Prosecution Insights
Last updated: July 17, 2026
Application No. 18/024,593

MOLECULAR MARKER OF CADMIUM ACCUMULATION IN RICE AND USE THEREOF IN IMPROVING CADMIUM ACCUMULATION IN RICE GRAINS

Non-Final OA §103§112
Filed
Mar 03, 2023
Priority
Sep 04, 2020 — CN 202010919701.0 +1 more
Examiner
DELEO, VICTORIA LYNN
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Yueyang Agricultural Research Institute
OA Round
3 (Non-Final)
37%
Grant Probability
At Risk
3-4
OA Rounds
0m
Est. Remaining
-3%
With Interview

Examiner Intelligence

Grants only 37% of cases
37%
Career Allowance Rate
10 granted / 27 resolved
-23.0% vs TC avg
Minimal -40% lift
Without
With
+-40.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
33 currently pending
Career history
66
Total Applications
across all art units

Statute-Specific Performance

§101
1.7%
-38.3% vs TC avg
§103
52.0%
+12.0% vs TC avg
§102
8.5%
-31.5% vs TC avg
§112
12.4%
-27.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 27 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 3/15/2026 has been entered. Status of Claims Claims 16-22,25,27-28 and 30-36 are under examination on the merits. The objection to the Abstract is withdrawn in light of Applicant’s arguments. The objections to claims 16, 18, 20-22, 26-27 & 29-30 are withdrawn in light of Applicant’s amendments. The rejection of claims 20-22 & 29-30 under 35 U.S.C. 101 is withdrawn in light of Applicant’s amendments. The rejection of claim 19 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, is withdrawn in light of Applicant’s amendments. The rejection of claims 16-22 & 25-30 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, (rejection part B) is withdrawn in light of Applicant’s amendments. The rejection of claims 16-22 & 25-30 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, for New Matter (rejection part C) is withdrawn in light of Applicant’s amendments. The rejection of claims 16-22 & 25-30 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, for scope of enablement is withdrawn in light of Applicant’s amendments. The rejection of claims 16-19 & 25-28 under 35 U.S.C. 103 as being unpatentable over Li et al (CN 109750062A), in view of Zhou et al (2019) Mol Breeding. 39: 84, NCBI reference AP005106.6 and NCBI reference AP006052.3 is withdrawn in light of Applicant’s amendments. Priority Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216. Claim Objections Claims 16, 19, 20, 21 & 25 are objected to because of the following informalities: Claim 16 (line 16): “with second rice of other genetic background” should read --with a second rice of another genetic background--. Claim 19 (line 5): “of a rice” should read --of a rice plant--. Claim 19 (line 6): “a rice” should read --a rice plant--. Claim 19 (line 9): “having different genetic background” should read --having a different genetic background--. Claim 19 (line 17 & line 19): “a pair of primer” should read --a pair of primers--. Claim 20 (line 5): a connecting word like --and-- is needed between the two steps of the recited method. Claim 20 (line 4): “genome from the target rice” should read --genome of the target rice--. Claim 20 (line 6): “having different genetic background” should read --having a different genetic background--. Claim 21 (line 4 & line 6): “a pair of primer” should read --a pair of primers--. Claim 25 (lines 1-2): “the detecting” should read --detecting--. Appropriate correction is required. Applicant is advised that should claim 19 and/or 22 be found allowable, claims 21 & 31 respectively will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m). Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 16-22, 25, 27, 28, & 30-36 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 11/14/2025 as applied to claims 16-22 & 25-30. Applicant' s arguments filed 1/11/2026 have been fully considered but they are not persuasive. Claim 16 recites the limitation "the detected rice" in line 11. There is insufficient antecedent basis for this limitation in the claim because the previous step detects a marker rather than a rice. Replacing (lines 11-13) “identifying and selecting the detected rice comprising the lcrf2 as parent rice based on the presence of the lcrf2 in the rice” with wording similar to --identifying rice comprising the detected lcrf2 molecular marker and selecting the identified rice as a parent-- is suggested to overcome the issue of antecedent basis and clarify the meaning of the claim. Dependent claims 17, 18, 25, 27, 28, & 34 are also indefinite. Claim 20 also recites the limitation “the detected rice” in line 7. The molecular marker is detected, but not a rice plant. Replacing (line 7) “the detected target rice comprising the lcrf2” with --the target rice comprising the detected lcrf2-- could solve the antecedent basis issue. Dependent claims 21, 22, 31, 33 & 36 are also indefinite. Claim 16 recites the limitation “the parent rice” in line 16. There is insufficient antecedent basis for this limitation in the claim, because there are two distinct “parent rice” presented in claim 16 step 2: rice identified as comprising lcrf2 (lines 11-13) and rice screened based on cadmium content in rice (lines 13-15). It is indefinite whether “the parent rice” refers to parent rice obtained by one or the other or both potential methods of screening for the parent rice. Dependent claims 17, 18, 25, 27, 28, & 34 are also indefinite. Claim 16 recites the limitation “the rice with low grain cadmium accumulation” in line 17. There is insufficient antecedent basis for this limitation in the claim, because there are two distinct “rice with low grain cadmium accumulation” in claim 16: the rice that is bred (line 1) and the rice that is screened as parent rice (lines 13-15). Wording to differentiate the rice with low grain cadmium accumulation traits in step 2, which does not necessarily comprise an lcrf2 molecular marker, from the rice with low grain cadmium accumulation traits in step 3 would resolve the antecedent basis issue. Dependent claims 17, 18, 25, 27, 28, & 34 are also indefinite. Claim 17 recites “the lcrf1” in line 4. Claim 19 recites “the lcrf1” in line 8. Claim 21 recites “the lcrf1” in line 3. There is insufficient antecedent basis for this limitation in the claims. Dependent claims 27, 30, 32 & 35 are also indefinite. Claim 19 recites “the progeny” in line 10. There is insufficient antecedent basis for this limitation in the claim. Dependent claims 30, 32 & 35 are also indefinite. Claim 20 recites “the rice with low grain cadmium accumulation” in line 8. There is insufficient antecedent basis for this limitation in the claims. Dependent claims 21, 22, 31, 33 & 36 are also indefinite. Claim 22 recites “the pair of PCR primers” in lines 1-2. There is insufficient antecedent basis for this limitation, because claim 20 does not require that the primers (line 4) be PCR primers. Deleting “PCR” would overcome this antecedent basis rejection. Claims 34-36 recite “the parent rice comprises Luohong 3A and Luohong 4A”. A single parent rice plant or rice line cannot comprise two different rice varieties, so the scope of this limitation is indefinite. Is the parent rice a hybrid of two varieties? Or is the parent rice plant a variety selected from the group consisting of Luohong 3A and Luohong 4A? If the later, proper Markush group language could clear up the indefiniteness. See MPEP 2117. Applicant urges that amendments to the claims are sufficient to resolve the issues under 35 U.S.C. 112(b) (Remarks, page 10, paragraph 2-page 11, paragraph 1). This argument is unpersuasive, because the amendments to the claims introduce new indefiniteness issues as presented above. Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 17, 19, 21, 27, 30, 32 & 35 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 11/14/2025 as applied to claims 16-22 & 25-30. Applicant' s arguments filed 1/11/2026 have been fully considered but they are not persuasive. Claim 17 (lines 9-10), claim 19 (lines 15-16), claim 21 (lines 9-10) and dependent claims 27, 30, 32 & 35 require a lcrf1, which is a DNA fragment set forth in the 8899129-9307609 region of the rice chromosome 7. The claims thus require an extremely broad genus of molecular marker. Because no lower limit of length is provided in the instant specification for a “DNA fragment”, a DNA fragment set forth in an 8899129-9307609 region of the rice chromosome 7 encompasses any length of consecutive DNA nucleotides found within the provided region. This is in contrast to “the DNA fragment set forth in a 8899129-9307609 region of the rice chromosome 7”, which would require the entire stretch of nucleotides from 8899129 to 9307609 on chromosome 7 of a rice genome. Even if the claims were limited to the DNA fragment set forth in a 8899129-9307609 region of the rice chromosome 7, this encompasses the DNA fragment set forth in this region in any variety of rice. The instant specification describes three molecular markers of cadmium accumulation, lcrf2, lcrf2, and lcrf3 (page 2, lines 14-33). The instant specification describes lcrf1 as a DNA fragment set forth in the 8899129-9307609 region of the rice chromosome 7 of the CANU version of Shuhui 498 reference genome or a DNA fragment that has 75% or more identity to such a fragment (page 2, lines 20-25). The instant specification does not provide this sequence in the sequence listing file. While the reference genome may provide the locations in the Luohong 4A and Luohong 3A genomes where the marker starts and ends, Applicant has described only a 2,980 bp long fragment in the region between 8899129 and 9307609 in the genome of Luohong 4A and Luohong 3A (relative to the reference genome Shuhui 498) (page 9, lines 5-12), and t 408,481 bp of the reference genome not found in Luohong 3A or Luohong 4A to be associated with cadmium accumulation. Applicant has not described the region between 8899129 and 9307609 in any other rice background as being associated or not associated with cadmium accumulation. The specification describes methods for breeding rice with low cadmium accumulation traits using Luohong 3A and Luohong 4A rice, which are described as red lotus type hybrid rice, and Minghui 63, Longtefu B, and Huanghuazhan rice (page 7, line 11-page 8, line 2). However, the claims are not limited to methods that use Shuhui 498 rice or the cultivars of Luohong 3A, Luohong4A, Minghui 63, Longtefu B, and Huanghuazhan. The claims are not limited to even one species of rice. Cadmium accumulation markers on rice chromosome 7 are known in the art. Ueno et al (2010) PNAS. 107 (38) 16500-16505 (published 9/21/2010, hereafter Ueno) describes a major QTL controlling cadmium concentration in rice mapped to chromosome 7 (figure 1). Ueno describes a candidate gene for the cadmium accumulation phenotype to be OsHMA3, or Os07g0232900 (page 16502, left column, paragraph 2). Zhao et al (2018) Rice. 11(61) (published 11/21/2018, hereafter Zhao) describes, in addition to the OsHMA3 gene found at position 7,186,204 on chromosome 7, a QTL for low cadmium accumulation at position 8,263,482 on chromosome 7 with the associated candidate genes OsNRAMP1 and OsNRAMP5 and a QTL at position 18,553,958 (table 2, figure 2e). However, the linked SNP positions for these QTL are not in the same location in the Japonica population as in the composition population and not identified at all in the Indica population (table 2; page 11, left column, paragraph 2), suggesting that genes and QTLs responsible for cadmium transportation and accumulation may be subspecies-specific. These QTL were identified in 312 rice accessions (page 12, left column, paragraph 3). As further evidence that a DNA fragment set forth in the 8899129-9307609 region of chromosome 7 of rice is highly variable, the structure of chromosome 7 is not constant across the Japonica Nipponbare and Indica genomes of Oryza sativa, and are even more diverged when compared to wild rice species such as O. rufipogon and O. meridonalis (figure 3 of Abdullah et al (2025) BMC Genomics. 26. 54. Published 1/21/2025 after the filing of the instant application). The instant specification does not describe a structure of the 408,481 bp lcrf1 marker responsible for the difference in cadmium accumulation traits or that specifically serve as a molecular marker for accumulation that would be applicable across all rice varieties. The instant specification does not describe which of the 408,481 nucleotides of lcrf1 might be associated with cadmium accumulation and which are not associated with cadmium accumulation. One of skill in the art would not recognize that Applicant was in possession of the necessary common attributes or features of the genus in view of the disclosed species. Because Applicant has not, in fact, described an lcrf1 molecular marker for low cadmium accumulation over the full scope of the claims, the method of using an lcrf1 marker to breed rice with low cadmium accumulation traits, lower cadmium content in grains, or identify or assist in identifying low cadmium accumulation traits in rice grains is likewise not described, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed. Applicant urges that the claims are drawn to an invention which utilizes a direct correlation between the claimed molecular marker of a 2,980 bp long fragment in the recited region in rice chromosome 7 and cadmium accumulation. Applicant urges that the Description describes the discovery and characterization of the correlation of lcrf2 and cadmium accumulation in rice and demonstrated successful application of the claimed molecular marker associated with cadmium accumulation. Applicant urges that the Description discloses efficiently detecting lcrf2 in exemplary rice varieties using the primer pair of SEQ ID NO: 5 and SEQ ID NO: 6, and that one of ordinary skill in the art will understand that the lcrf2 occurs across different rice varieties and exhibits consistent data in reducing cadmium accumulation. Applicant urges that because of this, the disclosure and claims are sufficient to permit one of ordinary skill in the art to practice the claimed methods without undue experimentation (Remarks, page 11, paragraph 4-page 13, paragraph 1). This argument is unpersuasive, because whether one of ordinary skill in the art would be able to practice the claimed methods is a question of enablement not written description. The region between 8899129 and 9307609 on chromosome 7 across different rice varieties would encompass much more variety than described by the instant disclosure. One of ordinary skill in the art would not conclude based on the instant disclosure that Applicant was in possession of an lcrf1 marker over the full scope of the claimed invention at the time of filing. Enablement Claims 34-36 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. This is a new rejection necessitated by Applicant’s amendments. The claims all require rice comprising Luohong 3A and Luohong 4A. Since the rice variety claimed is essential to the claimed invention, it must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public. The specification does not disclose a repeatable process to obtain the exact same variety in each occurrence and it is not apparent if such a rice variety is readily available to the public. If a rice variety is not so obtainable or available, a deposit thereof may satisfy the requirements of 35 U.S.C. 112. So long as the number of seeds deposited complies with the requirements of the IDA where the deposit is made, the USPTO considers such a compliant submission as satisfying the rules under 37 CFR 1.801 through 1.809. The specification describes Luohong 3A and Luohong 4A as obtainable from the applicant only for repeating the relevant experiments and not for other purposes (page 7, lines 11-22), but there is no indication that the seeds have been deposited. Further, there is no affirmative statement in the specification that all restrictions upon availability to the public will be irrevocably removed upon granting of the patent. If the deposit of these seeds is made and accepted under the terms of the Budapest Treaty, then an affidavit or declaration by the Applicant, or a statement by an attorney of record over his or her signature and registration number, stating that the seeds will be irrevocably and without restriction or condition released to the public upon the issuance of a patent would satisfy the deposit requirement made herein. If the deposit has not been made and accepted under the Budapest Treaty, then in order to certify that the deposit meets the requirements set forth in 37 CFR 1.801-1.809, Applicant may provide assurance of compliance by an affidavit or declaration, or by a statement by an attorney of record over his or her signature and registration number showing that (a) during the pendency of the application, access to the invention will be afforded to the Commissioner upon request; (b) all restrictions upon availability to the public will be irrevocably removed upon granting of the patent; (c) the deposit will be maintained in a public depository for a period of 30 years or 5 years after the last request or for the enforceable life of the patent, whichever is longer; and (d) the viability of the biological material at the time of deposit will be tested (see 37 CFR 1.807). In addition, the identifying information set forth in 37 CFR 1.809(d) should be added to the specification. See 37 CFR 1.801 - 1.809 [MPEP 2401-2411.05] for additional explanation of these requirements. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 16, 18, 20, 22, 25, 28, 31, 33, 34 & 36 are rejected under 35 U.S.C. 103 as being unpatentable over Lyu et al CN111466291A (published 7/31/2020, hereafter Lyu. Appended with the machine translation of the Description into English) in view of Hayashi et al (2006) Theor Appl Genet. 113:251–260 (published 5/4/2006, hereafter Hayashi) and taken with the evidence of Li et al (2009) Advances on the molecular mechanism and use of Honglian-CMS in rice. In Accelerating hybrid rice development. Eds Xie and Hardy. 71-78. (published 2009, hereafter Li 2009). This is a new rejection. CN111466291A shares an Applicant with the instant application. However, CN111466291A lists inventors that are not listed on the instant application, necessitating this rejection. Claims 16, 20 & 25 are drawn to methods comprising detecting the presence of absence of the molecular marker lcrf2 in rice using a pair of primers that amplify the lcrf2, selecting rice comprising lcrf2 as parent rice, and crossing or backcrossing the rice with a second rice of another genetic background to obtain rice with low grain cadmium accumulation. Claims 28 & 33 are drawn to the method wherein the parent rice is a male sterile line. Claims 34 & 36 are drawn to the method wherein the parent rice is Luohong 4A. Claims 18, 22 & 31 require that the primers to amplify the lcrf2 comprise SEQ ID NO: 5 and SEQ ID NO: 6. Lyu teaches a method for breeding low-cadmium accumulation rice. Lyu teaches a motivation for the method, because cadmium can cause irreversible damage to the human respiratory system and bones and is a Group I carcinogen (paragraph [0004]). Lyu teaches that OsNRAMP5 protein loss-of-function leads to cadmium content that is 90% lower than that in normal rice, but because of strict regulation on genetically modified rice, naturally mutated rice materials of OsNRAMP5 is important to solve cadmium pollution in rice (paragraph [0006]). Lyu teaches screening naturally occurring rice materials and that only Luohong 4A and Luohong 4A showed low cadmium levels due to the absence of OsNRAMP5 (paragraph [0010]). Lyu teaches that Luohong 3A and Luohong 4A comprise a deletion in position 8899016-9307728 on chromosome 7, which is the region containing the OsNRAMP5 gene (paragraph [0012]). Lyu teaches that the deletion was discovered via resequencing (paragraph [0046]). Lyu teaches a method of breeding comprising the steps of hybridizing donor and recipient materials to obtain hybrid generation seeds which are self-pollinated to obtain F2 generation seeds, F2 generation population is screened by molecular marker for plants homozygous for OsNRAMP5 gene deletion (paragraphs [0014-0016]). Lyu also teaches a method comprising backcrossing donor and recipient materials, then the BC1F1 generation is screened for heterozygous OsNRAMP5 gene deletion and heterozygous plants are self-pollinated. Finally self-pollinated offspring are screened by molecular marker for plants homozygous for the OsNRAMP5 deletion (paragraphs [0018-0019]). Lyu teaches that the operation of the molecular marker comprises extracting genomic DNA, performing PCR amplification using an InDel molecular marker, and comparing the size of the PCR amplification product (paragraph [0023]). Lyu does not teach the DNA fragment of SEQ ID NO: 1 or primers that directly amplify the DNA fragment of SEQ ID NO: 1. Hayashi teaches that to develop molecular markers that can be used reliably in marker assisted selection, the recombination frequency between the markers and the target genes must be as low as possible, which can be achieved by producing markers tightly linked to the gene (page 258, left column, paragraph 2-right column, paragraph 1). Li 2009 provides evidence that Luohong 3A is an example of an HL-CMS line characterized by good grain quality, stable sterility, and high hybrid seed yield (page 77, paragraph 5). Before the filing of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of Lyu to detect the low-cadmium accumulation marker by designing a set of primers to amplify across the causative deletion instead of amplifying across a closely linked deletion. One of ordinary skill in the art would have been motivated to use primers that amplify across the causative deletion because such a marker would have no recombination with the target gene and would be reliable in marker assisted selection. One of ordinary skill in the art would have had reasonable expectation of success, because Lyu had identified the deletion responsible for the low cadmium phenotype, and design of PCR primers was routine in the art at the time of filing of the instant application. Thus, the method of Lyu in light of Hayashi makes obvious a method of detecting the presence or absence of a molecular marker of SEQ ID NO: 1 by using a pair of primers that PCR amplify the sequence, selecting rice comprising the marker based on the presence in the rice, and crossing or backcrossing the rice with rice of another genetic background to obtain rice with low grain cadmium accumulation (instant claims 16, 20, 25). Because the sequence of this deletion in Luohong 3A and Luohong 4A comprises SEQ ID NO: 1, a primer pair that would amplify the deletion detected by Lyu would inherently amplify the sequence of SEQ ID NO: 1. Additionally, because Luohong 3A and Luohong 4A are male sterile lines, claims 28, 33, 34, 36 are also obvious. Although Lyu does not explicitly teach a primer pair of SEQ ID NO: 5 and SEQ ID NO: 6 to amplify the marker in the OsNramp5 region in Luohong 3A or Luohong 4A, it would have been obvious to use the sequences of Luohong 3A and Luohong 4A to design primers such as SEQ ID NO: 5 and SEQ ID NO: 6 to amplify the region which was known to be a marker for cadmium accumulation. One of ordinary skill in the art would have had reasonable expectation of success, because primer design was routine in the art prior to the filing of the instant application. In light of this, instant claims 18, 22 & 31 would have been obvious. Claim(s) 17, 19, 21, 27, 30, 32 & 35 are rejected under 35 U.S.C. 103 as being unpatentable over Lyu and Hayashi as applied to claims 16, 18, 20, 22, 25, 28, 31, 33, 34 & 36 above, and further in view of Li et al (CN 109750062A, published 5/14/2019, hereafter Li; relying on a machine translation) and MBKBase web page for Locus OsR498G0713916200.01 (accessed 5/29/2026). This is a new rejection. Applicant’s arguments filed 1/14/2026 have been considered below as they apply to the instant rejection, but they are unpersuasive. Claims 17, 19, 21, 27, 30, 32 & 35 are drawn to a method comprising identifying the homozygous or heterozygous status of parent rice using a combination of primers that amplifies the lcrf2 of SEQ ID NO: 1 and a DNA fragment set forth in the 8899129-9307609 region of the rice chromosome 7. The teachings of Lyu and Hayashi are presented above. They do not teach determining the heterozygous or homozygous state of the parent rice using a combination of primer pairs that distinguish the lcfr1 and lcfr2 nor do they teach primers of SEQ ID NOs: 3 & 4. Li teaches a rice breeding method for reducing the cadmium content of rice grains by targeting the OsNRAMP5 gene (paragraph [0002,0014]). Li teaches a PCR primer (target site 2 forward PCR primer #2) with 100% sequence similarity to instant SEQ ID NO: 3. See first alignment below. Li also teaches a PCR primer (target site 2 reverse PCR primer #2) with 100% sequence similarity to instant SEQ ID NO: 4. See second alignment below. Li teaches that these are single-stranded DNA molecules, and teaches a DNA molecule formed from annealing the two molecules (paragraph [0068]). The annealed DNA molecule was connected to a vector to form a recombinant plasmid (paragraph [0071]). The recombinant plasmid was introduced into Agrobacterium and then into embryonic callus of rice and seedlings with mutations were identified by using the target site 2 forward and target site 2 reverse primers to amplify the target gene and sequence (paragraph [0083]). Mutant plants were screened to identify plants that were homozygous for the mutations (paragraphs [0084]). A homozygous mutant was self-pollinated, cultivated into T1 generation plants, and selected for lack of Cas9 gene to generate a T2 generation named LChhz2 (paragraph [0083]). Li teaches that the rice variety used for the method is an indica rice (paragraph [0051]). SEQ ID NO: 3 alignment ID BGJ07955 standard; DNA; 23 BP. XX AC BGJ07955; XX DT 25-JUL-2019 (first entry) XX DE Oryza sativa Nramp5 gene target site 2 forward PCR primer #2. XX KW CRISPR-Cas9 system; Genome editing; Nramp5 gene; PCR; crop improvement; KW plant; primer; ss; transgenic plant. XX OS Oryza sativa. XX CC PN CN109750062-A. XX CC PD 14-MAY-2019. XX CC PF 12-MAR-2019; 2019CN-10183421. XX PR 12-MAR-2019; 2019CN-10183421. XX CC PA (HUNA-) HUNAN HYBRID RICE RES CENT. XX CC PI Li L, Wang T, Fu Y, Wen J, Li Y, Song S, Qiu M; XX DR WPI; 2019-444692/53. XX CC PT Cultivation of rice comprises causing frameshift mutation in specific CC PT exon of OsNramp5 gene in rice genome where specific exon is ninth, tenth, CC PT eleventh exon, twelfth exon or thirteenth exon. XX CC PS Example 1; Page 7; 20pp; Chinese. XX CC The present invention relates to a rice breeding method for reducing CC cadmium content in rice grains without affecting agronomic traits. The CC method involves: inducing a frameshift mutation by editing a gene located CC in a specific exon of a rice Nramp5 gene in the rice genome using CC Crispr/Cas9 system. The invention further discloses: (1) a method for CC preparing a transgenic rice; (2) a a substance for genetic editing of CC rice in the preparation of transgenic rice; and (3) an sgRNA having a CC target sequence binding region. The method of the invention is useful CC reducing cadmium content in rice grains without affecting agronomic CC traits. XX SQ Sequence 23 BP; 8 A; 7 C; 3 G; 5 T; 0 U; 0 Other; Query Match 100.0%; Score 23; Length 23; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACTTGACAATCGATCCAACTAGC 23 ||||||||||||||||||||||| Db 1 ACTTGACAATCGATCCAACTAGC 23 SEQ ID NO: 4 alignment ID BGJ07956 standard; DNA; 19 BP. XX AC BGJ07956; XX DT 25-JUL-2019 (first entry) XX DE Oryza sativa Nramp5 gene target site 2 reverse PCR primer #2. XX KW CRISPR-Cas9 system; Genome editing; Nramp5 gene; PCR; crop improvement; KW plant; primer; ss; transgenic plant. XX OS Oryza sativa. XX CC PN CN109750062-A. XX CC PD 14-MAY-2019. XX CC PF 12-MAR-2019; 2019CN-10183421. XX PR 12-MAR-2019; 2019CN-10183421. XX CC PA (HUNA-) HUNAN HYBRID RICE RES CENT. XX CC PI Li L, Wang T, Fu Y, Wen J, Li Y, Song S, Qiu M; XX DR WPI; 2019-444692/53. XX CC PT Cultivation of rice comprises causing frameshift mutation in specific CC PT exon of OsNramp5 gene in rice genome where specific exon is ninth, tenth, CC PT eleventh exon, twelfth exon or thirteenth exon. XX CC PS Example 1; Page 7; 20pp; Chinese. XX CC The present invention relates to a rice breeding method for reducing CC cadmium content in rice grains without affecting agronomic traits. The CC method involves: inducing a frameshift mutation by editing a gene located CC in a specific exon of a rice Nramp5 gene in the rice genome using CC Crispr/Cas9 system. The invention further discloses: (1) a method for CC preparing a transgenic rice; (2) a a substance for genetic editing of CC rice in the preparation of transgenic rice; and (3) an sgRNA having a CC target sequence binding region. The method of the invention is useful CC reducing cadmium content in rice grains without affecting agronomic CC traits. XX SQ Sequence 19 BP; 3 A; 4 C; 7 G; 5 T; 0 U; 0 Other; Query Match 100.0%; Score 19; Length 19; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CGAAGCTTTGCTGATCGGG 19 ||||||||||||||||||| Db 1 CGAAGCTTTGCTGATCGGG 19 Li teaches that the LChhz2 plants, as well as other test plants, were cultivated under different exposures to cadmium chloride to determine cadmium content in the grain; LChhz2 plants had lower cadmium accumulated than the control Huanghuazhan plants (paragraphs [0086-0096]). The MBKBase web page for Locus OsR498G0713916200.01 provides evidence that the OsNRAMP5 gene with a gene ID of Os07g0257200 in the Nipponbare reference genome is found on Chr7 between 8934799 and 8942223 of the R498 reference genome. Before the filing of the instant application, it would have been obvious to one of ordinary skill in the art to screen the plants generated by a method of Lyu in order to select plants that are homozygous for a mutation that confers a non-functional OsNramp5 gene, as taught by Li. One of ordinary skill in the art would have been motivated to screen for a homozygous plant, because the homozygous mutants of Li and the Luohong 3A and Luohong4A varieties of Lyu with low cadmium accumulation both lack a functional copy of OsNramp5. One of ordinary skill in the art would have had reasonable expectation of success, because designing primers to amplify a gene was routine in the art at the time of filing of the instant application, and Li teaches primers of SEQ ID NO: 3 and 4 are able to amplify sequences of the OsNramp5 gene. The OsNRAMP5 gene falls within the 8899129-9307609 region of chromosome 7 of the Shuhui 498 reference gene and therefore reads on a DNA fragment set forth in the 8899129-9307609 region of the rice chromosome 7, or lcrf1. Thus, claims 17, 19, & 21 would have been obvious over Hao, Lv, and Li. Regarding claims 27 & 30, because designing primers to amplify molecular markers was routine in the art prior to the filing of the instant application, it would have been obvious to use the resequencing data of Luohong 3A and Luohong 4A to design primers such as SEQ ID NO: 5 and SEQ ID NO: 6 to amplify the deletion taught by Lyu to be associated with cadmium accumulation. Finally, regarding claims 32 & 35, it would have been obvious to perform the method wherein the parent line with low cadmium accumulation was Luohong 3A or Luohong 4A, which is a male sterile line, because Lyu had identified Luohong 3A and Luohong 4A to carry the molecular marker for low cadmium accumulation that comprises SEQ ID NO: 1. Claims 16-22, 25, 27-28, & 30-36 would have been obvious over Lyu, Hayashi, and Li. Applicant urges that Li is focused on a rice breeding method for reducing the cadmium content of rice by frame shift mutations in the OsNramp5 gene, but Applicant urges that the OsNramp5 gene does not cover lcrf2 and there is no overlapping sequence between the two fragments. Applicant urges that the present invention is based on the correlation of lcrf2 and low cadmium and introducing lcrf2 into a rice variety through natural methods, and so are completely different in principle or rationale (Remarks, page 14, paragraph 1-paragraph 2). This argument is unpersuasive, because Lyu teaches that the low cadmium phenotype in Luohong 3A and Luohong 4A is the result of the absence of OsNramp5. Therefore, one of ordinary skill in the art would understand the presence of lcrf2 as a marker for low cadmium accumulation is similar in principle to a null mutation in OsNramp5 causing low cadmium accumulation. Applicant urges that Li has a substantially different method for lowering grain cadmium accumulation and because of the lack of teaching regarding the role of lcrf2, one of ordinary skill in the art would not be drawn to method of introducing lcrf2 into a rice with a different genetic background through crossing or backcrossing (Remarks, page 14, paragraph 6-page 15, paragraph 1). This argument is unpersuasive, because Lyu teaches the region of the lcrf2 in Luohong 3A and Luohong 4A to be correlated with low cadmium and also teaches a motivation to use traditional breeding methods to avoid strict regulation on genetically modified rice. Claim(s) 16, 18, 20, 22, 25, 28, 30, 33, 34 & 36 are rejected under 35 U.S.C. 103 as being unpatentable over Hao et al (2019) Breeding Science. 69: 455–463. Published 7/10/2019, hereafter Hao) in view of Lv et al (2020) Nature Communications. 11:4778 (published 9/22/2020, hereafter Lv). Lv is published 9/22/2020, after the filing date of the foreign priority document but before the filing date of the PCT. Additionally, Lv lists authors not listed as inventors on the instant application. Applicant cannot rely upon the certified copy of the foreign priority application to overcome this rejection because a translation of said application has not been made of record in accordance with 37 CFR 1.55. When an English language translation of a non-English language foreign application is required, the translation must be that of the certified copy (of the foreign application as filed) submitted together with a statement that the translation of the certified copy is accurate. See MPEP §§ 215 and 216. Claims 16, 20, 25, 28, 33, 34 & 36 are summarized above. Claims 18, 22 & 31 require that the primers amplifying the lcrf2 marker comprise SEQ ID NOs: 5 & 6. Hao teaches that cadmium contaminated rice is an issue of major concern, because cadmium over-accumulation can damage health and increase risk of carcinogenesis in human organs; a practical approach to lower cadmium accumulation in rice is to breed inbred rice varieties or hybrid combinations with a low-Cadmium accumulation trait (page 455, left column-right column, paragraph 1). Hao teaches growing 174 thermosensitive genic male sterile rice lines and measuring the grain cadmium content of the plants (page 456, right column, paragraph 4-page 457, left column, paragraph 2). Hao teaches genotyping the lines via PCR amplification using primers amplifying SSR markers (page 457, left column, paragraph 3). Hao also teaches PCR amplification with primers of candidate genes related to cadmium (page 457, right column, paragraph 2). Hao teaches that the varieties B8S, SD34-1S, guanzhan63-4S, B14S, T91-22S, ZiseBLO2-1S, T95-5S, SD40S, B15S, Xiangling628S, 201507S, B76S, B216S, SD39S, and SD39-1S are low cadmium varieties (page 458, right column, paragraph 1-page 459, left column, paragraph 1). The low cadmium phenotype was significantly related to numerous SNPs and INDELs found in the OsNRAMP1 and OsNRAMP5 genes (page 460, left column, paragraphs 4-5; tables 2 & 3). Hao teaches that B8S and B14S have favorable alleles contributing to lo cadmium accumulation and could be considered low-Cd TGMS lines as putative resources for low cadmium breeding (page 460, right column, paragraph 3; table 4). Hao teaches that the markers in these genes can provide a basis for cadmium accumulation trait identification and molecular marker-assisted breeding of rice (page 462, left column, paragraph 1). Hao teaches a motivation to identify low cadmium traits in parent lines of hybrid rice, because hybrid rice is high-yielding and low cadmium parents will ensure hybrid rice produces cadmium safe grains (page 455, right column, paragraph 2). Hao does not teach a marker of SEQ ID NO: 1. Lv teaches that Luohong 3A and Luohong 4A comprise a deletion on chromosome 7 that spans OsNramp5 and have markedly lower cadmium content. Lv performed PCR using pairs of primers targeting exons of OsNramp5 to confirm the absence of the gene (page 5, right column, paragraph 4; figure 4). Lv teaches sequencing rice lines including Luohong3A and Luohong4A and that the sequencing data is deposited in NCBI (page 8, right column, paragraph 2, page 9, left column, paragraph 7). Before the filing of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of Hao to incorporate the cytoplasmic male sterile line of Luohong 3A or Luohong 4A. One of ordinary skill in the art would have been motivated to use Luohong 3A or Luohong 4A because Lv teaches that these male sterile lines also have mutation in the region of OsNramp5 leading to low cadmium accumulation, similar to the male sterile lines used by Hao. One of ordinary skill in the art would have had reasonable expectation of success, because both methods use mutations in OsNramp5 in male sterile rice to achieve low cadmium accumulation. Furthermore, one of ordinary skill in the art would have been motivated to cross the male sterile rice plant comprising the marker with a plant of a different genetic background because Hao teaches that hybrid rice is high-yielding and low cadmium parents will ensure hybrid rice produces cadmium safe grains. The method of Hao to amplify the OsNramp5 region via PCR, when performed in Luohong 3A or Luohong 4A reads on an amplification of a sequence of SEQ ID NO: 1, because this is the sequence found in the deleted OsNramp5 region in these lines. Although Hao and Lv do not explicitly teach a primer pair of SEQ ID NO: 5 and SEQ ID NO: 6 to amplify the marker in the OsNramp5 region in Luohong 3A or Luohong 4A, it would have been obvious to use the sequences of Luohong 3A and Luohong 4A to design primers such as SEQ ID NO: 5 and SEQ ID NO: 6 to amplify the region which was known to be a marker for cadmium accumulation. One of ordinary skill in the art would have had reasonable expectation of success, because primer design was routine in the art prior to the filing of the instant application. In light of this, instant claims 18, 22 & 31 would have been obvious. Claims 16, 18, 20, 22, 25, 28, 31, 33, 34 & 36 are obvious over Hao and Lv. Claim(s) 17, 19, 21, 27, 30, 32 & 35 are rejected under 35 U.S.C. 103 as being unpatentable over Hao and Lv as applied to claims 16, 18, 20, 22, 25, 28, 31, 33, 34 & 36 above, and further in view of Li et al (CN 109750062A, published 5/14/2019, hereafter Li; machine translation appended) and the MBKBase web page for Locus OsR498G0713916200.01 (accessed 5/29/2026). This is a new rejection. Applicant’s arguments filed 1/14/2026 have been fully considered as they related to the instant rejection, but they are not persuasive. Claims 17, 19, 21, 27, 30, 32 & 35 are drawn to a method comprising identifying the homozygous or heterozygous status of parent rice using a combination of primers that amplifies the lcrf2 of SEQ ID NO: 1 and a DNA fragment set forth in the 8899129-9307609 region of the rice chromosome 7. The teachings of Hao and Lv are presented above. They do not teach determining the heterozygous or homozygous state of the parent rice using a combination of primer pairs that distinguish the lcfr1 and lcfr2 nor do they teach primers of SEQ ID NOs: 3 & 4. The teachings of Li and the MBKBase web page for Locus OsR498G0713916200.01 are presented above. Before the filing of the instant application, it would have been obvious to one of ordinary skill in the art to screen the plants generated by a method of Hao and Lv in order to select plants that are homozygous for a mutation that confers a non-functional OsNramp5 gene, as taught by Li. One of ordinary skill in the art would have been motivated to screen for a homozygous plant, because the homozygous mutants of Li and the Luohong 3A and Luohong4A varieties of Lv with low cadmium accumulation both lack a functional copy of OsNramp5. One of ordinary skill in the art would have had reasonable expectation of success, because designing primers to amplify a gene was routine in the art at the time of filing of the instant application, and Li teaches primers of SEQ ID NO: 3 and 4 are able to amplify sequences of the OsNramp5 gene. The OsNRAMP5 gene falls within the 8899129-9307609 region of chromosome 7 of the Shuhui 498 reference gene and therefore reads on a DNA fragment set forth in the 8899129-9307609 region of the rice chromosome 7, or lcrf1. Thus, claims 17, 19, & 21 would have been obvious over Hao, Lv, and Li. Regarding claims 27 & 30, because designing primers to amplify molecular markers was routine in the art prior to the filing of the instant application, it would have been obvious to use the available sequences of Luohong 3A and Luohong 4A to design primers such as SEQ ID NO: 5 and SEQ ID NO: 6 to amplify the deletion taught by Lv to be associated with cadmium accumulation. Finally, regarding claims 32 & 35, it would have been obvious to perform the method wherein the parent line with low cadmium accumulation was Luohong 3A or Luohong 4A, which is a male sterile line, because Lv had identified Luohong 3A and Luohong 4A to carry the molecular marker for low cadmium accumulation that comprises SEQ ID NO: 1. Claims 16-22, 25, 27-28, & 30-36 would have been obvious over Hao, Lv, and Li. Applicant urges that Li is focused on a rice breeding method for reducing the cadmium content of rice by frame shift mutations in the OsNramp5 gene, but Applicant urges that the OsNramp5 gene does not cover lcrf2 and there is no overlapping sequence between the two fragments. Applicant urges that the present invention is based on the correlation of lcrf2 and low cadmium and introducing lcrf2 into a rice variety through natural methods, and so are completely different in principle or rationale (Remarks, page 14, paragraph 1-paragraph 2). This argument is unpersuasive, because Lv teaches that Luohong 3A and Luohong 4A with markedly lower cadmium content comprise a deletion on chromosome 7 that spans OsNramp5. Therefore, one of ordinary skill in the art would understand the presence of lcrf2 as a marker for low cadmium accumulation is similar in principle to a null mutation in OsNramp5 causing low cadmium accumulation. Applicant urges that Li has a substantially different method for lowering grain cadmium accumulation and because of the lack of teaching regarding the role of lcrf2, one of ordinary skill in the art would not be drawn to method of introducing lcrf2 into a rice with a different genetic background through crossing or backcrossing (Remarks, page 14, paragraph 6-page 15, paragraph 1). This argument is unpersuasive, because Hao suggests a method of introducing low cadmium traits into different rice varieties from existing variation in male sterile lines. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-4pm EDT. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /VICTORIA L DELEO/Examiner, Art Unit 1662 /Anne Kubelik/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Show 2 earlier events
Mar 19, 2025
Applicant Interview (Telephonic)
May 07, 2025
Non-Final Rejection mailed — §103, §112
Sep 08, 2025
Response Filed
Nov 14, 2025
Final Rejection mailed — §103, §112
Jan 14, 2026
Response after Non-Final Action
Mar 15, 2026
Request for Continued Examination
Mar 19, 2026
Response after Non-Final Action
Jun 15, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12668614
USE OF GLYCINE MAX GmSAMMT GENE IN REGULATION OF PROTEIN CONTENT AND/OR YIELD OF PLANT
2y 2m to grant Granted Jun 30, 2026
Patent 12584117
Use of Gene Encoding Gibberellin 3Beta-Hydroxylase of Glycine Max, GmGA3ox1
2y 11m to grant Granted Mar 24, 2026
Patent 12577577
COMPOSITIONS AND METHODS TO INCREASE RESISTANCE TO PHYTOPHTHORA SOJAE IN SOYBEAN
2y 9m to grant Granted Mar 17, 2026
Patent 12545926
NUCLEIC ACID MOLECULES FOR CONFERRING INSECTICIDAL PROPERTIES IN PLANTS
2y 3m to grant Granted Feb 10, 2026
Patent 12522839
USE OF ZLMYB1 AND ZLMYB2 GENES FROM ZIZANIA LATIFOLIA IN INCREASING ANTHOCYANIDIN CONTENT OF RICE SEED
2y 1m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
37%
Grant Probability
-3%
With Interview (-40.0%)
2y 6m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 27 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month