Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1-12, 18-22, 24-25 and 34 are pending.
Applicant’s election of Group I in the reply filed on December 24, 2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 1-12, 18-22, 24-25 and 34, drawn to a method of processing complexes, are being acted upon in this Office Action.
Priority
Applicant’ claim priority to provisional application 63/074,439, filed September 3, 2020, and 63/074,436, filed September 3, 2020 is acknowledged.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on December 24, 2025 has been considered by the examiner and an initialed copy of the IDS is included with this Office Action.
Drawings
The drawings filed on March 2, 2023 are acceptable.
Specification
The amendment to the specification filed on March 2, 2023 has been entered.
The lengthy specification has not been checked to the extent necessary to determine the presence of all possible minor errors. Applicant's cooperation is requested in correcting any errors of which applicant may become aware in the specification.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 11 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which applicant regards as the invention.
The term "gradually” in claim 11 is a relative term which renders the claim indefinite. The term “gradually” is not defined by the claim; the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. To obviate this rejection, the term “gradually” may be deleted from the claim.
Claim rejections under - 35 U.S.C. 112
The following is a quotation of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-12, 18-22, 24-25 and 34 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The Written Description Guidelines for examination of patent applications indicates, “the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical characteristics and/or other chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show applicant was in possession of the claimed genus.” (see MPEP 2163).
The claims are drawn to a method of processing complexes each comprising any antibody covalently linked to any one or more charge-neutral oligonucleotides, the method comprising
Claim 1 encompasses a method of processing complexes each comprising any antibody covalently linked to any one or more charge-neutral oligonucleotides, the method comprising:(i) contacting a mixture comprising an organic solvent, the complexes and unlinked charge-neutral oligonucleotides with a mixed-mode resin that comprises positively-charged metal sites and negatively charged ionic sites, under conditions in which the complexes adsorb to the mixed-mode resin, and (ii) eluting the complexes from the mixed-mode resin under conditions in which the complexes dissociate from the mixed-mode resin.
Claim 2 encompasses the method of any one of claims claim 1, wherein the organic solvent is Dimethylacetamide (DMA), isopropyl alcohol (IPA), dimethyl sulfoxide (DMSO), acetonitrile (ACN), or propylene glycol (PG).
Claim 3 encompasses the method of claim 1 or 2, wherein the organic solvent is at 5%-30% (v/v) in the mixture in step (i), optionally wherein the organic solvent is at 15% (v/v) in the mixture in step (i).
Claim 4 encompasses the method of any one of claims 1 3 claim 1,wherein the mixture in step (i) further comprises up to 10 mM phosphate ions and/or up to 20 mM chloride ions.
Claim 5 encompasses the method of any one of claims 1 4 claim 1,further comprising washing the mixed-mode resin between step (i) and step (ii) with a washing solution comprising an organic solvent, optionally wherein the organic solvent is Dimethylacetamide (DMA), isopropyl alcohol (IPA), dimethyl sulfoxide (DMSO), acetonitrile (ACN), or propylene glycol (PG).
Claim 6 encompasses the method of claim 5, wherein the organic solvent is at 5%-30% (v/v) in the washing solution, optionally wherein the organic solvent is at 15% (v/v) in the washing solution.
Claim 7 encompasses the method of claim 5 or claim 6, wherein the washing solution further comprises up to 10 mM phosphate ions and/or up to 20 mM chloride ions.
Claim 8 encompasses the method of claim 1,wherein step (ii) comprises applying an elution solution to the mixed-mode resin to elute the complexes, wherein the elution solution comprises an organic solvent, optionally wherein the organic solvent is Dimethylacetamide (DMA), isopropyl alcohol (IPA), dimethyl sulfoxide (DMSO), acetonitrile (ACN), or propylene glycol (PG).
Claim 9 encompasses the method of claim 8, wherein the organic solvent is at 10%-30% (v/v) in the elution solution, optionally wherein the organic solvent is at 10% (v/v) in the elution solution.
Claim 10encompasses the method of claim 8 or claim 9, wherein the elution solution comprises at least 30 mM phosphate ions, optionally wherein the elution solution comprises at least 100 mM phosphate ions.
Claim 11 encompasses the method of claim 8 or claim 9, wherein the elution solution comprises a gradually increasing concentration of phosphate ions, optionally wherein the concentration of the phosphate ions increases from at least 10 mM to at least 100 mM.
Claim 12 encompasses the method of any one of claims 8 11 claim 8,wherein the elution solution has a pH of 7.6-8.5.
Claim 18 encompasses a method of processing complexes each comprising an antibody covalently linked to one or more oligonucleotides, the method comprising:
contacting a mixture with a mixed-mode resin that comprises positively-charged metal sites and negatively charged ionic sites, under conditions in which the complexes adsorb to the mixed-mode resin, wherein the mixture comprises the complexes, unlinked oligonucleotides, and trace amounts of unlinked antibodies that comprise an alkyne group; and
eluting the complexes from the mixed-mode resin under conditions in which the complexes dissociate from the mixed-mode resins
wherein the mixture in step (i) is produced by a method comprising:
(a) obtaining a first intermediate comprising an oligonucleotide covalently linked to a cleavable linker comprising a valine-citrulline sequence;
(b) linking the first intermediate obtained in step (a) with a compound comprising a bicyclononyne to obtain a second intermediate; and
(c) linking the second intermediate obtained in step (b) to an antibody to obtain the complexes;
wherein the compound comprising the bicyclononyne is present in the reaction of step (c) in an amount that is less than 5% of the starting amount of the compound in step (b), optionally wherein the oligonucleotide is covalently linked to the cleavable linker comprising the valine- citrulline sequence at the 5' end and/or the antibody is linked via a lysine.
Claim 19 encompasses the method of claim 18, wherein the mixture in step (i) has not been subjected to previous purification.
Claim 20 encompasses the method of 18 or 19, wherein the mixture of step (i) comprises trace amounts of phosphate ions and/or chloride ions.
Claim 21 encompasses the method of claim 18, further comprising washing the mixed-mode resin between step (i) and step (ii) with a washing solution comprising up to 20 mM phosphate ions and/or up to 30 mM chloride ions, optionally wherein the solution comprises up to 10 mM phosphate ions and/or up to 25 mM chloride ions.
Claim 22 encompasses the method of claim 21, wherein the washing solution has a pH of 5.0-7.6.
Claim 23 encompasses the method of claim 18,wherein step (ii) comprises applying an elution solution comprising at least 30 mM phosphate ions and/or at least 50 mM chloride ions to the mixed-mode resin to elute the complexes, optionally wherein the elution solution comprises at least 100 mM phosphate ions and/or at least 100 mM chloride ions.
Claim 25 encompasses the method of claim 24, wherein the elution solution has a pH of 7.5-8.5.
The specification defines antibody as follow:
[0051] Antibody: As used herein, the term “antibody” refers to a polypeptide that includes at least one immunoglobulin variable domain or at least one antigenic determinant, e.g., paratope that specifically binds to an antigen. In some embodiments, an antibody is a full-length antibody, e.g., a full-length IgG. In some embodiments, an antibody is a chimeric antibody. In some embodiments, an antibody is a humanized antibody. However, in some embodiments, an antibody is a Fab fragment, a F(ab′)2 fragment, a Fv fragment or a scFv fragment. In some embodiments, an antibody is a nanobody derived from a camelid antibody or a nanobody derived from shark antibody. In some embodiments, an antibody is a diabody. In some embodiments, an antibody comprises a framework having a human germline sequence. In another embodiment, an antibody comprises a heavy chain constant domain selected from the group consisting of IgG, IgG1, IgG2, IgG2A, IgG2B, IgG2C, IgG3, IgG4, IgA1, IgA2, IgD, IgM, and IgE constant domains. In some embodiments, an antibody comprises a heavy (H) chain variable region (abbreviated herein as VH), and/or a light (L) chain variable region (abbreviated herein as VL). In some embodiments, an antibody comprises a constant domain, e.g., an Fc region. An immunoglobulin constant domain refers to a heavy or light chain constant domain. Human IgG heavy chain and light chain constant domain amino acid sequences and their functional variations are known. With respect to the heavy chain, in some embodiments, the heavy chain of an antibody described herein can be an alpha (a), delta (A), epsilon (E), gamma (γ) or mu (p) heavy chain. In some embodiments, the heavy chain of an antibody described herein can comprise a human alpha (a), delta (A), epsilon (E), gamma (γ) or mu (p) heavy chain. In a particular embodiment, an antibody described herein comprises a human gamma 1 CH1, CH2, and/or CH3 domain. In some embodiments, the amino acid sequence of the VH domain comprises the amino acid sequence of a human gamma (γ) heavy chain constant region, such as any known in the art. Non-limiting examples of human constant region sequences have been described in the art, e.g., see U.S. Pat. No. 5,693,780 and Kabat E A et al., (1991) supra. In some embodiments, the VH domain comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to any of the variable chain constant regions provided herein. In some embodiments, an antibody is modified, e.g., modified via glycosylation, phosphorylation, sumoylation, and/or methylation. In some embodiments, an antibody is a glycosylated antibody, which is conjugated to one or more sugar or carbohydrate molecules. In some embodiments, the one or more sugar or carbohydrate molecule are conjugated to the antibody via N-glycosylation. O-glycosylation, C-glycosylation, glypiation (GPI anchor attachment), and/or phosphoglycosylation. In some embodiments, the one or more sugar or carbohydrate molecule are monosaccharides, disaccharides, oligosaccharides, or glycans. In some embodiments, the one or more sugar or carbohydrate molecule is a branched oligosaccharide or a branched glycan. In some embodiments, the one or more sugar or carbohydrate molecule includes a mannose unit, a glucose unit, an N-acetylglucosamine unit, an N-acetylgalactosamine unit, a galactose unit, a fucose unit, or a phospholipid unit. In some embodiments, an antibody is a construct that comprises a polypeptide comprising one or more antigen binding fragments of the disclosure covalently linked to a linker polypeptide or an immunoglobulin constant domain. Linker polypeptides comprise two or more amino acid residues joined by peptide bonds and are used to link one or more antigen binding portions. Example linker polypeptides have been reported (see e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R. J., et al. (1994) Structure 2:1121-1123). Still further, an antibody may be part of a larger immunoadhesion molecule, formed by covalent or noncovalent association of the antibody or antibody portion with one or more other proteins or peptides. Examples of such immunoadhesion molecules include use of the streptavidin core region to make a tetrameric scFv molecule (Kipriyanov, S. M., et al. (1995) Human Antibodies and Hybridomas 6:93-101) and use of a cysteine residue, a marker peptide and a C-terminal poly histidine tag to make bivalent and biotinylated scFv molecules (Kipriyanov, S. M., et al. (1994) Mol. Immunol. 31:1047-1058).
Regarding “charge-neutral oligonucleotide”, the specification defines as follow:
[0088] Charge-neutral oligonucleotide: As used herein, the term “charge-neutral oligonucleotide” refers to oligonucleotide analogs comprising charge-neutral backbones at a physiological pH (e.g., pH 7.35-pH 7.45). Examples of charge-neutral oligonucleotides include, without limitation, phosphorodiamidate morpholino oligomers (PMOs) and peptide nucleic acids (PNA), e.g., as described in Jarver et al., (Nucleic Acid Therapeutics, Vol. 25, No. 2, 2015), incorporated herein by reference.
Regarding “organic solvent”, the specification discloses:
[0089] Organic Solvent: As used herein, the term “organic solvent” refers to a carbon-based substance that is capable of dissolving other substances. By being carbon based, organic solvents have carbon atoms present in the structure of their compound. Non-limiting examples of organic solvents that can be used in accordance with the present disclosure include, without limitation, Dimethylacetamide (DMA), isopropyl alcohol (IPA), dimethyl sulfoxide (DMSO), acetonitrile (ACN), or propylene glycol (PG).
[0126] Organic solvents commonly used in chromatography methods can be used throughout the methods described herein. In some embodiments, the organic solvent used in step (i) of the methods of processing complexes described herein is Dimethylacetamide (DMA), isopropyl alcohol (IPA), dimethyl sulfoxide (DMSO), acetonitrile (ACN), or propylene glycol (PG). In some embodiments, the organic solvent used in step (i) of the methods described herein is Dimethylacetamide (DMA). In some embodiments, the organic solvent used in step (i) of the methods described herein is isopropyl alcohol (IPA). In some embodiments, the organic solvent used in step (i) of the methods described herein is dimethyl sulfoxide (DMSO). In some embodiments, the organic solvent used in step (i) of the methods described herein is acetonitrile (ACN). In some embodiments, the organic solvent used in step (i) of the methods described herein is propylene glycol (PG).
Thus, the claims encompass a method of processing complexes each comprising any antibody covalently linked to any one or more charge-neutral oligonucleotide or any one or more oligonucleotide using a mixed-mode resin (hydroxyapatite resin) in any conditions and methods of making said complexes.
Regarding antibody, the specification discloses mouse transferrin receptor antibody. The heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 33 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 34. The six CDRs are shown in Table 3.
The humanized anti-TfR antibody comprises a heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 35 and a light chain variable region comprises the amino acid sequence of SEQ ID NO: 36.
The specification discloses several alternative strategies for the purification of the crude mixture of a complex comprising anti-TfR Fab covalently linked to oligonucleotide, unlinked oligonucleotide, and unlinked anti-TfR Fab from Example 1 were examined, including cation exchange (CEX) and anion exchange (AEX) resins. It was found that none of the alternative strategies was as effective as the approach described here (using ceramic hydroxyapatite resin).
The specification exemplifies Synthesis of a Complex Comprising an Antibody Linked to a Charge-Neutral Oligonucleotide (Conjugation Method 2—Two Step Conjugation)
[0505] A muscle-targeting complex was generated comprising an oligonucleotide (e.g., a charge-neutral oligonucleotide) covalently linked, via a cathepsin cleavable linker, to an anti-transferrin (anti-TfR) receptor Fab antibody. Anti-TfR Fabs can be recombinantly produced (e.g., in CHO cells) and purified. The oligonucleotide used is a phosphorodiamidate morpholino oligomer (PMO) that is 30 nucleotides in length.
[0506] The anti-TfR Fab was diluted with propylene glycol to a final concentration of 40% v/v propylene glycol and incubated with 5-fold molar excess of endo-BCN-PEG3-PFP (endo-bicyclononyne-PEG3-pentafluorophenyl, dissolved in DMSO at a concentration of 20 mg/mL] for 2 hr at room temperature (˜22.5° C.). It was anticipated that labeling should yield 2.0-2.5 moles of BCN per mole of Fab. Post labeling, the reaction product was sterile filtered or depth filtered to remove precipitated BCN. The filtered solution was then assayed for average reactive BCN moieties analytically using LCMS (ThermoFisher MAbPac RP 4 um 2.1×100 mm, #088647; mobile phase A 0.1% formic acid in 100% UPLC-grade water, mobile phase B 0.1% formic acid in 100% UPLC-grade acetonitrile; flow rate 0.3 mL/min; column temperature 70° C.; in-source CID 20 eV; positive polarity; spray voltage 3.5 kV; scan range 1000-3000 m/z).
[0507] Anti-TfR having a degree of labeling (D0L) of >2.3 was taken to the next step of the conjugation, and was purified into 10% isopropanol in PBS at pH 7.2 by tangential flow filtration using a 10 kDa molecular weight cutoff (1.2 bar), with 5 filtrate volumes, to remove free BCN and propylene glycol. Complete removal of BCN and propylene glycol was verified by analytical HPLC-SEC (Waters Xbridge Protein BEH SEC 3.5 um, 7.8×300 mm, 0.3 mL/min, 100 mM PO.sub.4, 100 mM NaCl, 15% v/v acetonitrile pH 7.0). SEC traces of the crude and purified products are shown in FIG. 8. The recovery of BCN-labeled anti-TfR was >90% of starting material. The purified solution was concentrated to 3.5 mg/mL for further conjugation steps.
[0508] In a separate reaction, the oligonucleotide (e.g., a charge-neutral oligonucleotide) was conjugated to a linker molecule. The oligonucleotide was dissolved at 35 mg/mL in anhydrous DMSO at 37° C. The linker molecule (azide-PEG3-Val-Cit-PAB-PNP) was dissolved at 40 mg/mL in anhydrous DMF and was added at 2.7-fold molar excess to the oligonucleotide with 3-fold molar excess of N,N-Diisopropylethylamine (DIPEA). This linker conjugation reaction was allowed to proceed for 2 hours at room temperature (˜22.5° C.). Progress and completion of the reaction was measured using a ninhydrin assay (Kaiser test) prior to quenching the reaction via acetone precipitation.
[0509] Precipitation was conducted by adding 8 volumes of chilled acetone to the product solution, and the precipitate was pelleted by centrifugation at 3500×g at 8° C. for 20 minutes. The pellet was then washed with 3 volumes of acetone to remove remaining free linker and was centrifuged again at 3500× g at 8° C. for 20 minutes. The purified oligonucleotide-linker was then dissolved in 20% v/v acetonitrile in nuclease-free water at a concentration of 30 mg/ml. The concentration and yield were measured by optical density (OD) in 0.1N HCl, demonstrating a yield of greater than 90%. Analytical RP-HPLC was conducted (Waters BEH-C18, 4.6 mm×150 mm, 0.5 mL/min. 5-90% v/v acetonitrile in water, 30 minute run time) on the crude linker/oligonucleotide conjugation reaction product (FIG. 9) and the purified oligonucleotide-linker (FIG. 10) to confirm removal of free linker by the precipitation and washing steps. Confirmatory LCMS of the purified oligonucleotide-linker was also conducted (FIG. 11).
[0510] To conjugate the anti-TfR and the oligonucleotide, BCN-labeled antibody was mixed with 5-fold molar excess of oligonucleotide-PAB-VC-PEG3-azide (FIG. 1A) in a glass bottle overnight at room temperature (˜22.5° C.).
[0511] Completion of the reaction was evaluated by SDS-PAGE (FIG. 12) and analytical SEC analysis (FIG. 13), which demonstrated less than 10% unlinked anti-TfR antibody (DAR0) and a 90% coupling efficiency by densitometry.
Example 8. Conjugation Process for Preparation of a Fab-Oligonucleotide (Charge-Neutral Oligonucleotide) Conjugate
(Conjugation Method 1—Pre-Reaction Conjugation)
[0512] This example describes the preparation of a conjugate composed of an oligonucleotide covalently linked via a val-cit cathepsin cleavable peptide linker to an anti-transferrin receptor (anti-TfR) Fab antibody. Anti-TfR Fabs can be recombinantly produced (e.g., in CHO cells) and purified. The oligonucleotide used is a phosphorodiamidate morpholino oligomer (PMO) that is 30 nucleotides in length. Prior to the conjugation with the Fab, an intermediate containing the oligonucleotide and the linker is generated via a copper-free 3+2 click reaction between the azide group of an oligonucleotide-PAB-VC-PEG3-azide molecule (FIG. 1A) and the strained bicyclononyne moiety on an endo-BCN-PEG4-PFP ester (FIG. 1B) heterobifunctional crosslinker (“the pre-reaction”). Lyophilized oligonucleotide-PAB-VC-PEG3-azide (98.1 mg) was solubilized in a 4 mL glass Wheaton vial in 0.32 mL of MilliQ water. Following solubilization, 0.32 mL of N,N-dimethylacetamide (DMA) was added and the mixture was gently agitated for 5-10 minutes. Prior to continuing, the vial was inspected carefully to ensure the oligonucleotide-PAB-VC-PEG3-azide was completely dissolved and no residue remained on the walls of the glass vial. The concentration of the oligonucleotide-PAB-VC-PEG3-azide stock solution in 1:1 DMA:water was determined with a Nanodrop UV/vis instrument by using aliquots diluted 25-, 50-, and 100-fold in 1:1 DMA:water containing a final concentration of 0.1 M HCl at 265 nm, using an extinction coefficient of 318,050 M.sup.−1 cm.sup.−1. The HCl was added to ensure accuracy of the concentration measurement. The calculated concentration at each dilution was averaged to determine the solution concentration of 10.1 mM.
[0513] A 32.5 mg/mL (53.5 mM) stock solution of endo-BCN-PEG4-PFP ester was prepared by weighing approximately 25 mg of endo-BCN-PEG4-PFP ester oil into a 4 mL glass Wheaton vial. The appropriate volume of DMA was then added to afford the 32.5 mg/mL stock solution.
[0514] The pre-reaction was conducted with the following final solution reaction conditions: 5.87 μM (6.5 μmol) oligonucleotide-PAB-VC-PEG3-azide, 5.34 mM endo-BCN-PEG4-PFP ester (1.1:1.0 mol:mol equivalents) in 60:40 v/v % DMA to 25 mM 2-(N-morpholino)ethanesulfonic acid (MES) pH 5.5 buffer at room temperature. The reaction was set-up in a 4 mL glass Wheaton vial by adding the appropriate amounts of the reactants and stock solutions as indicated in Table 6. The total final volume of the pre-reaction was 1.11 ml.
Example 9. Purification of Anti-TfR Fab-Oligonucleotide Conjugate
[0520] Following synthesis of the anti-TfR Fab-oligonucleotide conjugate described in Example 8, a two-part purification process was conducted. First, free payload was removed by hydroxyapatite (HA) chromatography. The HA eluate was then buffer exchanged into the final formulation. At the 45 mg scale of Fab, the final buffer exchange was performed with a 30 kDa centrifugal filter device. Prior to loading onto the HA column, the crude reaction product from Example 8 (anti-TfR Fab-oligonucleotide conjugate) was diluted and the pH adjusted from 7.5 to 5.7. First, the 7.5 mL of crude conjugate was diluted by addition of 16.5 mL of 15 v/v % DMA in water and the solution was thoroughly mixed. To this mixture, 0.75 mL of 500 mM MES (pH 3.3) was added to adjust the pH down to 5.7.
[0521] Chromatographic purification to remove unreacted oligonucleotide species was performed using a 5 mL Bio Rad CHT Type I (ceramic hydroxyapatite) cartridge on an AKTA Pure chromatography system. Prior to loading the diluted conjugate pool from the reaction mixture preparation step, the CHT cartridge was prepared and equilibrated according to the manufacturer's instructions using 15:85 v/v % of DMA to 10 mM sodium phosphate, pH 5.8 buffer. Following equilibration, the conjugate pool was loaded at a flow rate of 5 mL/min. After loading the conjugate, the column was washed for a minimum of 7 CV with 15:85 v/v % of DMA in 10 mM sodium phosphate buffer (pH 5.8). After completion of the wash, elution was initiated via a step gradient with 100 mM sodium phosphate, pH 7.6 buffer containing DMA at 15:85 v/v % at a flow rate of 5 mL/min. The entire elution peak, identified by monitoring at 260 nm and 280 nm, was collected and pooled.
[0522] Analysis of the flow through during the HA column loading step by SEC (FIG. 16) indicated the presence of little to no Fab-oligonucleotide conjugate in the flow-through. Only peaks due to oligonucleotide payload species were observed, at ˜10.5 and ˜11.3 minutes. Conversely, SEC analysis of the pooled elution peak shows only conjugate species (FIG. 17), with multiple peaks and shoulders due to the size differences of the conjugates with different oligonucleotide (e.g., PMO) payload loadings. No peaks for payload species at 10.5 or 11.3 minutes were observed.
However, the specification does not disclose a representative number of species of such antibodies and oligonucleotides or charge-neutral oligonucleotides that are used in the claimed methods, nor sufficient relevant identifying characteristics in the form of structure or functional characteristics coupled with a known or disclosed correlation between structure and function. The disclosure of just anti-TfR Fab covalently linked to phosphorodiamidate morpholino oligomer (PMO) that is 30 nucleotides in length via a linker comprising PAB-VC-PEG3-azide and BCN-PEG4-PFP together as shown in Formula D in claim 34 is not representative of the genus of antibody covalently linked to one or more charge-neutral oligonucleotides or oligonucleotides payload. The specification does not describe where and what amino acid within the full-length sequence of which antibody heavy chain and light chain variable domains to be substitute, added, deleted or a combination thereof such that the modified antibody when covalently linked to which one or more unspecified charge-neutral oligonucleotides (claims 1-12) or any one or more oligonucleotides (claims 18-22, 24, 34) is effective for delivering molecular payloads (e.g., oligonucleotides) that modulate expression or activity of target genes in muscle cells, e.g., in a subject having or suspected of having a muscle disease, such as rare muscle diseases, including myotonic dystrophy (e.g., myotonic dystrophy type 1), Facioscapulohumeral muscular dystrophy (FSHD), Pompe disease, Centronuclear myopathy, Fibrodysplasia Ossificans Progressiva, Friedreich's ataxia, and Duchenne muscular dystrophy. Clearly, just any oligonucleotides or charge-neutral oligonucleotides covalently linked to any antibody will not predictably function to modulate expression or activity of any and all genes in muscle cells, e.g., in a subject having or suspected of having a muscle disease, such as rare muscle diseases, including myotonic dystrophy (e.g., myotonic dystrophy type 1), Facioscapulohumeral muscular dystrophy (FSHD), Pompe disease, Centronuclear myopathy, Fibrodysplasia Ossificans Progressiva, Friedreich's ataxia, and Duchenne muscular dystrophy. The specification does not disclose, and the art does not teach, the genus as broadly encompassed in the claims.
Regarding conditions for purifying any and all possible antibody covalently linked to any oligonucleotides via any linkers, Wiener et al (Scientific Reports 10: 1457, 2020; PTO 892) teaches that one bottleneck in the development of antibody-oligonucleotide conjugates is the conjugation reaction between the two molecules. All antibodies and oligonucleotides have to be functionalized first with the respective reactive chemical group. Despite the vast variety of commercially-available crosslinking reagents, the oligonucleotide labeling of antibodies is not robust. The reason for this is multilayered, including problems related to a loss in the specificity of the antibody due to the masking of the antigen binding site, a change in polarity upon the addition of the reactive conjugation group and oligonucleotide, and a lack of purification methods for the removal of excess oligonucleotides, which increases the rate of false positive errors. Another problem is that antibody-oligonucleotide conjugation is a consecutive reaction with a heterogeneous outcome of single-, multiple-, and non-labeled antibodies depending on the reaction conditions. The temperature, time, and molar stoichiometries of the antibody and oligonucleotide make the conjugation reaction a multiparameter optimization problem.
Wiener further teaches that the yield and product types of the click reaction are dependent on the number of factors, including the click conjugation reaction of antibodies with oligonucleotides, the crosslinker used, reaction temperature, duration, oligonucleotide length, and secondary structure and the removal of excess click reagents after antibody and oligonucleotide functionalization, see entire document, abstract, p. 2.
For example, an increased number of click functional group, e.g., DBCO molecules conjugated to the antibody reduces its solubility. Typically crosslinkers are dissolved in organic solvent such as dimethyl sulfoxide (DMSO), see p. 3. Removal of excess click reagents after antibody and oligonucleotide functionalization was essential for increasing the yield of the subsequent click reaction by reducing the occurrence of unwanted reactions with left-over reactants.
Regarding oligonucleotide length and secondary structure, Wiener further teaches that secondary structure within the oligonucleotide reduced the fraction of single oligonucleotide conjugate antibody by about 56%, see Figure 4, in particular. Antibody conjugated to oligonucleotides with a length of 64 nt exhibited an increased background signal in IF and PLA compared to the same antibodies conjugated with an oligonucleotide of 32 nt length. Thus, the specification does not disclose a representative number of species of charge-neutral oligonucleotides or oligonucleotides covalently linked to antibody comprising any cleavable linker comprising a valine-citrulline sequence to be used for treating muscle disease in the claimed methods. Given the lack of guidance as to the binding specificity of the antibody and sequence specificity of the oligonucleotide, and the delivery of oligonucleotides to targeted tissues, one of skill in the art would conclude that the specification fails to disclose a representative number of species of antibody-oligonucleotide conjugates to describe the genera encompassed by the claimed methods at the time of filing.
Vas-Cath Inc. v. Mahurkar, 19 USPQ2d 1111, makes clear that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the written description inquiry, whatever is now claimed.” (See page 1117.) The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.” (See Vas-Cath at page 1116.).
Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method for isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (CAFC 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016.
One cannot describe what one has not conceived. See Fiddles v. Baird, 30 USPQ2d 1481, 1483. In Fiddles v. Baird, claims directed to mammalian FGF’s were found unpatentable due to lack of written description for the broad class. The specification provided only the bovine sequence. Thus, the specification fails to describe these DNA sequences.
For genus claims, an adequate written description of a claimed genus requires more than a generic statement of an invention's boundaries. A patent must set forth either a representative number of species falling within the scope of the genus or structural features common to the members of the genus. Kubin, Exparte, 83 USPQ2d 1410 (Bd. Pat. App. & Int. 2007); Ariad Pharms., Inc. v. Eli Lilly& Co., 598 F.3d 1336, 1350 (Fed. Cir. 2010).
Therefore, only (1) a method of processing complexes each comprising a Fab that binds to transferrin receptor covalently linked to one or more phosphorodiamidate morpholino oligonucleotide (PMO) that is 30 nucleotides in length, the method comprises: (1) contacting a mixture comprising an organic solvent, the complexes and unlinked PMOs with a ceramic hydroxyapatite resin that comprises positively-charged metal sites and negatively charged ionic sites, under condition in which the complexes absorb to the resin, (ii) eluting the complexes with a step gradient of 100 mM sodium phosphate, pH 7.6 buffer containing dimethylacetamide (DMA) at 15:85 v/v %, (2) the method above further comprising washing the resin between step (i) and step (ii) with a washing solution comprising 15:85 v/v % of DMA in 10 mM sodium phosphate buffer at pH 5.8, (3) the method above wherein the mixture in step (i) is produced by a method comprising (a) obtaining a first intermediate comprising reacting one or more phosphorodiamidate morpholino oligomer (PMO) that is 30 nucleotides in length with a cleavable linker comprising PAB-VC-PEG3-azide (b) linking the first intermediate comprising PMO-PAB-VC-PEG3-azide molecule obtained in step (a) with a compound comprising endo-bicyclononyne (BCN)-PEG3-pentafluorophenyl ester (endo-BCN-PEG3-PFP) to obtain a second intermediate, and (c) linking the second intermediate in step (b) to an antibody or antigen binding fragment thereof that binds to transferrin receptor to obtain the complexes; wherein the compound comprising BCN is present in the reaction of step (c) in an amount that is less than 5% of the starting amount of the compound in step (b), wherein the PMOs are linked to the cleavable linker comprising the valine-citrulline sequence at the 5’ end of the PMOs and the antibody is linked via a lysine, wherein the antibody or antigen binding fragment thereof comprises a heavy chain variable region and a light chain variable region wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 33 or SEQ ID NO: 35 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 34 or SEQ ID NO: 36, but not the full breadth of the claims meets the written description provision of 35 U.S.C. § 112, first paragraph.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102 of this title, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a).
Claims 1-4, 7, 10 and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Nadkarni (WO2017109619 publication, of record, published June 29, 2017; PTO 892) in view of Geall (US20210095283, of record, claimed earliest priority to 62/613,742, filed January 4, 2018; PTO 892) and Gagnon et al (Current Pharmaceutical Biotechnology 10: 440-446, 2009; PTO 1449).
Claim 1 recites a method of processing complexes each comprising an antibody covalently linked to one or more charge-neutral oligonucleotides, the method comprising: (i) contacting a mixture comprising an organic solvent, the complexes and unlinked charge- neutral oligonucleotides with a mixed-mode resin that comprises positively-charged metal sites and negatively charged ionic sites, under conditions in which the complexes adsorb to the mixed-mode resin, and (ii) eluting the complexes from the mixed-mode resin under conditions in which the complexes dissociate from the mixed-mode resin.
Regarding claims 1 and 2, Nadkarni teaches and claims a method for purifying antibody drug conjugate (ADC) monomers from aggregates in an ADC preparation containing an organ solvent, e.g., dimethyl sulfoxide (DMSO, see reference claims 27-28, p. 8, lines 15-16,), one or more additional impurities selected from unconjugated payload molecules, species originating from the payload, quench reagents, reducing agents and reducing agent byproducts (reference claim 52), said method comprising the steps of: (i) loading an ADC preparation onto a hydroxyapatite resin column (aka mixed-mode resin), (ii) washing said hydroxyapatite resin column with a low concentration of sodium phosphate buffer; and (iii) eluting said ADC preparation through said column with a gradually increasing concentration of said sodium phosphate buffer, whereby purified ADC monomers are separated from said aggregates (see reference claim 1), wherein the washing buffer is about 5 to 35 mM of sodium phosphate, see reference claim 14), wherein the concentration of sodium phosphate in the eluting step gradually increases from about 5 to 35 mM to about 130 to 150 mM, see entire document, abstract, reference claim 15. Examples of ADCs include anti-Notch 3 ADCs, see p. 2, line 25, in particular. Examples of various payloads or drugs include mismatched double stranded RNA (p. 15, line 9), oligonucleotides (p. 15, line 18), antisense oligonucleotides (p. 14, line 2-3, sense oligonucleotides (p. 16, line 2).
Regarding claim 3, Nadkarni teaches that method is able to remove the organic solvents from the ADC preparation from approximately 11% to less than the limit of detection by analytical technique.
Regarding claim 12, Nadkarni teaches that the elution solution pH may be from 6.8 to 7.3, may be 7, 7.5, or 8, see p. 22, line 22-25.
Nadkarni does not teach the antibody covalently linked to one or more charge-neutral oligonucleotides (aka phosphorodiamidate morpholino oligomers or PMOs) as per claim 1.
However, Geall teaches antibody conjugated to PMO, e.g., mAb-SMCC-3′amine-0 PMO with the guide strand siRNA, e.g., UUACAUUAAAGUCUGUUGUUU, see entire document, para. [0378]. Examples of antibodies include anti-EGFR mAb (para. [0394] to [0395]) or anti-transferrin receptor antibody (para. [0392] to [0393] conjugated to one or more charge-neutral oligonucleotides, e.g., phosphorodiamidate morpholino oligomers (PMO) RNA heteroduplex (aka charge-neutral oligonucleotides), see para. [0081] to [0083], Example 2.2, 2.5 Conjugates, in particular. Geall teaches PMO chemistry on the passenger strand of the duplex (RNA/PMO heteroduplex) results in improved pharmacokinetic properties of antibody conjugates, see para. [0431]).
Gagnon teaches antibody aggregate can be removed by hydroxyapatite (HA) chromatography, see entire document, abstract, p. 441, in particular. Gagnon teaches that majority of the antibody applications have employed elution with simple phosphate gradients. Phosphate’s strong affinity for calcium allows it to control metal affinity interactions, see p. 441, left col. Sodium chloride gradients in the presence of low phosphate concentrations have been demonstrated to extend the range of IgG monoclonal antibodies from which hydroxyapatite (HA) can remove aggregates, see paragraph bridging p. 442 and 443. Gagnon further teaches that phosphate gradients represent the simplest application format for HA. Table 2 identifies buffers and screening conditions for chloride/phosphate gradients. MES is added because of the low buffer capacity of 5 mM phosphate. In the event that a given IgG does not elute at 5 mM phosphate, increase the phosphate concentration to 10 mM and repeat, see paragraph bridging p. 443-444.
Claims 4, 7 and 10 are included because it is within the purview of one of ordinary skill in the art to optimize by increasing the amount of phosphate or chloride ions in the mixture, washing solution and elution solution of Nadkarni by adjusting the concentrations of NaCl and sodium phosphate. Doing so is merely optimizing through routine experimentation. It has long been settled to be no more than routine experimentation for one of ordinary skill in the art to discover an optimum value of a result effective variable. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum of workable ranges by routine experimentation." Application of Aller, 220 F.2d 454, 456, 105 USPQ 233, 235-236 (C.C.P.A. 1955). "No invention is involved in discovering optimum ranges of a process by routine experimentation." Id. at 458, 105 USPQ at 236-237. The "discovery of an optimum value of a result effective variable in a known process is ordinarily within the skill of the art." Application of Boesch, 617 F.2d 272, 276, 205 USPQ 215, 218-219 (C.C.P.A. 1980).
In view of the combined teachings of the references, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filling date of the claimed invention to use the Ceramic hydroxyapatite (cHA) mixed-mode resin of Nadkarni or Gagnon to process or purify the antibody-PMO conjugate/complex of Geall in order to remove any impurities, including unlinked oligonucleotide, organic solvent DMSO, unlinked antibodies and aggregates, etc. from the preparation.
One of ordinary skill in the art would have been motivated with a reasonable expectation to do so because Nadkarni teaches that organic solvents and small molecules impurities such as payload do not bind to the hydroxyapatite resin under elution conditions and these impurities elute early in the wash portion (Table 1 ) of the purification after the column loading (see Figure 1 ). This enables easy separation of these impurities from the ADC molecules.
One of ordinary skill in the art would have been motivated with a reasonable expectation to do so because Nadkarni teaches that ceramic hydroxyapatite (cHA) has high durability, good protein binding capacity, and can be used at higher flow rates and pressures than crystalline hydroxyapatite.
One of ordinary skill in the art would have been motivated with a reasonable expectation to do so because Gagnon teaches antibody aggregate can be removed by hydroxyapatite (HA) chromatography, and phosphate buffer is often used for the process, see entire document, abstract, p. 441, in particular.
A person of ordinary skill in the art is always motivated to pursue the known options within her or his technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. KSR Int’l Co. v. Teleflex Inc., 550 U.S. 398, 416 (2007).
“The test of obviousness is not express suggestion of the cl aimed invention in any or all of the references but rather what the references taken collectively would suggest to those of ordinary skill in the art presumed to be familiar with them.” See In re Rosselet 146 USPQ 183, 186 (CCPA 1965).
“There is no requirement (under 35 USC 103(a)) that the prior art contain an express suggestion to combine known elements to achieve the claimed invention. Rather, the suggestion to combine may come from the prior art, as filtered through the knowledge of one skilled in the art.,” Motorola, Inc, v. Interdigital Tech. Corn., 43 USPQ2d 1481, 1489 (Fed. Cir. 1997).
Accordingly, the claimed invention as a whole was prima facie obvious to one of ordinary skill in the art before the effective filling date of the claimed invention especially in the absence of evidence to the contrary.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the claims at issue are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO internet Web site contains terminal disclaimer forms which may be used. Please visit http://www.uspto.gov/forms/. The filing date of the application will determine what form should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 1-12, 18-22, 24-25 and 34 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 29 of copending Application No. 17/616,870 (hereinafter US20220306685). Although the claims at issue are not identical, they are not patentably distinct from each other because reference teaches and claims the same methods.
PNG
media_image1.png
233
850
media_image1.png
Greyscale
PNG
media_image2.png
245
818
media_image2.png
Greyscale
methods of isolating a complex or plurality of complexes each comprising an antibody covalently linked to one or more oligonucleotides, the method comprising:
(i) contacting a mixture comprising the complexes and unlinked oligonucleotides with a mixed-mode resin that comprises positively-charged metal sites and negatively charged ionic sites, under conditions in which the complexes adsorb to the mixed-mode resin, and
(ii) eluting the complexes from the mixed-mode resin, e.g., ceramic hydroxyapatite resin under conditions in which the complexes dissociate from the mixed-mode resin, see para. [0022] to [0023].
Typical oligonucleotides include phosphorodiamidate morpholino oligomer (PMO), which is charge neutral oligonucleotides, see p. 90-93, para. [0028].
The reference teaches the claimed method, see p. 33-39.
The mixture in step (i) is produced by combining the reference oligonucleotide with a val-cit linker that has the claimed structure:
PNG
media_image3.png
523
820
media_image3.png
Greyscale
The reference n is 0-10 encompasses the claimed range of n is 3.
The oligonucleotide-linker above is further react with endo-BCN-PEGn0-10-PFP ester
PNG
media_image4.png
124
260
media_image4.png
Greyscale
to produce the claimed structure of formular D below:
PNG
media_image5.png
260
835
media_image5.png
Greyscale
And contacting the product of Formula D with a transferrin receptor antibody covalently linked to an oligonucleotide via a Val-cit linker to produce the claimed structure:
PNG
media_image6.png
317
948
media_image6.png
Greyscale
, see p. 104-105, 109, para. [00371] to [00389].
[0024] In some embodiments, the mixture in step (i) further comprises up to 20 mM phosphate ions and/or up to 30 mM chloride ions, optionally wherein the mixture in step (i) further comprises up to 10 mM phosphate ions and/or up to 25 mM chloride ions. In some embodiments, the unlinked oligonucleotide does not adsorb to the mixed-mode resin in step (i).
[0025] In some embodiments, the mixture in step (i) further comprises up to 5 mM phosphate ions and/or up to 10 mM chloride ions, optionally wherein the mixture in step (i) further comprises up to 3 mM phosphate ions and/or up to 8 mM chloride ions.
Thus, the reference method reads on the methods of the instant claims.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
Claims 18-21, 24-25 and 34 are free of prior art.
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to PHUONG HUYNH whose telephone number is (571)272-0846. The examiner can normally be reached on 9:00 a.m. to 6:30 p.m. The examiner can also be reached on alternate alternative Friday from 9:00 a.m. to 5:30 p.m.
If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Misook Yu, can be reached at 571-270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-272-0839.
Information regarding the status of an application may be obtained from Patent Center. Status information for published applications may be obtained from Patent Center. Status information for unpublished applications is available through Patent Center for authorized users only. Should you have questions about access to Patent Center, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) Form at https://www.uspto.gov/patents/uspto-automated- interview-request-air-form.
/PHUONG HUYNH/ Primary Examiner, Art Unit 1641