Prosecution Insights
Last updated: April 19, 2026
Application No. 18/026,287

HYBRID PROTOCOLS AND BARCODING SCHEMES FOR MULTIPLE SEQUENCING TECHNOLOGIES

Non-Final OA §102§103§112§DP
Filed
Mar 14, 2023
Examiner
DAUNER, JOSEPH G
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Regents of the University of California
OA Round
1 (Non-Final)
57%
Grant Probability
Moderate
1-2
OA Rounds
3y 4m
To Grant
91%
With Interview

Examiner Intelligence

Grants 57% of resolved cases
57%
Career Allow Rate
404 granted / 712 resolved
-3.3% vs TC avg
Strong +35% interview lift
Without
With
+34.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 4m
Avg Prosecution
76 currently pending
Career history
788
Total Applications
across all art units

Statute-Specific Performance

§101
11.1%
-28.9% vs TC avg
§103
27.4%
-12.6% vs TC avg
§102
18.4%
-21.6% vs TC avg
§112
30.1%
-9.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 712 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . The preliminary amendments to the claims filed 3/14/2023 are under consideration. Election/Restrictions Applicant’s election of Group I, claims 1-8 and 12-17 in the reply filed on 12/2/2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Upon further consideration, the restriction requirement between Groups I, II and IV is withdrawn. Claims 9-11 and 29 are included with the election of Group I. In view of the above noted withdrawal of the restriction requirement, applicant is advised that if any claim presented in a divisional application is anticipated by, or includes all the limitations of, a claim that is allowable in the present application, such claim may be subject to provisional statutory and/or nonstatutory double patenting rejections over the claims of the instant application. Once a restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01. Claims 18-19, 21-23 and 26-27 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected inventions, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/2/2025. Applicant’s election of SEQ ID NOs: 1 and 226 as species is acknowledged. Priority The present application is a 371 national stage entry of PCT/US2021/051924 (filed 9/24/2021), which claims benefit of US provisional application 63/083,868 (filed 9/26/2020). Priority is recognized. Drawings The SEQ ID NOs for nucleic acid sequences in Fig. 8E are provided in the specification. Specification The use of terms that are trade names or marks used in commerce, such as MinION™, PromethION™ and Illumina™, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Interpretation Claim 1 is drawn to an “oligonucleotide” comprising “barcodes” and the structure of the “barcodes” are described in the body of the claim. The claim includes two “wherein” clauses describing how the barcodes were made or designed. The claim is not limited by the process of how the barcodes were made or designed, and broadly encompasses any oligonucleotide having the barcodes with the structural elements resulting from or implied by process of designing or making the barcodes. In view of the “wherein” clauses referring to “pairs” of “4-9mers” and a “pair” of “barcodes”, the oligonucleotide is interpreted as having at least a “pair”, i.e., two, of the “barcodes” described in the claim. The “barcodes” as claimed “comprise” “at least about 18 to about 39 nucleotides”. The “barcodes” are interpreted as having a minimum length of about 18 nucleotides and is not limited to a length of no more than 39 nucleotides, based on the use of the open transition term “comprising” when describing the features of the “barcodes”. Claim 2 states the “oligonucleotide” further comprises a “flow cell attachment domain”. The claim is broadly interpreted as encompassing any structure that may be used to attach the “oligonucleotide” to a flow cell because a flow cell is not a structural element of the claimed oligonucleotide and the manner of attachment is not defined in any manner. Claim 3 further limits the “flow cell attachment domain” of claim 2 to one that comprises a full-length sequence of SEQ ID NO: 1, 2, 3 or 4. Claim 4 states the “oligonucleotide” further comprises “a sequencing primer binding domain”. The claim is broadly interpreted as encompassing any structure that may be used to bind any sequencing primer because a sequencing primer is not a structural element of the claimed oligonucleotide and the manner of binding is not defined in any manner. Claim 5 describes how the “second domain”, interpreted as referring to the “second nucleotide domain”, is made. The claim is not limited by the process of how the “second nucleotide domain” were made or designed, and broadly encompasses any oligonucleotide having “second nucleotide domains” with the structural elements resulting from or implied by process of designing or making the “second nucleotide domains”, which is to form a “barcode” having a length of 33-38 nucleotides. Claim 6 is interpreted as requiring the “oligonucleotide” to comprise the full-length sequence of at least one of SEQ ID NOs: 226-416 and 417. Claim 7 limits the overall length of the “oligonucleotide” to a minimum length of 47 nucleotides and a maximum length of 80 nucleotides based on the use of closed transition term “consists of”. Claim 12 is interpreted has encompassing one or more oligonucleotide having the barcodes described in claim 1, which are barcodes comprising at least about 18 to about 39 nucleotides in length having a first nucleotide domain and at least one second nucleotide domain; wherein the first nucleotide domain comprises 4-9 nucleotides (4-9mer) of the barcode located at either end of the barcode and wherein the 4-9mers are compatible with a next generation sequencing technology that utilizes bridge amplification, wherein the second nucleotide domain comprises 14-35 nucleotides (14- 35mer) of the barcode and wherein the 14-35mers are compatible with a next generation sequencing that utilizes nanopores, wherein at least a minimum Levenshtein distance between a pair of 4-9mers is utilized, and wherein the Levenshtein distance has been maximized between a pair of barcodes in order to minimize barcode "crosstalk". As noted above, the claim is not limited by the language describing the process of how the barcodes were made or designed, and broadly encompasses any oligonucleotide having the barcodes with the structural elements resulting from or implied by process of designing or making the barcodes. Claim 16 is interpreted has encompassing a “sequencing library” having the barcodes described in claim 1, which are barcodes comprising at least about 18 to about 39 nucleotides in length having a first nucleotide domain and at least one second nucleotide domain; wherein the first nucleotide domain comprises 4-9 nucleotides (4-9mer) of the barcode located at either end of the barcode and wherein the 4-9mers are compatible with a next generation sequencing technology that utilizes bridge amplification, wherein the second nucleotide domain comprises 14-35 nucleotides (14- 35mer) of the barcode and wherein the 14-35mers are compatible with a next generation sequencing that utilizes nanopores, wherein at least a minimum Levenshtein distance between a pair of 4-9mers is utilized, and wherein the Levenshtein distance has been maximized between a pair of barcodes in order to minimize barcode "crosstalk". As noted above, the claim is not limited by the language describing the process of how the barcodes were made or designed, and broadly encompasses any oligonucleotide having the barcodes with the structural elements resulting from or implied by process of designing or making the barcodes. Claim 17 sets forth an intended use of the “sequencing library” of claim 17. The intended use of a product does not limit the structure of a product. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 1, the claim recites “wherein the 4-9mers are compatible with a next generation sequencing technology that utilizes bridge amplification”. The recitation is of an intended use and/or property of the “first nucleotide domain”. It is unclear what structural limitations the language imposes on the “first nucleotide domain”, if any, in order to accomplish the intended use and/or confer the property recited in the clause. Regarding claim 1, the claim recites “wherein the 14-35mers are compatible with a next generation sequencing that utilizes nanopores”. The recitation is of an intended use and/or property of the “second nucleotide domain”. It is unclear what structural limitations the language imposes on the “second nucleotide domain”, if any, in order to accomplish the intended use and/or confer the property recited in the clause. Regarding claim 1, the claim states the “Levenshtein distance” minimizes barcode “crosstalk”. It is unclear what is encompassed by “crosstalk” and what if any structural limitations the language imposes on the “barcodes”. Claims 2-8, 13-15 and 17 depend from claim 1 and are rejected for the same reason as claim 1. Regarding claim 5, the claim recites “the 33-38mer barcode”. The recitation lacks proper antecedent basis as the claim does not previously set forth or describe a barcode that is 33 to 38 nucleotides in length. Regarding claim 9, the claim recites “the oligonucleotide” in the second to last line. It is unclear if the recitation is in reference to an “oligonucleotide barcode sequence”, an “oligonucleotide barcode”, a “first oligonucleotide barcode” or a “second oligonucleotide barcode”. Claims 10 and 11 depend from claim 9 and are rejected for the same reason. Regarding claim 10, the claim recites “the barcode”. It is unclear if the recitation is in reference to an “oligonucleotide barcode sequence”, an “oligonucleotide barcode”, a “first oligonucleotide barcode” or a “second oligonucleotide barcode”. Regarding claim 11, the claim recites “the oligonucleotide”. It is unclear if the recitation is in reference to an “oligonucleotide barcode sequence”, an “oligonucleotide barcode”, a “first oligonucleotide barcode” or a “second oligonucleotide barcode”. Regarding claim 12, the claim refers to the “barcodes” of claim 1, thus, incorporating the language rejected above. Claim 12 is rejected for the same reason as claim 1 described above. Regarding claim 16, the claim refers to the “barcodes” of claim 1, thus, incorporating the language rejected above. Claim 16 is rejected for the same reason as claim 1 described above. Regarding claim 16, the claim refers to “the set of barcodes of claim 1”. The recitation lacks proper antecedent basis as claim 1 does not set forth a “set of barcodes”. Regarding claim 17, the claim sets forth an intended use of the “sequencing library” of claim 16. It is unclear what additional structural limitations are required, if any, in order for the sequencing library to be used as described. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1-5, 7-10, 12-14 and 16-17 is/are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Zhao (US 2019/0085384 A1). Regarding claim 1, Zhao teaches an “oligonucleotide” resulting from the ligation of adaptors to an double-stranded nucleic acid as generalized in Fig. 1B, reproduced below: PNG media_image1.png 541 497 media_image1.png Greyscale PNG media_image2.png 235 472 media_image2.png Greyscale The adaptors may alternatively have the following structures from Fig. 1G: The adaptors depicted above have “barcodes” comprising a combination of i5 and UMI2 or i7 and UMI1. The elements “i5” and “i7” of Zhao refer to index sequences, which have a length of 8 nucleotides as depicted in Fig. 1I and 1J, and thus are encompassed by the claimed “first nucleotide domain”. The elements UMI1 and UMI2 of Zhao have a length of 14, 15, 16, 17, 18, 19, 20 or 30 nucleotides when vRNUMI (para. 77), and thus are encompassed by the claimed “second nucleotide domain”. As noted above, the intended use or property recited in the “wherein” clauses do not limit the structures of the first and second nucleotide domains. Zhao further teaches the barcodes are designed based on Levenshtein distances (para. 170; see also, para. 15, 80 and 226). Thus, the oligonucleotide resulting from the use of the adaptors in Fig. 1G in the ligation method of Fig. 1B is encompassed by claim 1. Regarding claim 2, the oligonucleotide of Zhao further includes sequences such as P5, P7’, Rd1 SP and Rd2 SP as depicted in Fig. 1G above, any of which are encompassed by “a flow cell attachment domain”. Zhao further teaches adaptors include a flow cell amplification primer binding sequence (para. 212). Regarding claim 3, Zhao teaches the flow cell amplification primer binding sequence is CAAGCAGAAGACGGCATACGAGAT (para. 212), which is claimed SEQ ID NO: 1. Regarding claim 4, Zhao teaches the oligonucleotide of Zhao further includes sequences such as P5, P7’, Rd1 SP and Rd2 SP as depicted in Fig. 1G above, any of which are encompassed by “sequencing primer binding domain”. Zhao further teaches adaptors include a SP1 sequencing primer binding sequence (para. 212). Regarding claim 5, Zhao teaches the index sequences have a length of 8 nucleotides and a UMI having a length of 30 nucleotides as noted above. Together they form a “barcode” with a length of 38 nucleotides as broadly encompassed by claim 5 as interpreted above. PNG media_image2.png 235 472 media_image2.png Greyscale Regarding claims 7 and 8 (and claim 1), Zhao teaches the following adaptor “oligonucleotide” in Fig. 1G: The adaptors depicted above have “barcodes” comprising a combination of i5 and UMI2 or i7 and UMI1. The elements “i5” and “i7” of Zhao refer to index sequences, which have a length of 8 nucleotides as depicted in Fig. 1I and 1J, and thus are encompassed by the claimed “first nucleotide domain”. The elements UMI1 and UMI2 of Zhao have a length of 14, 15, 16, 17, 18, 19, 20 or 30 nucleotides when vRNUMI (para. 77), and thus are encompassed by the claimed “second nucleotide domain”. As noted above, the intended use or property recited in the “wherein” clauses do not limit the structures of the first and second nucleotide domains. Zhao further teaches the barcodes are designed based on Levenshtein distances (para. 170; see also, para. 15, 80 and 226). The P5 and P7’ regions have a length of 29 and 24 nucleotides, respectively (para. 212). The i5 and i7 regions have a length of 8 nucleotides as noted above. The UMI sequences may have a length of 14, 15, 16, 17, 18, 19, 20 or 30 as noted above. The Rd1 SP and Rd2 SP have a length of 14 and 15 nucleotides, respectively (para. 21). Together the regions combine to form an “oligonucleotide” with a length of between 60 and 82 nucleotides, which is encompassed by claims 7 and 8. Claim 1 is alternatively anticipated by the adaptors of Fig. 1G as applied to dependent claims 7 and 8. Regarding claim 9, Zhao teaches an “oligonucleotide barcode” comprising a combination of i5 linked to UMI2 or i7 linked to UMI1 as depicted in Fig. 1G reproduced above. The elements i5 and i7 of Zhao refer to index sequences, which have a length of 8 nucleotides as depicted in Fig. 1I and 1J, and thus are encompassed by the claimed “first oligonucleotide barcode”. The elements UMI1 and UMI2 of Zhao have a length of 14, 15, 16, 17, 18, 19 and 20 nucleotides when vRNUMI (para. 77), and thus are encompassed by the claimed “second oligonucleotide barcode”. As noted above, the intended use or property recited in the “wherein” clauses do not limit the structures of the first and second nucleotide domains. Zhao further teaches the barcodes are designed based on Levenshtein distances (para. 170; see also, para. 15, 80 and 226). Regarding claim 10, Zhao teaches the UMI may be 30 nucleotides (para. 77), which is “about” 29 nucleotides, and when paired with the 8 nucleotide i5 or i7 sequence produces a “barcode” with a length of 38 nucleotides. Regarding claims 12 and 16, Zhao teaches a “set of oligonucleotides” or “sequencing library” comprising the barcodes described in claim 1 in the form of the adaptors depicted above or the ligation products of a double-stranded fragment and two adaptors depicted above. Regarding claim 13, in the ligation products, each “barcode” is located between “sequencing adaptors” in the form of the P5 and P7’ sequence regions depicted in Fig. 1B. Regarding claim 14, Zhao teaches one of the “sequencing adaptors” has the sequence CAAGCAGAAGACGGCATACGAGAT (para. 212), which is claimed SEQ ID NO: 1. Regarding claim 17, the claim merely recites an additional intended use of the “sequencing library” of claim 16. No additional structural elements are claimed. Claim 17 is anticipated for the same reason as claim 16. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 15 and 29 is/are rejected under 35 U.S.C. 103 as being unpatentable over Zhao (US 2019/0085384 A1). PNG media_image1.png 541 497 media_image1.png Greyscale Regarding claim 15, Zhao teaches a “set of oligonucleotides” or “sequencing library” comprising the barcodes described in claim 1 in the form of the adaptors depicted above or the ligation products of a double-stranded fragment and two adaptors depicted above in Fig. 1B: Zhao teaches alternative adaptor “oligonucleotides” in Fig. 1G, in which a barcode is the combination of i5 or i7 and a UMI sequence. PNG media_image3.png 742 474 media_image3.png Greyscale Zhao teaches an alternative embodiment in which the “barcodes” are added to the ligation products via PCR as depicted in Fig. 2A, reproduced below: It would have been prima facie obvious to the ordinary artisan that an obvious variant to the “PCR primers” of Fig. 2A is to incorporate the “barcodes” made of the combination of a UMI sequence and either i5 or i7 in place of the i5 or i7 sequence alone. The two structures are obvious variants of one another based on the teaches of Zhao as a whole because it simply substitutes known elements that are compatible with one another as taught by Zhao. Regarding claim 29, Zhao teaches the following adaptor “oligonucleotide” in Fig. 1G: PNG media_image2.png 235 472 media_image2.png Greyscale The adaptors depicted above have “paired barcodes” comprising a combination of i5 and UMI2 and a combination of i7 and UMI1. The elements “i5” and “i7” of Zhao refer to index sequences, which have a length of 8 nucleotides as depicted in Fig. 1I and 1J. The elements UMI1 and UMI2 of Zhao have a length of 30 nucleotides when vRNUMI (para. 77), and thus are encompassed by the claimed “second nucleotide domain”. The intended use or property recited in the “wherein” clauses do not limit the structures paired “barcodes”. Zhao further teaches the barcodes are designed based on Levenshtein distances (para. 170; see also, para. 15, 80 and 226). While the “paired barcodes” described above have a length of 38 nucleotides, Zhao teaches the UMI1 and UMI2 may be other lengths (para. 77). Thus, the claimed “paired 37mer barcodes” of claim 29 represent an obvious variant of those of Zhao. Based on the teachings of Zhao and based on design considerations, one would be reasonably able to arrive at barcodes having a length of 37 nucleotides. Conclusion No claims allowed. Oligonucleotide barcodes consisting of a full-length sequence selected from SEQ ID NOs: 226-236 or oligonucleotides comprising a barcode sequence consisting of a full-length sequence selected from SEQ ID NOs: 226-236 are free of the prior art. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOSEPH G DAUNER whose telephone number is (571)270-3574. The examiner can normally be reached 7 am EST to 4:30 EST with second Fridays Off. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JOSEPH G. DAUNER/ Primary Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Mar 14, 2023
Application Filed
Jan 18, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12601006
TARGETED, LONG-READ NUCLEIC ACID SEQUENCING FOR THE DETERMINATION OF CYTOSINE MODIFICATIONS
2y 5m to grant Granted Apr 14, 2026
Patent 12595506
Compositions and Methods for Analyzing Modified Nucleotides
2y 5m to grant Granted Apr 07, 2026
Patent 12584162
HYDROXYMETHYLATION ANALYSIS OF CELL-FREE NUCLEIC ACID SAMPLES FOR ASSIGNING TISSUE OF ORIGIN, AND RELATED METHODS OF USE
2y 5m to grant Granted Mar 24, 2026
Patent 12571042
MARKERS SPECIFIC FOR PLURIPOTENT STEM CELLS, AND METHODS OF USING THE SAME
2y 5m to grant Granted Mar 10, 2026
Patent 12565682
METHODS OF TREATING CANCER
2y 5m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
57%
Grant Probability
91%
With Interview (+34.7%)
3y 4m
Median Time to Grant
Low
PTA Risk
Based on 712 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month