DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
The amendments to the claims filed 7/13/2026 are under consideration.
The amendments and arguments presented in the papers filed 7/13/2026 ("Remarks”) have been thoroughly considered. The issues raised in the Office action dated 1/23/2026 listed below have been reconsidered as indicated.
a) The objection to the specification is withdrawn in view of the amendments to the claims.
b) The rejections of claim(s) 1-5, 7-10, 12-14 and 16-17 under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Zhao (US 2019/0085384 A1) are withdrawn because Zhao is silent regarding the Levenshtein distance of any of its sequences.
The Examiner’s responses to the Remarks regarding issues not listed above are detailed below in this Office action.
New and modified grounds of rejection necessitated by amendment are detailed below and this action is made FINAL.
Election/Restrictions
Applicant elected Group I, claims 1-8 and 12-17, in the reply filed on 12/2/2025. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Upon further consideration, the restriction requirement between Groups I, II and IV was withdrawn. Claims 9-11 and 29 were included with the election of Group I.
In view of the above noted withdrawal of the restriction requirement, applicant is advised that if any claim presented in a divisional application is anticipated by, or includes all the limitations of, a claim that is allowable in the present application, such claim may be subject to provisional statutory and/or nonstatutory double patenting rejections over the claims of the instant application.
Once a restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01.
Claims 18-19, 21-23 and 26-27 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected inventions, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/2/2025.
Applicant’s election of SEQ ID NOs: 1 and 226 as species is acknowledged.
Priority
The present application is a 371 national stage entry of PCT/US2021/051924 (filed 9/24/2021), which claims benefit of US provisional application 63/083,868 (filed 9/26/2020).
Priority is recognized.
Drawings
The SEQ ID NOs for nucleic acid sequences in Fig. 8E are provided in the specification.
Claim Interpretation
Claim 1 is drawn to an “oligonucleotide” comprising “barcodes” and the structure of the “barcodes” are described in the body of the claim. The relative structural orientation of the “first nucleotide domain” and the “second nucleotide domain” are not defined, other than the “first nucleotide domain” is located at one end of the “barcode”. The barcodes broadly encompass those with a “first nucleotide domain” and a “second nucleotide domain” that overlap, are adjacent to one another or separated by an intervening sequence. The claim encompasses a “first nucleotide domain” that is 5’ of a “second nucleotide domain” or a “second nucleotide domain” that is 5’ of a “first nucleotide domain”.
The “barcodes” as claimed “comprise” “at least about 18 nucleotides”. The “barcodes” are interpreted as having a minimum length of about 18 nucleotides.
Claim 2 states the “set of oligonucleotides” further comprises a “flow cell attachment domain”. The claim is broadly interpreted as encompassing any structure that may be used to attach the “oligonucleotide” to a flow cell because a flow cell is not a structural element of the claimed oligonucleotide, and the manner of attachment is not defined in the claim. It is further noted the “flow cell attachment domain” is part of the “set of oligonucleotides” and not necessary a structural element of each oligonucleotide of the set.
Claim 3 further limits the “flow cell attachment domain” of claim 2 to one that comprises a full-length sequence of SEQ ID NO: 1, 2, 3 or 4.
Claim 4 states the “set of oligonucleotides” further comprises “a sequencing primer binding domain”. The claim is broadly interpreted as encompassing any structure that may be used to bind any sequencing primer because a sequencing primer is not a structural element of the claimed oligonucleotide, and the manner of binding is not defined in the claim. It is further noted the “sequencing primer binding domain” is part of the “set of oligonucleotides” and not necessary a structural element of each oligonucleotide of the set.
Claim 6 is interpreted as requiring the “set of oligonucleotides” to comprise the full-length sequence of at least one of SEQ ID NOs: 226-236. It is further noted the “sequence” is part of the “set of oligonucleotides” and not necessary a structural element of each oligonucleotide of the set.
Claim 9 is drawn to an “oligonucleotide barcode”. The claim includes a wherein clause stating “the Levenshtein distance has been maximized between a pair of oligonucleotide barcodes in a set of oligonucleotides”. The claim broadly encompasses a single “oligonucleotide barcode”, thus, the “wherein” clause does not limit the claim as the “set of oligonucleotides” is not a structural element of the claim.
Claim 16 is interpreted has encompassing a “sequencing library comprising the set of barcodes of claim 9”. Claim 9 does not set forth a “set of barcodes”.
Claim Objections
Claim 9 is objected to because of the following informalities: the claim recites “the barcode” starting in line 8, presumably in reference to “an oligonucleotide barcode”. The claim also recites “the oligonucleotide barcode”, presumably in reference to “an oligonucleotide barcode sequence”. It is suggested a single term consistently be used when referring to a particular element of the claim. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 2, 3, 4, 6 and 16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, the claim recites “wherein the 4-9mers are compatible with a next generation sequencing technology that utilizes bridge amplification”. The recitation is of an intended use and/or property of the “first nucleotide domain”. It is unclear what structural limitations the language imposes on the “first nucleotide domain”, if any, in order to accomplish the intended use and/or confer the property recited in the clause. For example, does the claim encompass any 4-9mer pair having the recited Levenshtein distances? It is unclear what distinguishes one sequence that is “compatible with a next generation sequencing technology that utilizes bridge amplification” from one that is not. It is unclear if simply the Levenshtein distance of at least 3 is sufficient to distinguish the first nucleotide domains encompassed from the claim and those that are not. It is unclear whether some first nucleotide domains having a Levenshtein distance of at least 3 are not compatible with a next generation sequencing technology that utilizes bridge amplification” and if so, which ones are and are not. Does the claim require the 4-9mer to have structure employed in “bridge amplification”?
Regarding claim 1, the claim recites “wherein the 14-35mers are compatible with a next generation sequencing that utilizes nanopores”. The recitation is of an intended use and/or property of the “second nucleotide domain”. It is unclear what structural limitations the language imposes on the “second nucleotide domain”, if any, in order to accomplish the intended use and/or confer the property recited in the clause. For example, does the claim encompass any 14-35mer pair having the recited Levenshtein distances? Does the claim require the 4-9mer to have structure employed in “nanopore” based sequencing?
Claims 2, 3, 4 and 6 depend from claim 1 and are rejected for the same reason as claim 1.
Regarding claim 16, the claim refers to “the set of barcodes” of claim 9, thus, that element from claim 9 is incorporated in to claim 16. However, the recitation lacks proper antecedent basis as claim 9 does not set forth a “set of barcodes” as an element of claim 9.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1, 2, 4, 9, 11, 13, 15 and 16 is/are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Volkmuth (WO 2013/033721 A1).
The following are new rejections necessitated by the amendments to the claims.
Regarding claim 1, Volkmuth teaches “barcode sequences” used in the following method:
(a) distributing the samples into a plurality of containers;
(b) synthesizing polynucleotide sequences of interest using templates derived from the sample; and
(c) adding a barcode sequence to the polynucleotide sequences of interest synthesized in step (b),
wherein said barcode sequence comprises one or more of the sequences shown in Table 1 or Table 2.
In embodiments where two sequences of Table 1 are used in the “barcode sequence”, at least a pair of oligonucleotide comprising barcodes is formed.
The barcodes of Table 1 have a length of 28 nucleotides, thereby satisfying the length requirement of “at least about 18 nucleotides”.
Using combinations of 2 sequences of Table 1 a “barcode sequence” includes the exemplary combinations of any two of the following sequences:
Barcode Number 08: ACATCTACTCGACACACTGTACAGTAGC
Barcode Number 14: GTCGAGAGCACTACTACAGAGTCGATCA
Barcode Number 18: ACTAGATCGCTGCACGCATAGATACTAG
Barcode Number 20: CTAGTGTAGAGTCACGAGATCTCAGCAG
Barcode Number 22: ACTCATAGCGATACGTGTGCGTCATACG
Barcode Number 32: ACGAGACGAGACTGCGTCTACGCTGCAT
Barcode Number 43: CGTATCTCACAGTACTCAGATAGCGTCT
Barcode Number 48: GTAGTCATCTGTGCTCGATCACTGAGAC
Barcode Number 52: AGCGAGCAGATAGAGCACTGAGTAGTGC
The underlined portions satisfy the length requirements of a “first nucleotide domain” and the italicized portion satisfy the length requirements of a “second nucleotide domain”.
PNG
media_image1.png
276
285
media_image1.png
Greyscale
The above sequences have the following overall Levenshtein distances for each possible pair of barcodes:
PNG
media_image2.png
273
287
media_image2.png
Greyscale
The Levenshtein distances for each possible pair of “first nucleotide domains” is as follows:
PNG
media_image3.png
274
289
media_image3.png
Greyscale
The Levenshtein distances for each possible pair of “second nucleotide domains” is as follows:
Because the “first nucleotide domains” and “second nucleotide domains” have the recited Levenshtein distances, they are compatible with “next generation sequencing technology that utilizes bridge amplification” and “next generation sequencing that utilizes nanopores”, respectively.
Regarding claim 2, Volkmuth further teaches the barcodes are within oligonucleotides that include other sequences, such as a universal primer or spacer (para. 70 and 93, 94, 125). Each these sequences have a structure that may serve as a “flow cell attachment domain”, depending on the structure of a “flow cell”, which is not a structural element of the claimed invention.
Regarding claim 4, Volkmuth further teaches the barcodes are within oligonucleotides that include other sequences, such as universal primer or spacer (para. 70 and 93, 94, 125). Each these sequences have a structure that may serve as a “sequencing primer binding domain”, depending on the structure of a “sequencing primer”, which is not a structural element of the claimed invention.
Regarding claim 9, Volkmuth teaches “barcode sequences”, e.g., those disclosed in Table 1.
The barcodes of Table 1 have a length of 28 nucleotides, thereby satisfying the length requirement of “at least about 28 nucleotides”.
The barcode sequences include the following sequences:
Barcode Number 08: ACATCTACTCGACACACTGTACAGTAGC
Barcode Number 14: GTCGAGAGCACTACTACAGAGTCGATCA
Barcode Number 18: ACTAGATCGCTGCACGCATAGATACTAG
Barcode Number 20: CTAGTGTAGAGTCACGAGATCTCAGCAG
Barcode Number 22: ACTCATAGCGATACGTGTGCGTCATACG
Barcode Number 32: ACGAGACGAGACTGCGTCTACGCTGCAT
Barcode Number 43: CGTATCTCACAGTACTCAGATAGCGTCT
Barcode Number 48: GTAGTCATCTGTGCTCGATCACTGAGAC
Barcode Number 52: AGCGAGCAGATAGAGCACTGAGTAGTGC
The underlined portions satisfy the length requirements of a “first oligonucleotide barcode domain” at the 3’ or 5’ end and the italicized portion satisfy the length requirements of a “second nucleotide domain” that is “operably linked to the first oligonucleotide barcode domain”.
Because the “first nucleotide domains” and “second nucleotide domains” of Volkmuth have all the structural features required by the claim, they are compatible with “next generation sequencing technology that utilizes bridge amplification” and “next generation sequencing that utilizes nanopores”, respectively.
The claim further describes Levenshtein distances within a “set of oligonucleotides”. The “set of oligonucleotides” is not required and thus does not place any structural limitations of a single “oligonucleotide barcode sequence” encompassed by the full scope of the claims. The language describing the “set of oligonucleotides” does not distinguish an “oligonucleotide barcode sequence” encompassed by the claim from “oligonucleotide barcode sequences” found in the prior art.
If the claim is amended to be limited to a plurality of oligonucleotide barcode sequences or a set of oligonucleotide barcode sequences, the following is noted.
The Levenshtein distances for each possible pair of “first nucleotide domains” is as follows:
PNG
media_image2.png
273
287
media_image2.png
Greyscale
PNG
media_image3.png
274
289
media_image3.png
Greyscale
The Levenshtein distances for each possible pair of “second nucleotide domains” is as follows:
PNG
media_image1.png
276
285
media_image1.png
Greyscale
The above sequences have the following overall Levenshtein distances for each possible pair of barcodes:
Regarding claim 11, the claim further describes the “set of oligonucleotides”, which is not a structural feature required by the claimed invention. It is further noted the claim does not require the recited SEQ ID NOs be a feature of an “oligonucleotide barcode sequence”.
The barcode sequences of Volkmuth described in the rejection of claim 9 are encompassed by claim 11 and the claim is anticipated.
Regarding claim 13, Volkmuth teaches the barcode is located between various nucleotide sequences, such as a 454 titanium primer and a universal primer sequencer (para. 94, 125). These type of sequences are encompassed by the full scope of a “sequencing adaptor”.
Regarding claim 15, Volkmuth teaches the barcodes are part of a set of primers (para. 66, 93, 94, 125).
Regarding claim 16, Volkmuth teaches a library comprising the above barcode sequences detailed in the rejection of claim 9, and which is formed by the steps of:
(a) distributing the samples into a plurality of containers;
(b) synthesizing polynucleotide sequences of interest using templates derived from the sample; and
(c) adding a barcode sequence to the polynucleotide sequences of interest synthesized in step (b),
wherein said barcode sequence comprises one or more of the sequences shown in Table 1 or Table 2.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 3 and 14 is/are rejected under 35 U.S.C. 103 as being unpatentable over Zhao (US 2019/0085384 A1; previously cited) in view of Volkmuth (WO 2013/033721 A1).
The following are new rejections necessitated by the amendments to the claims.
PNG
media_image4.png
235
472
media_image4.png
Greyscale
PNG
media_image5.png
541
497
media_image5.png
Greyscale
Regarding claim 3, Zhao teaches an “oligonucleotide” resulting from the ligation of adaptors to a double-stranded nucleic acid as generalized in Fig. 1B, reproduced below:
The adaptors may alternatively have the following structures from Fig. 1G:
The adaptors depicted above have “barcodes” comprising a combination of i5 and UMI2 or i7 and UMI1.
The elements “i5” and “i7” of Zhao refer to index sequences, which have a length of 8 nucleotides as depicted in Fig. 1I and 1J, and thus are encompassed by the claimed “first nucleotide domain”.
The elements UMI1 and UMI2 of Zhao have a length of 14, 15, 16, 17, 18, 19, 20 or 30 nucleotides when vRNUMI (para. 77), and thus are encompassed by the claimed “second nucleotide domain”.
As noted above, the intended use or property recited in the “wherein” clauses do not limit the structures of the first and second nucleotide domains.
Zhao further teaches the barcodes are designed based on Levenshtein distances (para. 170; see also, para. 15, 80 and 226).
Zhao further teaches the flow cell amplification primer binding sequence is CAAGCAGAAGACGGCATACGAGAT (para. 212), which is claimed SEQ ID NO: 1.
PNG
media_image4.png
235
472
media_image4.png
Greyscale
PNG
media_image5.png
541
497
media_image5.png
Greyscale
Regarding claim 14, Zhao teaches an “oligonucleotide” resulting from the ligation of adaptors to a double-stranded nucleic acid as generalized in Fig. 1B, reproduced below:
The adaptors may alternatively have the following structures from Fig. 1G:
The adaptors depicted above have “barcodes” comprising a combination of i5 and UMI2 or i7 and UMI1.
The elements “i5” and “i7” of Zhao refer to index sequences, which have a length of 8 nucleotides as depicted in Fig. 1I and 1J, and thus are encompassed by aspects of the claimed “first nucleotide domain”.
The elements UMI1 and UMI2 of Zhao have a length of 14, 15, 16, 17, 18, 19, 20 or 30 nucleotides when vRNUMI (para. 77), and thus are encompassed by the claimed “second nucleotide domain”.
Zhao further teaches the barcodes are designed based on Levenshtein distances (para. 170; see also, para. 15, 80 and 226).
In the ligation products, each “barcode” is located between “sequencing adaptors” in the form of the P5 and P7’ sequence regions depicted in Fig. 1B.
Zhao further teaches one of the “sequencing adaptors” has the sequence CAAGCAGAAGACGGCATACGAGAT (para. 212), which is claimed SEQ ID NO: 1.
Zhao is silent regarding the relationship between oligonucleotides based on the Levenshtein distances between “first nucleotide domains”, “second nucleotide domains” and overall Levenshtein distances between oligonucleotides.
However, Volkmuth teaches the barcode sequences of Table 1, having a length of 28 nucleotides, thereby satisfying the length requirement of “at least about 28 nucleotides”.
The barcodes of Table 1 include the following sequences as part of a “set”:
Barcode Number 08: ACATCTACTCGACACACTGTACAGTAGC
Barcode Number 14: GTCGAGAGCACTACTACAGAGTCGATCA
Barcode Number 18: ACTAGATCGCTGCACGCATAGATACTAG
Barcode Number 20: CTAGTGTAGAGTCACGAGATCTCAGCAG
Barcode Number 22: ACTCATAGCGATACGTGTGCGTCATACG
Barcode Number 32: ACGAGACGAGACTGCGTCTACGCTGCAT
Barcode Number 43: CGTATCTCACAGTACTCAGATAGCGTCT
Barcode Number 48: GTAGTCATCTGTGCTCGATCACTGAGAC
Barcode Number 52: AGCGAGCAGATAGAGCACTGAGTAGTGC
The underlined portions satisfy the length requirements of a “first nucleotide domain” and the italicized portion satisfy the length requirements of a “second nucleotide domain”.
The above sequences have Levenshtein distances as described above.
Because the “first nucleotide domains” and “second nucleotide domains” have the recited Levenshtein distances, they are compatible with “next generation sequencing technology that utilizes bridge amplification” and “next generation sequencing that utilizes nanopores”, respectively.
It would have been prima facie obvious to have replace the “barcodes” of Zhao with the barcode sequences of Volkmuth. One would have been motivated to use the barcodes of Volkmuth because they are optimized for multiplex DNA sequencing (para. 3 and 49).
Claim(s) 29 is/are rejected under 35 U.S.C. 103 as being unpatentable over Zhao (US 2019/0085384 A1).
PNG
media_image4.png
235
472
media_image4.png
Greyscale
Regarding claim 29, Zhao teaches the following adaptor “oligonucleotide” in Fig. 1G:
The adaptors depicted above have “paired barcodes” comprising a combination of i5 and UMI2 and a combination of i7 and UMI1.
The elements “i5” and “i7” of Zhao refer to index sequences, which have a length of 8 nucleotides as depicted in Fig. 1I and 1J.
The elements UMI1 and UMI2 of Zhao have a length of 30 nucleotides when vRNUMI (para. 77), and thus are encompassed by aspects of the claimed “second nucleotide domain”.
The intended use or property recited in the “wherein” clauses do not limit the structures paired “barcodes”.
Zhao further teaches the barcodes are designed based on Levenshtein distances (para. 170; see also, para. 15, 80 and 226).
While the “paired barcodes” described above have a length of 38 nucleotides, Zhao teaches the UMI1 and UMI2 may be other lengths (para. 77). Thus, the claimed “paired 37mer barcodes” of claim 29 represent an obvious variant of those of Zhao. Based on the teachings of Zhao and based on design considerations, one would be reasonably able to arrive at barcodes having a length of 37 nucleotides.
Response to the traversal of the 103 rejection over Zhao
The Remarks summarize the rejection over Zhao (p. 11 of 12).
The Examiner’s position is detailed in the above rejection.
The Remarks argue MPEP § 2141 requires a reason or motivation to modify the prior art and Zhao provides no motivation for a POSITA to design barcodes for nanopore compatibility, as Zhao is exclusively focused on improving Illumina-based sequencing (p. 11 of 12). The Remarks further argue that nanopore sequencing presents a significantly higher error rate than bridge amplification, a technical problem Zhao does not contemplate (p. 11 of 12). The Remarks further argue the specific LD range (14-31) and the higher LD threshold for the second domain (LD of at least 4) are non-obvious results designed to overcome these nanopore-specific error and without the benefit of hindsight using Applicant's disclosure as a roadmap, there is no suggestion in Zhao to adopt these specific structural and mathematical parameters (p. 11 of 12).
The arguments have been fully considered but are not persuasive. The oligonucleotides of Zhao are obvious variants of those of claim 29. The structural elements of the claim and the oligonucleotides of Zhao vary based on a single nucleotide difference in length. It is noted that no specific Levenshtein distances between structural elements are defined. The claim generically describes an intended use that does not specify any particular structural elements that are required. The specification does not define what “minimum Levenshtein distances” are required by the claim. The specification does not point to any structural differences between the oligonucleotides and sequences and those rendered obvious by Zhao. The features upon which arguments rely (i.e., LD ranges of 14-31 between 37mers and LD thresholds for second domains) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
The Remarks point to no structural deficiencies that prevent the oligonucleotides of Zhao being “compatible” with nanopore sequencing. There is no requirement that limits the structural elements to those that overcome any sort of error rate associated with nanopore sequencing or to overcome any type of sequencing error rate. It is noted that nanopore sequencing is mentioned as being a method that is similarly used as SMRT™ technology in terms of single molecule sequencing.
In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, the structural difference between the claims and Zhao is a one base difference in length. Zhao acknowledges that their 38-mers may be of different lengths. One would be motivated to modify the lengths to optimize performance or based on design considerations of the oligonucleotide overall. Changing the length of an oligonucleotide by reducing it length by 2.6% has a reasonable expectation of success.
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
Conclusion
Claim 30 is free of the prior art.
-
-
-
-
-
-
-
-
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOSEPH G DAUNER whose telephone number is (571)270-3574. The examiner can normally be reached 7 am EST to 4:30 EST with second Fridays Off.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JOSEPH G. DAUNER/Primary Examiner, Art Unit 1682
Prosecution Insights