DETAILED ACTION
Status of the Claims
Claims 1-15 are currently pending and are the subject of this Office Action.
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Rejections - 35 USC § 112(b) – Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4, 6, and 11 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 4 recites “wherein the cell is a microbial cell, in particular a gram positive bacterial cell”, claim 6 recites “wherein the cells show different levels of expression of the heterologous RNA due to culture conditions, in particular temperature, pressure and/or culture medium, chromosomal genetic alterations or genetic alterations in the vector”, and claim 11 recites “wherein the cell is a Gram positive bacterial cell from the genus Corynebacterium, in particular Corynebacterium glutamicum”, however, it is unclear if the term “in particular” makes the limitations mandatory or merely preferential.
Since it is unclear if the cells of claims 4 and 11 must be gram positive and Corynebacterium glutamicum, and what the specific culture conditions of claim 6 are, the metes and bounds of the claim are unascertainable.
As per MPEP 2173: It is of utmost importance that patents issue with definite claims that clearly and precisely inform persons skilled in the art of the boundaries of protected subject matter. Therefore, claims that do not meet this standard must be rejected under 35 U.S.C. 112(b) or pre-AIA 35 U.S.C. 112, second paragraph as indefinite. Further, as per MPEP 2173.02: If the language of the claim is such that a person of ordinary skill in the art could not interpret the metes and bounds of the claim so as to understand how to avoid infringement, a rejection of the claim under 35 U.S.C. 112, second paragraph, would be appropriate. As currently written, the metes and bounds of the rejected claims are unascertainable for the reasons set forth above, thus the above claim(s) and all dependent claims are rejected under 35 USC 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph.
Claim Rejections – 35 U.S.C. 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Wagner et al.
Claims 1, 3-6, 8-10, and 13-15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wagner et al. (PLoS ONE, 2018, 13(5):e0197420), as evidenced by Filonov et al. (Chem Biol., 2015; 22: 649-660).
Regarding claims 1, 3-5, and 10, Wagner discloses a cell and a method for optimizing the production of a heterologous RNA sequence of interest in a cell, comprising the steps of:
a) introducing into a plurality of cells a vector capable of expressing a heterologous RNA of interest (e.g., gene of interest as per Fig. 1 and 4), wherein said RNA is tagged with an RNA tag (e.g., the F30-2xdBroccoli RNA tag as per the Properties of the pTRA reporter plasmid section on p. 2) comprising
- an aptamer capable of stabilizing a fluorophore (e.g., DFHBI-1T as per Fig. 1 and 4) and
- a scaffold capable of stabilizing the aptamer (e.g., the F30 scaffold as per the Properties of the pTRA reporter plasmid section on p. 2);
b) culturing the cells in a culture medium under conditions that allow expression of the heterologous RNA of interest (e.g., E. coli cells as per the Strains and cultivation section on pp. 7-8);
c) adding said fluorophore to the culture medium (e.g., DFHBI-1T as per Fig. 1 and 4);
d) identifying those cells that show the highest intensity of fluorescence and therefore a high expression of the RNA of interest (e.g., using flow cytometry as per p. 4 and Fig. S3).
Regarding claim 6, Wagner discloses the above method, wherein the cells show different levels of expression of the heterologous RNA due to culture conditions, in particular temperature, pressure and/or culture medium, chromosomal genetic alterations or genetic alterations in the vector (e.g., as per S2 Fig.).
Regarding claims 7 and 12, Wagner discloses the above cell and method, wherein the Spinach aptamer comprises a sequence according to SEQ ID NO: 6 (e.g., see SEQ ID NO: 7 of Daròs).
Regarding claims 8 and 14, Wagner discloses the above cell and method, wherein the F30 RNA scaffold capable of stabilizing the aptamer comprises the sequence according to SEQ ID NO: 12 (e.g., see below, noting that Wagner references Filonov for the F30:Broccoli construct as per the Properties of the pTRA reporter plasmid section on p. 2).
Regarding claims 9 and 15, Wagner discloses the above cell and method, wherein the RNA tag comprises F30:Broccoli according to SEQ ID NO: 58 (e.g., see below, noting that Wagner references Filonov for the F30:Broccoli construct as per the Properties of the pTRA reporter plasmid section on p. 2).
Regarding claim 13, Wagner discloses the above cell, wherein the aptamer is capable of stabilizing the fluorophore DFHBI-1T (e.g., as per Fig. 1 and 4).
F30:Broccoli as per Spec (SEQ ID NO: 60):
UUGCCAUGUGUAUGUGGGAGACGGUCGGGUCCAGAUAUUCGUAUCUGUCGAGUAGAGUGUGGGCUCCCACAUACUCUGAUGAUCCNNNNGGAUCAUUCAUGGCAA
F30:Broccoli as per Filonov et al. (Figure S13 on p. 35):
UUGCCAUGUGUAUGUGGGAGACGGUCGGGUCCAGAUAUUCGUAUCUGUCGAGUAGAGUGUGGGCUCCCACAUACUCUGAUGAUCCUUCGGGAUCAUUCAUGGCAA
Daròs et al.
Claims 1, 3-4, 6-7, 10, and 12-13 are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Daròs et al. (U.S. PGPub 2017/0088871 A1).
Regarding claims 1, 3-4, and 10, Daròs discloses a cell and a method for optimizing the production of a heterologous RNA sequence of interest in a cell (e.g., as per para 0151-0156), comprising the steps of:
a) introducing into a plurality of cells a vector capable of expressing a heterologous RNA of interest (e.g., a recombinant RNA as per para 0151), wherein said RNA is tagged with an RNA tag (e.g., the ELVd molecule as per para 0151) comprising
- an aptamer capable of stabilizing a fluorophore (e.g., DFHBI as per para 0151) and
- a scaffold capable of stabilizing the aptamer (e.g., the ELVd molecule as per para 0151);
b) culturing the cells in a culture medium under conditions that allow expression of the heterologous RNA of interest (e.g., as per para 0152);
c) adding said fluorophore to the culture medium (e.g., DFHBI as per para 0151);
d) identifying those cells that show the highest intensity of fluorescence and therefore a high expression of the RNA of interest (e.g., as per Fig. 13).
Regarding claim 6, Daròs discloses the above method, wherein the cells show different levels of expression of the heterologous RNA due to culture conditions, in particular temperature, pressure and/or culture medium, chromosomal genetic alterations or genetic alterations in the vector (e.g., variations in the vector as per para 0154).
Regarding claims 7 and 12, Daròs discloses the above cell and method, wherein the Spinach aptamer comprises a sequence according to SEQ ID NO: 6 (e.g., see SEQ ID NO: 7 of Daròs).
Regarding claim 13, Daròs discloses the above cell, wherein the aptamer is capable of stabilizing the fluorophore DFHBI (e.g., as per para 0151).
Allowable Subject Matter
Claim 2 discloses a method for producing a heterologous RNA of interest, comprising the steps of
a) introducing into a plurality of cells a vector capable of expressing a heterologous RNA of interest, wherein said RNA is tagged with a RNA tag comprising an aptamer capable of stabilizing a fluorophore and a scaffold capable of stabilizing the aptamer;
b) culturing the cells in a culture medium under conditions that allow expression of the heterologous RNA of interest;
c) adding said fluorophore to the culture medium;
d) identifying and isolating those cells that show the highest intensity of fluorescence and therefore a high expression of the RNA of interest;
e) removing the first vector of step a) from the cells isolated in step d);
f) introducing a second vector capable of expressing the heterologous RNA of interest without the RNA tag into the cells obtained in step e);
g) producing the RNA of interest by culturing the cells obtained in step f).
Daròs and Wagner are considered to be the closest prior art, and would anticipate and/or render obvious the limitations of the claim for steps (a)-(d), neither of the references fairly teach or suggest the removal of the vector from the cells followed by introducing another vector into the same cells, nor does a thorough search of the prior art find any teaching, suggestion, or motivation to perform such steps. Accordingly, the claim is allowable.
Conclusion
Claim 2 is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JEREMY FLINDERS whose telephone number is (571)270-1022. The examiner can normally be reached M-F 10-6:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Heather Calamita can be reached on (571)272-2876. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JEREMY C FLINDERS/
Primary Examiner, Art Unit 1684