial duplicate of claim 14. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6 and 16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 6 depends from claim 5, which, in turn, depends from claim 1. Claim 1 recites, “… wherein the oligonucleotide comprises at least one 2'-deoxy-2'-fluoroarabinonucleotide (2'F-ANA)-modified nucleotide and at least one 2'-deoxyribonucleotide.”
It is not clear if the Formula 1, as selected, comprise at least one 2'-deoxyribonucleotide. It is apparent to the Examiner that formula 1 comprises only 2'-deoxy-2'-fluoroarabinonucleotide (2'F-ANA)-modified nucleotide (Spec, page 20, table 2) and does not contain “at least one 2'-deoxyribonucleotide”.
Claim 16 depends from claim 1 and is drawn to the target RNA or DNA which is selected from a diverse group of RNA molecules.
It is not clear if all the RNA recited in claim 16 are intended to decrease the target RNA or DNA expression in a plant-chewing or piercing-sucking plant-feeding insect, by providing an antisense oligonucleotide to the insect or a member of its microbiome, as recited in the base claim 1. Exogenously applied antisense RNA molecules are not known to downregulate or decrease including snRNA, tmRNA, locked nucleic acid (LNA) etc.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim 1 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hunter et al. (a) (Antisense oligonucleotides, FANA, for treatment of microbes and arthropod pests of agricultural and medical importance. W069, 2018, in Plant & Animal Genome XXVI Conference, San Diego, CA).
Hunter et al. (a) teaches sequence specific gene silencing (i.e., decreasing target RNA or DNA expression) using sequence specific antisense oligonucleotides, FANA-ASO [(2'-deoxy-2'-fluoro-D- arabinonucleic acid)-(antisense oligonucleotides)] to reduce insect endosymbiont bacterial pathogens in woody fruit crops, as well as being able to suppress mRNA in arthropod vectors (i.e., providing an antisense oligonucleotide to the insect, or a member of its microbiome) (abstract). The inherent property including the chemistry and construction of FANA oligonucleotide comprising at least one 2'-deoxy-2'-fluoroarabinonucleotide (2' FANA) and at least one 2'-deoxyribonucleotide to reduce/silence endogenous gene(s) is known in the art (Damha et al., column 3, line 50-65; column 4, line 1-12). Thus, the teachings of Hunter et al (a) satisfies all the limitations of claim 1.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 2-4 and 7-17 are rejected under 35 U.S.C. 103 as being unpatentable over Hunter et al. (a) as applied to reject claim 1 under USC 102(a)(1) above, and further in view of Hunter et al. (b) (Emerging RNA Suppression Technologies to Protect Citrus Trees From Citrus Greening Disease Bacteria, 2018, Advances in Insect Physiology, 55:163-199)
Claim 2 is drawn to the method of claim 1 wherein the target RNA is a bacterial RNA and the bacterial RNA is DNA Gyrase, subunit-A.
The Applicant describes some of the inherent properties of FANA (2'-Deoxy-2'-Fluoro-o-D-Arabinonucleic Acid) antisense oligonucleotides are nucleic acids with a phosphorothioate backbone and modified flanking nucleotides, in which the 2'-OH group of the ribose sugar was substituted by a fluorine atom. The flank modifications increase the resistance of the ASOs to degradation and enhance binding to targeted mRNA. The FANA/RNA duplex is recognized by ribonuclease H (RNase H), an enzyme that catalyzes the degradation of duplexed mRNA (Spec, page 3, para 0009).
Hunter et al.(a) describes a method of decreasing target RNA expression in an insect endosymbiont bacterial pathogen in woody fruit crops by using FANA-ASO, as discussed above.
However, Hunter et al.(a) does not teach downregulating or silencing a DNA gyrase, subunit A.
Hunter et al.(b) teaches that Asian citrus psyllid (ACP), Diaphorina citri (as recited in claim 4), is a vascular/phloem feeding (as recited in claims 7 and 9) insect and the most economically important pest of citrus (as recited in claim 10) including orange (as recited in claim 11) (page 172, para 1, last 2 lines, Fig. 2) because of its status as the main psyllid vector of the bacteria associated with citrus greening or Huanglongbing (HLB) (page 165, last para, line 20-23). One of the three endosymbiotic bacteria is Candidatus Liberibacter asiaticus (CLas), as recited in claim 3 (page 165, last para, line 24-26).
Hunter et al.(b) describes methods to reduce Asian citrus psyllid (ACP) infection by suppressing another endosymbiont (one of the three, as mentioned before), Wolbachia-Diaphorina, wDi (page 179, para 1, line 7-9) by using Morpholino-based bactericides, PPMOs (page 181, last para, line 1-5). PPMOs are synthetic and stable (with no reported enzyme able to degrade it) molecules (page 177, last para, last 3 lines) that mimic DNA/RNA with a different sugar-phosphate backbone allowing them to bind target RNA. Short PPMOs of 14-18 nt renders the target RNA (often mRNA) susceptible to cleavage (page 178, para 1, line 3-7). Hunter et al.(b) teaches silencing or inactivating prokaryotic (as recited in claim 15) bacterial DNA gyrase A, including wDi gyrase A, using cell-penetrating peptide linked morpholino oligonucleotides (PPMOs) (as recited in claim 13) (page 179, para 1, line 1-9).
Hunter et al.(b) describes both canonical and noncanonical oligonucleotides to knockdown specific gene(s) in a bacterium (page 173, last para; page 173, para 2) using dsRNA and RNAi (page 170, para 3). Use of Noncanonical oligonucleotides resulted in significant increase in ACP mortality compared to equivalent canonical (traditional) oligonucleotides (page 173, para 1, line 1-6). Hunter et al.(b) does not explicitly describe the noncanonical oligonucleotides. However, the noncanonical oligonucleotides would include FANA-ASO1.
Hunter et al.(b) also teaches ingestion of oligonucleotide (dsRNA) by the psyllid (Asian citrus psyllid, ACP), as recited in claim 8 (page 171, para 2, last 3 lines; page 172, last para, first 2 lines; page 175, para 2, first 2 lines). Besides citrus, the method is equally effective in various plants including Solanaceous plants like potato and tomato (as rejoined by the Examiner and as stated earlier), as recited in claim 12 (page 180, para 1, line 2-3).
Hunter et al. (b) describes foliar spray and soil applied solution (treatments) (as recited in claim 13) of oligonucleotide (dsRNA) to reduce ACP by significantly suppressing target mRNA (as recited in claim 16) via RNAi (page 177, para 1, last 5 lines). Root absorption (through soil) was accomplished by two different methods: direct soil application and root dipping (page 179, para 1, line 17-18).
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to modify the method to silence/inhibit the expression of target gene(s) in an insect endosymbiont bacterial pathogen, as described by Hunter et al.(a), in bacteria other than Wolbachia-Diaphorina, wDi, comprising Candidatus Liberibacter asiaticus (CLas), by targeting the DNA gyrase subunit A (DNA gyrase A) of CLas, as described by Hunter et al. (b), by targeting its mRNA transcript, as described by Hunter et al. (a).
PPMO molecules comprising oligonucleotides, as described by Hunter et al (b), are functional equivalents of FANA molecules, as described by Hunter et al. (a), in terms of its ability to enter the organism and into the cells (as FANA oligos do not need any cell-penetrating peptide, unlike PPMO), and then bind to target RNA sequence(s), which are inherent among the properties of FANA molecule2. Both FANA and PPMO molecules are not found in nature, made synthetically and very stable inside a cell especially resistant to nuclease degradation. It is an experimental design choice of an ordinarily skilled artisan to use FANA-ASO technique especially considering FANA’s simple design that does not need any cell penetrating peptide attached to the oligonucleotide, to silence/inhibit a bacterial RNA encoding DNA gyrase A, as described by Hunter et al. (b).
Before the effective filing date, an ordinarily skilled artisan would have been motivated to use FANA-ASO technique to silence/inhibit a bacterial DNA gyrase A by targeting its mRNA transcript in the bacteria Candidatus Liberibacter asiaticus (CLas), with a realistic goal to address the commercially devastating citrus greening or Huanglongbing (HLB) disease in citrus plants caused by CLas.
Regarding claims 14 and 17, Designing suitable oligonucleotides for RNAi based gene silencing comprise more than 80% or 99% sequence identity to the complementary sequence to the target sequence, is a well-known and standard practice in the art3.
Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Hunter et al. (a) as applied to reject claim 1 under USC 102(a)(1) above, and further in view of Hunter et al. (b) and Xu et al. (CN109706255 A, published in 2019).
Claim 5 depends from claim 1 and is drawn to instant SEQ ID NO: 13.
Hunter et al.(a) describes a method of decreasing target RNA expression in an insect endosymbiont bacterial pathogen in woody fruit crops by using FANA-ASO, as discussed above.
However, Hunter et al.(a) does not explicitly teach downregulating or silencing a gene by using an oligonucleotide consisting of SEQ ID NO: 13.
Hunter et al.(b) describes silencing or inactivating bacterial DNA gyrase A, which also inactivates several bacterial species including Wolbachia-Diaphorina, wDi (page 179, para 1, line 2-9), one of the bacteria (endosymbiont) in the psyllid, D. citri.
Xu et al. teaches a nucleotide sequence (SEQ ID NO: 9) of the gyrase, subunit A (gyrA) gene in Candidatus Liberibacter asiaticus, the causative agent of the citrus Huanglongbing disease (abstract). SEQ ID NO: 9 as described by Xu et al. is having 100% identity to instant SEQ ID NO: 13, as shown below.
RESULT 2
ID BGI60797 standard; DNA; 2733 BP.
AC BGI60797;
DT 11-JUL-2019 (first entry)
DE Candidatus Liberibacter asiaticus gyrA DNA, SEQ ID 9.
KW bacterial infection; crop plant pathogen; dna detection; ds; fluorescence; genetic marker; gyrA gene; microorganism detection; plant bacterial disease.
OS Candidatus Liberibacter asiaticus.
CC PN CN109706255-A.
CC PD 03-MAY-2019.
CC PF 18-JAN-2019; 2019CN-10104175.
PR 18-JAN-2019; 2019CN-10104175.
CC PA (USCG ) UNIV SOUTH CHINA AGRIC.
CC PI Xu M, Zheng Y, Zheng Z, Deng X;
DR WPI; 2019-42658D/50.
CC PT New internal reference gene combination useful in RTqPCR analysis of Candidatus Liberibacter asiaticus or preparing RT-qPCR analysis kit for Candidatus Liberibacter asiaticus.
CC PS Claim 1; SEQ ID NO 9; 25pp; Chinese.
CC The present invention relates to a novel internal reference gene selected
CC from SEQ ID NO: 9 (see BGI60797) and SEQ ID NO: 10 (see BGI60798). The
CC invention further claims: (1) a primer selected from SEQ ID NO: 2 (see
CC BGI60790), SEQ ID NO: 3 (see BGI60791), SEQ ID NO: 5 (see BGI60793) and
CC SEQ ID NO: 6 (see BGI60794); (2) a fluorescence real-time quantitative
CC PCR (RT-qPCR) method for detecting the internal reference gene; and (3) a
CC kit comprising the primer. The internal reference gene of the present
CC invention can be used for detecting Candidatus Liberibacter asiaticus and
CC its infection (Citrus Huanglongbing) in citrus plants. The present
CC sequence represents a Candidatus Liberibacter asiaticus gyrA DNA which is
CC specifically claimed and can be used as a target for detecting Candidatus
CC Liberibacter asiaticus.
SQ Sequence 2733 BP; 856 A; 669 C; 433 G; 775 T; 0 U; 0 Other;
Query Match 100.0%; Score 21; Length 2733; Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGAAGGACAAGGAAATTTTGG 21
|||||||||||||||||||||
Db 2401 TGAAGGACAAGGAAATTTTGG 2381
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to modify the method to silence/inhibit the expression of a target gene in the insect endosymbiont bacterial pathogen by using FANA-ASO, as described by Hunter et al.(a) while targeting the DNA gyrase, subunit A (DNA gyrase A) in Candidatus Liberibacter asiaticus, CLas), as described by Hunter et al (b), using the DNA gyrase A sequence as described by Xu et al. Deigning suitable antisense RNA to silence specific target gene is a well-known and standard practice in the art. Using any specific sequence within the DNA gyrase A sequence is an experimental design choice of an ordinarily skilled artisan, without negatively affecting the outcome.
Before the effective filing date, an ordinarily skilled artisan would have been motivated to use FANA-ASO technique to silence/inhibit the DNA gyrase A gene in Candidatus Liberibacter asiaticus (CLas), using a sequence complementary to the gyrase A gene including a sequence comprising SEQ ID NO: 13, with a realistic goal to address the citrus greening or Huanglongbing (HLB) disease caused by CLas.
Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Hunter et al. (a) in view of Hunter et al. (b) and Xu et al. as applied to claim 5 above, and further in view of Damha et al. (US 9902953 B2, published in 2018).
Claim 6 depends from claim 5 and is drawn to a 2' F-ANA oligonucleotide according to any of the Formulas including formula 1 and/or formula 14 (as rejoined by the Examiner and as stated earlier). To the extent that the claim 6 is examined in the context of elected species (formula 1). The Examiner does not find a prior art. So, the Examiner rejoined the next species, formula 14 and examined the claim accordingly.
The Applicant describes various formulas depending on positions of sugar-modified nucleotides (2’ F-ANA) vis-à-vis unmodified deoxyribonucleotides (page 20, para 0063; Table -2). Formula 14 (as rejoined by the Examiner) shows alternate arrangement of sugar-modified nucleotides (2’ F-ANA) and unmodified deoxyribonucleotides (Table 2).
Hunter et al.(a) in view of Hunter et al.(b) and Xu et al. describe using FANA-ASO technique to inhibit the DNA gyrase A gene in Candidatus Liberibacter asiaticus (CLas) comprising instant SEQ ID NO: 13, with a realistic goal to address the citrus greening or Huanglongbing (HLB) disease in citrus caused by CLas, as discussed above.
However, Hunter et al.(a) in view of Hunter et al.(b) and Xu et al. do not describe any formula to design the FANA oligonucleotides.
Damha et al. describes various structures or formula to arrange sugar-modified nucleotides (2’ F-ANA) vis-à-vis unmodified deoxyribonucleotides (column 3, line 50-67; column 4, line 1-12). Damha et al. also teaches the specific formula comprising alternate arrangement of sugar-modified nucleotides (2’ F-ANA) vis-à-vis unmodified deoxyribonucleotides (column 3, line 50), similar to formula 14 in the instant description.
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to use various formulas including structure 1 (as described by Damha et al.), which is similar to instant formula 14, to design the 2’F-ANA oligonucleotides, to inhibit the DNA gyrase A gene in Candidatus Liberibacter asiaticus (CLas), with a realistic goal to address the citrus greening or Huanglongbing (HLB) disease caused by CLas, as described by Hunter et al. (a) in view of Hunter et al. (b) and Xu et al., above.
Before the effective filing date, to an ordinarily skilled artisan would have been motivated to use various formulas including formula 14 for designing the 2’F-ANA oligonucleotides with a realistic goal to inhibit the DNA gyrase A gene in Candidatus Liberibacter asiaticus (CLas), to address the citrus greening or Huanglongbing (HLB) disease caused by CLas
Improper Markush Group
Claim 16 is rejected under the judicially-created basis that it contains an improper Markush grouping of alternative species. See In re Harnisch, 631 F.2d 716, 721-722 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. and Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature.
The members of the improper Markush grouping do not share a substantial feature and a common use that flows from the substantial structural feature for the following reasons: the claim encompasses different polynucleotide sequences which are biochemically divergent, they have no conserved structure throughout the genus, and may or may not be a target RNA or DNA to be silences using the FANA technique.
Claim 16 depends from claim 1 and is drawn to the target RNA or DNA which is selected from a diverse group of RNA molecules. The species lack any substantial structural feature to become the target for decreasing the target RNA or DNA expression in a plant-chewing or piercing-sucking plant-feeding insect, by providing an antisense oligonucleotide to the insect, or a member of its microbiome. The “provided antisense oligonucleotide”, as recited in the base claim 1, can only target endogenous RNA and/or DNA molecules involved in specific (target) gene expression in the insect or a member of its microbiome. Such RNA molecules are not known to include snRNA, tmRNA, locked nucleic acid (LNA) etc.
See also USC 112(b) rejection above.
Double Patenting
Nonstatutory Double Patenting Rejection
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-11 and 13-17 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 5, 7, 9-10 of U.S. Patent No. 11254945 B2 (subsequently referred as ‘945B), in view of Hunter et al. (b).
Claim 1 and 7 in ‘945B recites, “a method of controlling bacteria , wherein the bacteria
are present in an insect , and wherein the bacteria are Candidatus Liberibacter asiaticus or Candidatus Liberib acter solanacearum, …. with an oligonucleotide comprising at least one 2'F-ANA modified nucleotide that targets a mRNA present in the bacteria, wherein the 2'F-ANA - modified nucleotides are positioned according to any of Formulas 2-16; allowing the insect to feed on the food source….; inducing RNA silencing…”.
Recitation of the reference claim 1 would make instant claims 1, 3, 6, 15-16 obvious. Instant claim 1 recites “a method of decreasing target RNA or DNA expression in a plant- chewing or piercing-sucking plant-feeding insect, comprising providing an antisense oligonucleotide to the insect, or a member of its microbiome, wherein the oligonucleotide comprises at least one 2'-deoxy-2'-fluoroarabinonucleotide (2'F-ANA)-modified nucleotide and at least one 2'-deoxyribonucleotide.” Considering the reference claim 1, it becomes obvious to an ordinarily skilled artisan that the oligonucleotide “comprising at least one 2'F-ANA” and “according to formula 2-16” (which reads on to instant claim 6) would contain at least at least one 2'-deoxyribonucleotide, which is also evident from the inherent property including the chemistry and construction of FANA oligonucleotides as discussed above (Damha et al., column 3, line 50-65; column 4, line 1-12). The target bacteria, a prokaryote (as recited in instant claim 15) (Candidatus Liberibacter asiaticus or Candidatus Liberib acter solanacearum) in reference claim 1 are recited in instant claim 3, while the target insect pest comprising Diaphorina citri (D citri) as recited in reference claim 1 is also recited in instant claim 4. Recitation of “inducing RNA silencing” in reference claim 1 would make instant claim 16 obvious as most of the species in instant claim 16 are RNAs and a potential target of the “antisense oligonucleotide” as recited in instant claim 1.
Regarding claims 2, 5, 14 and 17; instant SEQ ID NO: 13, as recited in instant claims 5 and 17 has more than 99% (100%) sequence identity to SEQ ID NO: 11 in the reference claim 2, as shown below.
RESULT 1
US-16-412-735-50/c
Sequence 50, US/16412735
Patent No. 11001842
GENERAL INFORMATION
APPLICANT: HUNTER, WAYNE B.
APPLICANT: PELZ-STELINSKI, KIRSTEN
TITLE OF INVENTION: PEPTIDE PHOSPHORODIAMIDATE MORPHOLINO OLIGIMERS PLANT DELIVERY TO
TITLE OF INVENTION: REDUCE PATHOGENS AND INSECT PESTS
FILE REFERENCE: 0040.17
CURRENT APPLICATION NUMBER: US/16/412,735
CURRENT FILING DATE: 2019-05-15
NUMBER OF SEQ ID NOS: 61
SEQ ID NO 50
LENGTH: 2733
TYPE: DNA
ORGANISM: Candidatus Liberibacter asiaticus
Query Match 100.0%; Score 21; Length 2733;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGAAGGACAAGGAAATTTTGG 21
|||||||||||||||||||||
Db 2401 TGAAGGACAAGGAAATTTTGG 2381
Regarding instant claims 2 and 14, reference claims 1 and 2 do not explicitly specify a bacterial gene or identify the percentage of sequence identity or homology complementary to the target sequence needed for the method to work, i.e. to downregulate of silence the target gene.
Hunter et al. (b) describes application of oligonucleotide (dsRNA) containing non-canonical (implying FANA, as discussed above) nucleotides to inhibit/reduce target gene expression in a member of microbiome of an insect (ACP) by significantly suppressing target mRNA via RNAi (page 177, para 1, last 5 lines). Hunter et al. (b) also teaches that the psyllid, D. citri, harbors three endosymbiotic bacteria, Candidatus Carsonella ruddii, C. Profftella armatura, and Wolbachia-Diaphorina, wDi (page 169, para 3, line 2-3), along with identification of genomes of the bacteria ((page 169, para 3, line 9-11) to find targets for “a management tool” against the bacteria via CRISPR (page 169, para 3, line 13-16) and dsRNA/RNAi (page 170, para 3).
Before the effective filing date of the instant invention, it would have been obvious to an ordinarily skilled artisan to use 2’F-ANA modified nucleotides, as recited in claims 1 and 5 of the reference application, to inhibit/reduce target gene expression in a bacterial member of microbiome (CLas) of an pathogenic insect pest (ACP) of economically important crop, citrus, by significantly suppressing target mRNA expression via RNAi, as described by Hunter et al. (b) and as discussed above.
Moreover, using any specific oligonucleotide, as recited in instant claim 5, to silence specific target gene, as recited in instant claims 2 and 14, comprising a specific complementary target sequence is a well-known standard process in the art (as discussed above) and would have been an experimental design choice of the artisan. Before the effective filing date of the instant invention, an ordinarily skilled artisan would have been motivated to use 2’F-ANA modified nucleotides comprising suitable sequence to inhibit/reduce target gene expression in a member of microbiome of an insect (ACP) by significantly suppressing target mRNA expression of a vital gene (needed by the bacteria to survive and/or establish pathogenecity) with a realistic goal to address the disease of citrus greening (Huanglongbing, HLB) caused by the member bacteria (CLas) of the insect microbiome.
Regarding instant claims 7, 9 and 13; reference claim 9 recites, “…the oligonucleotide is
contacted with the plant by root soak , injection or foliar spray” (i.e. via leaves).
Regarding instant claim 8, reference claim 3 recites, “…the food source is a
plant”.
Regarding instant claims 10-11, reference claims 5 and 10 recite, “a citrus plant”.
Conclusion
No claim is allowed.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
1 Sun et al. (Citrus Genetic Engineering for Disease Resistance: Past, Present and Future, 2019, International Journal of Molecular Sciences, 20:5256) provides the evidence that noncanonical oligonucleotides, as described by Hunter et al.(b) include FANA-ASO to trigger RNAi degradation of the transcripts of specific target gene(s) (page 9, para 3, line 9-12).
2 Sandoval‑Mojica1 et al. (Antibacterial FANA oligonucleotides as a novel approach for managing the Huanglongbing pathosystem, 2021, Scientific Reports, 11:2760) provides the evidence that the ability to enter insect cells and into bacterial cells to target specific RNA sequence(s), are inherent the properties of FANA molecule (abstract).
3 Horn et al. (Design and evaluation of genome-wide libraries for RNA interference screens, 2010, Genome Biology, 11:R61) provides the evidence that design of ideal and/or suitable oligonucleotides for RNAi based gene silencing would preferably comprise more than 80% or even 99% sequence identity to the target sequence.