Prosecution Insights
Last updated: April 19, 2026
Application No. 18/023,548

COMPOSITIONS AND METHODS FOR CLL1 MODIFICATION

Non-Final OA §101§103§112§DP
Filed
Feb 27, 2023
Examiner
GOMEZ RODRIGUEZ, JULIO WASHINGTON
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Vor Biopharma Inc.
OA Round
1 (Non-Final)
50%
Grant Probability
Moderate
1-2
OA Rounds
4y 1m
To Grant
96%
With Interview

Examiner Intelligence

Grants 50% of resolved cases
50%
Career Allow Rate
11 granted / 22 resolved
-10.0% vs TC avg
Strong +46% interview lift
Without
With
+45.8%
Interview Lift
resolved cases with interview
Typical timeline
4y 1m
Avg Prosecution
48 currently pending
Career history
70
Total Applications
across all art units

Statute-Specific Performance

§101
6.3%
-33.7% vs TC avg
§103
32.8%
-7.2% vs TC avg
§102
19.1%
-20.9% vs TC avg
§112
27.1%
-12.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 22 resolved cases

Office Action

§101 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Claims 2-14, 24, 29-32, 36, 38, 41 are cancelled. Claims 1, 15-23, 25-28, 33-35, 37, 39-40 are amended and examined on the merits. Priority This application is a national stage application, of International Patent Application No. PCT/US2021/047967, filed 08/27/2021, which claims priority from U.S. Provisional Application 63071984, filed 08/28/2020 is acknowledged. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 15-16 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The claim recites “A guide RNA (gRNA) comprising a targeting domain which binds a target domain of Table 1, 2, 6, or 8”. This language renders the claim indefinite because it creates an ambiguous reference to the specification, failing to define the scope of the claimed subject matter clearly and precisely. Simply referencing a list of tables is not sufficient to incorporate the sequences into the claim. The claim must provide an explicit, self-contained definition of the sequences. A person of ordinary skill in the art cannot ascertain the specific sequences or characteristics that define the “target domain” with reasonable certainty by reading the claim itself. This ambiguity makes it impossible to determine the metes and bounds of the claimed gRNA. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 15-23, 25-28, 33-35, 37, 39-40 are rejected under 35 U.S.C. 103 as being unpatentable over Mukherjee et al. (“Mukherjee”, WO 2020/150478 A1, cited as a reference on IDS filed 03/22/2024) in view of Ishikawa et al. (“Ishikawa”, US 2012/0070450 A1) and Tashiro et al. (“Tashiro”, Molecular Therapy, September 2017). Regarding claim 1, 17-18, Mukherjee teaches novel approaches to cancer immunotherapy that targets certain classes of lineage-specific cell-surface antigens on tumor cells. The CART cell treatment is then combined with replacement of the non-tumor cells by infusion or reinfusion of a modified population of cells that are deficient for the lineage-specific cell-surface antigen. Recurrence of the tumor is prevented or decreased by maintaining surveillance of the patient in vivo with the CAR T cells (e.g., paragraph 3rd, page 2). Mukherjee teaches gRNA described herein for reducing expression of CD33 in a sample of hematopoietic cells stem or progenitor cells using a CRISPR/Cas9 system (e.g., paragraph ). Mukherjee teaches cells made deficient in CD33 and CLL-1 can successfully engraft (e.g., paragraph 2nd, page 34; Fig. 33A-D). Mukherjee teaches CD34+ CD33Del CLL1Del double deletion cells were generated by transfecting CD34+ cells with different combinations of gRNAs, including: sgRNA 811 (having a spacer sequence of 5' CUCACUAGACUUGACCCAC 3' against CD33; SEQ ID NO: 70), sgRNA 846 (having a spacer sequence 5' AUCCCUGGCACUCUAGAACC 3' against CD33; SEQ ID NO: 67), a CLL-1 gRNA having a spacer sequence of 5' GUUGUAGAGAAAUAUUUCUC 3' (SEQ ID NO: 115) and a second CLL-1 gRNA having a guide region 5' GGAGAGGUUCCUGAUCUUGU 3' (SEQ ID NO: 116). On day 1, cells were transfected with the sgRNAs using nucleofection in order to obtain after CRISPR/Cas9-mediated ablation of the target genes (Fig. 33A, indicates a CD34+ CLL1Del by CRISPR using a single gRNA [see Fig. below]) (e.g., paragraph 2nd, page 127; Example 7). PNG media_image1.png 366 921 media_image1.png Greyscale Regarding claims 19-20, Mukherjee teaches a gRNA described herein is chemically modified. For example, the gRNA may comprise one or more 2'-0 modified nucleotide, e.g., 2'-O-methyl nucleotide (e.g., paragraph 2nd, page 72). Mukherjee teaches that the modified gRNA comprises at least one nucleotide having a modification to the chemical structure of at least one of the following: nucleobase, sugar, and phosphodiester linkage or backbone portion (e.g., nucleotide phosphates). suitable modifications include phosphorothioate backbone modification, 2'-O-Me-modified sugar, 2'F-modified sugar, replacement of the ribose sugar with the bicyclic nucleotide-cEt, 3'thioPACE (MSP) (e.g., paragraph 1st, page 72). Regarding claim 21-23, 25-26, Mekherjee teaches method of producing a genetically engineered hematopoietic stem and/or progenitor cell, comprising (i) providing a hematopoietic stem and/or progenitor cell, and (ii) introducing into the cell (a) a guide RNA (gRNA) that comprises a nucleotide sequence that is at least 90% identical to SEQ ID NO: 67, SEQ ID NO: 68, and/or SEQ ID NO: 70, and (b) a Cas9 endonuclease, thereby producing a genetically engineered hematopoietic stem and/or progenitor cell having a reduced expression level of CD33. In some embodiments, the gRNA and Cas9 endonuclease are encoded on one vector, which is introduced into the cell. In some embodiments, the vector is a viral vector (e.g., paragraph 3rd, page 3). provides a cell population comprising a plurality of the genetically engineered hematopoietic stem and/or progenitor cells (e.g., paragraph 2nd, page 3). M the gRNA and Cas9 endonuclease are introduced into the cell as a pre-formed ribonucleoprotein complex. In some embodiments, the ribonucleoprotein complex is introduced into the cell via electroporation (e.g., paragraph 3rd, page 3). Regarding claim 27-28, 33-35, 37, Mekherjee teaches cells made deficient in CD33 and CLL-1 can successfully engraft in mice. flow cytometry plots showing CD33 and CLL-1 levels can be reduced individually or in combination. (e.g., paragraph 2nd, page 34; Fig. 33A-D). Mukherjee teaches CD34+CD33Del CLL1Del double deletion cells were generated by transfecting CD34+ cells with different combinations of gRNAs, including: sgRNA 811 (having a spacer sequence of 5' CCUCACUAGACUUGACCCAC 3' against CD33; SEQ ID NO: 70), sgRNA 846 (having a spacer sequence 5' AUCCCUGGCACUCUAGAACC 3' against CD33; SEQ ID NO: 67), a CLL-1 gRNA having a spacer sequence of 5' GUUGUAGAGAAAUAUUUCUC 3' (SEQ ID NO: 115) and a second CLL-1 gRNA having a guide region 5' GGAGAGGUUCCUGAUCUUGU 3' (SEQ ID NO: 116). On day 1, cells were transfected with the sgRNAs using nucleofection in order to obtain after CRISPR/Cas9-mediated ablation of the target genes. Four days post-transfection, the expression of CD33 and CLL1 was assessed by flow cytometry. On day 5, CD34+WT, D34+CD33Del, CD34+ CLL1Del or CD34+CD33Del CLL1Del cells were intravenously injected into NSGS mice. CD33 and/or CLL1 levels were depleted successfully individually and in combination using these gRNAs. Four weeks post-injection, bone marrow (BM) aspirates of injected mice were analyzed by flow cytometry to determine the presence of CD33 and/or CLL1 in CD34+ cells gated on Terl 19-, Ly5-/H2kd-, hCD45+. The single and double deletion cells were successfully detected in the bone marrow samples (with an engraftment with at least 50% [see Fig. below]). Furthermore, CD123+, CD14+, CDlO+, and CD19+ cells were detected in the hCD45+ population in both whole bone marrow samples and spleen samples. This analysis shows that depletion of CD33 and/or CLL1 did not impair hematopoietic multilineage engraftment (e.g., paragraph 2nd-3rd, page 127; Fig. 33A-D [see Figs. below]). Mukherjee teaches features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features (e.g., paragraph 1st, page 128). Fig. 33A PNG media_image2.png 387 975 media_image2.png Greyscale Fig. 33B PNG media_image3.png 552 907 media_image3.png Greyscale Fig. 33C PNG media_image4.png 429 877 media_image4.png Greyscale Regarding claim 39-40, Mukherjee teaches method of treating a hematopoietic disorder, comprising administering to a subject in need thereof an effective amount of the genetically engineered hematopoietic stem and/or progenitor cell or the cell population described herein. In some embodiments, the hematopoietic disorder is a hematopoietic malignancy (e.g., paragraph 3rd, page 4). Mukherjee teaches new potential targets that share the properties that make CD33 an attractable target i.e. a functionally redundant lineage marker that is strictly expressed by hematopoietic cells and also expressed by the cancer cells (e.g., CD123, CLL-1 or CD244). This antigen is rendered "cancer specific" by CRISPR mediated ablation of the antigen from HSCs (e.g., paragraph 4th, page 125). Mukherjee teaches novel CD33 directed reagents (including new anti-CD33 CAR-T, anti-CD33 ADCs and CD33 bi-specific T cell engagers or BiTEs) (e.g., paragraph 3rd, page 125). Mukherjee teaches features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features (e.g., paragraph 1st, page 128). Mukherjee does not teach SEQ ID NO 25, as required by instant claim 1. Mukherjee does not teach the agent an antigen-binding fragment that binds CLL1. However, this is cured by Ishikawa and Tashiro. Ishikawa teaches molecular target that is specific for human leukemic stem cells (LSCs) and provide a therapeutic means that will lead to radical treatment of acute myeloid leukemia (AML) and the like (e.g., paragraph 0011). Ishikawa teaches a therapeutic agent for acute myeloid leukemia that targets leukemic stem cells, comprising as an active ingredient a substance capable of suppressing the expression of a gene selected from among leukemic stem cell marker genes consisting of the following set of genes such as CLEC12A, CD33, (that encodes CLL-1 protein) (e.g., paragraph 0015). Ishikawa teaches SEQ ID NO 37, that has 100% homology with SEQ ID NO 25 of the instant claim. PNG media_image5.png 65 308 media_image5.png Greyscale Based on these teachings, it would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to use the oligonucleotide SEQ ID NO 37 that targets CLL-1 taught by Ishikawa, to use as a gRNA to target CLL-1 with a CRISPR/Cas9 system in a hematopoietic stem cell taught by Mukherjee, for someone skilled in the art would have been obvious to use these teachings to achieve the predictable result of obtaining a CLL-1-genetically engineered hematopoietic stem using a CRISPR/Cas9 system. One of ordinary skill in the art before the effective filing date of the invention would have been motivated to do so in order to develop a method of treating a hematopoietic disorder, comprising administering to a subject in need of the genetically engineered hematopoietic stem and/or progenitor cell by targeting CLL-1 and CD33 using CRISPR/Cas9 system. Tashiro teaches development and evaluation of CLL-1-specific chimeric antigen receptor T cells (CLL-1.CAR-Ts) and we demonstrate their specific activity against CLL-1+ AML cell lines as well as primary AML patient samples in vitro (e.g., abstract). Tashiro teaches CLL-1-specific single-chain fragment variable (scFv) to create a panel of CLL-1.CARs with various costimulatory domains consisting of a CLL-1 scFv fused with a CD8a stalk and transmembrane domains (e.g., paragraph 2nd, column right, page 2203; Fig. S2A). Tashiro teaches CLL-1-specific CAR-Ts (CLL-1.CAR-Ts) and demonstrated selective killing of leukemic progenitor cells and their progeny (e.g., paragraph 1st, page 2203; Fig. 3). It would have been prima facie obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to use the CLL-1-specific CAR-Ts (CLL-1.CAR-Ts) taught by Tashiro, an incorporate in the method of treating a hematopoietic disorder, comprising administering to a subject in need of the genetically engineered hematopoietic stem and/or progenitor cell by targeting CLL-1 and CD33 using CRISPR/Cas9 system taught by Mukherjee. One of ordinary skill in the art before the effective filing date of the invention would have been motivated to do so in order to develop a method of treating a hematopoietic disorder, comprising administering to a subject in need of the genetically engineered hematopoietic stem and/or progenitor cell by targeting CLL-1 and CD33. Double Patenting A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957). A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101. Claims 1, 15-20, are provisionally rejected under 35 U.S.C. 101 as claiming the same invention as that of claims 1, 15-20 of copending Application No. 17638607 (“607”) (reference application). This is a provisional statutory double patenting rejection since the claims directed to the same invention have not in fact been patented. It is noted that “607”: A gRNA comprising a targeting domain, wherein the targeting domain comprises a sequence of any one of SEQ ID NOs: 21-30, 44, 45, 239, or 257, see “607” claim 1. A gRNA comprising a targeting domain which binds a target domain of Table 1, 2, 6, or 8, see “607” claim 15. A gRNA comprising a targeting domain capable of directing cleavage or editing of a target domain of Table 1, 2, 6, or 8, see “607” claim 16. The gRNA of any of claim 1 [[-16]], wherein the gRNA comprises a first complementarity domain, a linking domain, a second complementarity domain which is complementary to the first complementarity domain, and a proximal domain, see “607” claim 17. The gRNA of claim 1, wherein the gRNA is a single guide RNA (sgRNA), see “607” claim 18. The gRNA of claim 1, wherein the gRNA comprises one or more 2'O-methyl nucleotide, see “607” claim 19. The gRNA of claim 1, wherein the gRNA comprises one or more phosphorothioate or thioPACE linkage, see “607” claim 20. This is a provisional statutory double patenting rejection since the claims directed to the same invention have not in fact been patented. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 15-23, 25-26, 34-35, 37, 39-40 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 15-30, 32-34 of copending Application No. 17638607 (“607”) (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because “607” is a species of the instant application: A gRNA comprising a targeting domain, wherein the targeting domain comprises a sequence of any one of SEQ ID NOs: 21-30, 44, 45, 239, or 257, see “607” claim 1. A gRNA comprising a targeting domain which binds a target domain of Table 1, 2, 6, or 8, see “607” claim 15. A gRNA comprising a targeting domain capable of directing cleavage or editing of a target domain of Table 1, 2, 6, or 8, see “607” claim 16. The gRNA of any of claim 1 [[-16]], wherein the gRNA comprises a first complementarity domain, a linking domain, a second complementarity domain which is complementary to the first complementarity domain, and a proximal domain, see “607” claim 17. The gRNA of claim 1, wherein the gRNA is a single guide RNA (sgRNA), see “607” claim 18. The gRNA of claim 1, wherein the gRNA comprises one or more 2'O-methyl nucleotide, see “607” claim 19. The gRNA of claim 1, wherein the gRNA comprises one or more phosphorothioate or thioPACE linkage, see “607” claim 20. A method of producing a genetically engineered cell, comprising: (i) providing a cell (e.g., a hematopoietic stem or progenitor cell. e.g.. a wild-type hematopoietic stem or progenitor cell), and (ii) introducing into the cell (a) [[a]] the gRNA of claim 1, and (b) a Cas [[Cas9]] molecule that binds the gRNA, thereby producing the genetically engineered cell, see “607” claim 21. The method of claim 21, wherein the Cas molecule comprises a SpCas9 endonuclease, a SaCas9 endonuclease, or a Cpf I endonuclease, see “607” claim 22. The method of claim 21, wherein the gRNA of ([[ii a) and the Cas molecule of ([[ii]] b) are introduced into the cell as a pre-formed ribonucleoprotein complex, see “607” claim 23. The method of claim 21. wherein the ribonucleoprotein complex is introduced into the cell via electroporation, see “607” claim 24. A genetically engineered hematopoietic stem or progenitor cell, produced by [[a]]the method of claim 21, see “607” claim 25. A cell population, comprising a plurality of the genetically engineered hematopoietic stem or progenitor cells of claim 25, see “607” claim 26. The cell population of claim 26, further comprising [[es]] one or more cells comprising[[e]] one or more non-engineered CLL1 genes, see “607” claim 27. The cell population of claim 26, wherein the cell population expresses less than 20% of the CLL I expressed by a wild-type counterpart cell population, see “607” claim 28. The cell population of claim 26, wherein the cells of the population comprise[[s]] both [[of]] hematopoietic stem cells and hematopoietic progenitor cells, see “607” claim 29.The cell population of claim 26, wherein the cells of the population further comprise[[s]] a second mutation at a gene encoding a lineage- specific cell surface antigen other than CLL1, optionally wherein the gene encoding the lineage- specific cell surface antigen other than CLL1 is CD33 or CD 123, see “607” claim 30. A method, comprising administering to a subject in need thereof the [[a]] cell population of claim 26, see “607” claim 32. The method of claim 32, wherein the subject has a hematopoietic malignancy, see “607” claim 33. The method of claim 32, wherein the method further comprises administering to the subject an effective amount of an agent that targets CLL1, wherein the agent comprises an antigen-binding fragment that binds CLL1, see “607” claim 34. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to JULIO GOMEZ RODRIGUEZ whose telephone number is (571)270-0991. The examiner can normally be reached Monday - Friday 8:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 5712722916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JULIO WASHINGTON GOMEZ RODRIGUEZ/Examiner, Art Unit 1637 /J. E. ANGELL, Ph.D./Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Feb 27, 2023
Application Filed
Nov 12, 2025
Non-Final Rejection — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12534717
AAV CAPSID PROTEINS FOR NUCLEIC ACID TRANSFER
2y 5m to grant Granted Jan 27, 2026
Patent 12534725
METHOD FOR CONTROLLING MICRORNA EXPRESSION
2y 5m to grant Granted Jan 27, 2026
Patent 12514901
AD36E4ORF1: A THERAPEUTIC TREATMENT FOR ALZHEIMER'S DISEASE
2y 5m to grant Granted Jan 06, 2026
Patent 12480116
USE OF LNCRNA XR_595534.2 IN PREPARATION OF MEDICINE FOR TREATMENT OR PREVENTION OF CHRONIC PAIN
2y 5m to grant Granted Nov 25, 2025
Patent 12467052
Striatin interacting protein inhibitor and use thereof in preparation of anti-tumor drug
2y 5m to grant Granted Nov 11, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
50%
Grant Probability
96%
With Interview (+45.8%)
4y 1m
Median Time to Grant
Low
PTA Risk
Based on 22 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month