Prosecution Insights
Last updated: April 19, 2026
Application No. 18/027,250

COMPOSITIONS AND METHODS FOR INHIBITING ALPHA-SYNUCLEIN AGGREGATION

Non-Final OA §102§103§112
Filed
Mar 20, 2023
Examiner
O'NEILL, MARISOL ANN
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seelos Therapeutics Inc.
OA Round
1 (Non-Final)
47%
Grant Probability
Moderate
1-2
OA Rounds
3y 7m
To Grant
99%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allow Rate
8 granted / 17 resolved
-12.9% vs TC avg
Strong +75% interview lift
Without
With
+75.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
31 currently pending
Career history
48
Total Applications
across all art units

Statute-Specific Performance

§101
3.6%
-36.4% vs TC avg
§103
42.0%
+2.0% vs TC avg
§102
23.8%
-16.2% vs TC avg
§112
24.8%
-15.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 17 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Acknowledgement is made that the instant application is a National Stage of International application No. PCT/US2021/051758 (filed 09/23/2021), which claims the benefits of US Provisional Application No. 63/082,208 (filed 09/20/2020). Claim Objections Claim 31 is objected to because of the following informalities: Claim 13 depends from rejected claim 1 (See rejection below). However, claim 31 contains subject matter that would be allowable if written in independent form . Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 8, 68, and 76 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 8, 68, and 76 recite “α-synuclein (SEQ ID NO: 8)”. It is unclear whether the claims require any α-synuclein or specifically an α-synuclein encoded by SEQ ID NO: 8. Appropriate correction is required. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-4, 8, 13, 17, 76, and 79 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Eisenberg et al (WO2018005867A2). Eisenberg et al discloses inhibitory peptides that inhibits α-synuclein aggregation by binding to residues 68-78 of α-synuclein (See abstract and claim 1). The inhibitory peptide comprises a sequence of SEQ ID NO: 3, 4, 5, 6, or 7 (See claims 1 and 2). Eisenberg et al further discloses an expression vector encoding the inhibitory peptide (See claim 11). The vector can be a viral vector such as a lentivirus used to deliver the peptides to mammalian cells (See pg. 17, lns 20-21 and pg. 32, lns 11-15). The vector can further comprise regulatory sequences such as a promoter or an enhancer (See pg. 32, lns 1-7 and pg. 33, lns 3-7). The vector can be used to deliver a DNA encoding the inhibitory peptide to inhibit α-synuclein aggregation in a mammalian cell in vivo or ex vivo (See pg. 17, lns 21- 25, and claim 13). Additionally, Eisenberg et al disclose a method for treating a subject having a disease or condition which is mediated by the presence of fibrillated a-synuclein comprising administering to the subject an effective amount of an inhibitory peptide or pharmaceutical composition comprising the inhibitory peptide (See pg. 34, lns 3-7). Exemplary disease which can be treated by the method include Parkinson's disease (PD), Lewy body dementia, or multiple system atrophy (See pg. 34, lns 7-8). Regarding claim 1: Eisenberg et al discloses a viral vector comprising SEQ ID NO: 3 or 4 (reads on a composition comprising a viral vector). SEQ ID NO: 3 of Eisenberg comprises SEQ ID NO: 1 of the instant application and SEQ ID NO: 4 comprises SEQ ID NO: 2 of the instant application. See sequence alignments at end of office action. Regarding claim 2: Following the discussion of claim 1 above, Eisenberg et al discloses a viral vector comprising SEQ ID NO: 3 or 4. SEQ ID NO: 3 of Eisenberg has 100% similarity with SEQ ID NO: 3 of the instant application and SEQ ID NO: 4 has 100% similarity with SEQ ID NO: 4 of the instant application. See sequence alignments at end of office action. Regarding claim 3: Following the discussion of claim 1 above, Eisenberg et al discloses a viral vector comprising SEQ ID NO: 6 or 7. SEQ ID NO: 6 of Eisenberg has 100% similarity with SEQ ID NO: 6 of the instant application and SEQ ID NO: 7 has 100% similarity with SEQ ID NO: 7 of the instant application. See sequence alignments at end of office action. Regarding claim 4: Following the discussion of claim 1 above, Eisenberg discloses a viral vector comprising a peptide comprising a sequence of GAVVWGVTAVKK (SEQ ID NO: 3) or RAVVTGVTAVAE (SEQ ID NO: 4). SEQ ID NOs 3 and 4 comprise 12 amino acids each. Thus, Eisenberg discloses a composition comprising a viral vector with a peptide that is 9-45 amino acids in length. Regarding claim 8: Following the discussion of claim 1 above, Eisenberg discloses a composition comprising a viral vector comprising a peptide that inhibits α-synuclein aggregation by binding to residues 68-78 of α-synuclein. Regarding claims 13 and 17: Following the discussion of claim 1 above, Eisenberg discloses the vector can comprise a regulatory control sequence such as a promoter or an enhancer. Regarding claim 76: Eisenberg discloses a lentiviral vector can be used to express the α-synuclein inhibitory peptide which inhibits α-synuclein aggregation, in a mammalian cell which reads on a method of expressing a peptide that inhibits α-synuclein aggregation in a mammalian cell, comprising introducing the viral vector of claim 1 into the mammalian cell. Regarding claim 79: Eisenberg et al discloses a viral vector comprising an α-synuclein inhibitory peptide comprising a sequence of SEQ ID NO: 3 or 4 which reads on a kit comprising the composition of claim 1. The inclusion of written instructions in the kit of the instant application is not sufficient to differentiate the kit of the instant application from the kit disclosed by Eisenberg et al. Where the only difference between a prior art product and a claimed product is printed matter that is not functionally related to the product, the content of the printed matter will not distinguish the claimed product from the prior art. See MPEP2112.01(III) and In re Ngai, 367 F.3d 1336, 1339, 70 USPQ2d 1862, 1864 (Fed. Cir. 2004)) Claims 1, 10, 13, 17, 21, and 79 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Koprich et al (Molecular Neurodegeneration, 2010) as evidenced by rPeptide (alpha-synuclein A53T mutant page). Koprich et al discloses an AAV1/2 vector comprising 5’ and 3’ ITRs from AAV2, a CBA promoter hybridized with a CMV enhancer sequence, a human A53T α-synuclein sequence, a WPRE, and a bGH polyadenylation sequence (See pg. 10, Sec. Vectors). The vector of Koprich et al is used to express A53T α-synuclein in rats (See abstract). Regarding claim 1: Koprich et al discloses an AAV1/2 comprising a human A53T α-synuclein sequence. The amino acid sequence of A53T α-synuclein comprises SEQ ID NO:2 of the instant application. Thus, Koprich et al discloses a composition comprising a viral vector comprising a coding sequence that encodes a peptide comprising the amino acid sequence of SEQ ID NO: 2. See sequence alignment at end of office action. Regarding claim 10: Following the discussion of claim 1 above, Koprich et al discloses an AAV1/2 vector which reads on an AAV serotype 1 and 2 hybrid vector. Regarding claims 13, 17, and 21: Following the discussion of claim 1 above, the AAV of Koprich et al comprises a CMV enhancer hybridized to a CBA promotor (reads on hybrid CMV enhancer/CBA promoter) and a bGH polyadenylation sequence. Regarding claim 79: Koprich et al discloses a AAV vector comprising an A53T α-synuclein sequence. The A53Tα-synuclein sequence comprises SEQ ID NO:2 of the instant application. Thus, Koprich et al discloses a kit comprising the composition of claim 1. The inclusion of written instructions in the kit of the instant application is not sufficient to differentiate the kit of the instant application from the kit disclosed by Eisenberg et al. Where the only difference between a prior art product and a claimed product is printed matter that is not functionally related to the product, the content of the printed matter will not distinguish the claimed product from the prior art. See MPEP2112.01(III) and In re Ngai, 367 F.3d 1336, 1339, 70 USPQ2d 1862, 1864 (Fed. Cir. 2004)) Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-4, 8, 13, 17, 65-71, 76, and 79 are rejected under 35 U.S.C. 103 as being unpatentable over Eisenberg et al (WO2018005867A2). Regarding claims 65-71: Eisenberg discloses a method for treating a disease such as Parkinson’s disease, Lewy body dementia, or multiple system atrophy (read on neurodegenerative diseases and synucleinopathies) by administering an effective amount of the α-synuclein peptide inhibitor to a subject. The α-synuclein peptide inhibitor of Eisenberg inhibits α-synuclein aggregation. Thus, the method of treatment a disease disclosed by Eisenberg is also a method of reducing α-synuclein aggregation. Eisenberg further discloses the α-synuclein inhibitory peptide can be expressed in a mammalian cell, in vivo, using a lentiviral vector. Eisenberg does not disclose a treatment method comprising administering a viral vector. Although Eisenberg does not disclose a method of treatment comprising administering a viral vector, Eisenberg does disclose the α-synuclein inhibitory peptide can be introduced into a mammalian cell, in vivo, using a lentiviral vector. Thus, it would have been prima facie obvious to administer a lentiviral vector expressing the α-synuclein inhibitory peptide in the treatment method of Eisenberg to express the peptide within the subject’s cells. One would have been motivated to use a lentiviral vector in the method of Eisenberg because Eisenberg discloses a lentiviral vector can be used to express the peptide in cells. There is a reasonable expectation of success because using lentiviral vectors to express peptides in cells is a known technique in the field. Claims 1, 10, 13, 15, 17, 21, and 79 are rejected under 35 U.S.C. 103 as being unpatentable over Koprich et al (Molecular Neurodegeneration, 2010) as evidenced by rPeptide (alpha synuclein A53T mutant page) and in view of Otto-Wilhelm et al (Methods in Molecular Biology, 2011). The teachings of Koprich et al and rPeptide are set forth above. Koprich et al in view of rPeptide anticipates claims 1, 10, 13, 17, 21, and 79 Regarding claim 15: Following the discussion of claims 1 and 13 above, Koprich et al discloses an AAV comprising an A53T α-synuclein sequence which comprises the sequence of SEQ ID NO: 2 of the instant application. The AAV of Koprich et al further comprises a promoter and a polyA sequence. Koprich et al uses the vector to express A53T α-synuclein in rats. The vector of Koprich et al does not comprise a human influenza hemagglutinin (HA) tag. Otto Wilhelm et al teaches including a HA tag in a vector improves binding of the vector with host cells (See pg. 371, second paragraph) Given that Koprich discloses a vector for expressing a protein in rats and Otto-Wilhelm et al teaches including a HA tag in a vector can improve binding of vectors to host cells, it would have been prima facie obvious to include a HA tag in the vector of Koprich et al in order to improve binding of the vector to host cells. One would have been motivated to modify the vector in order to improve binding of the vector to the host cells. There is a reasonable expectation of success because including a HA tag in a vector is a known technique in the art. Conclusion Claim 31 contains subject matter that would be allowable if written in independent form. Claim 31 is drawn to a viral vector comprising a nucleic acid sequence of SEQ ID NO: 13 or SEQ ID NO: 14. The closest prior art is an AAV1/2-CMV/CBA-Null/Empty-WPRE-BGH-polyA vector, available from the Michael J. Fox Foundation for Parkinson’s Research (MJFF). The MJFF vector was previously used in Koprich et al as an empty vector control and to express human A53T α-synuclein (See teachings of Koprich et al above). The vector of MJFF comprises a sequence that is 90.8% similar to SEQ ID NO: 14 of the instant application (See addgene page for pAM/SAR-CAG-WPRE-bGHpA vector comprising the AAV1/2-CMV/CBA-WPRE-BGH-polyA expression cassette and sequence alignment below). The next closest prior art is SEQ ID NO: 141 of Bai et al (WO2016073704A1) which is a sequence to AAV8 expression vector pAM/CBA-pl-WPRE-bGH which is under the control of a CAG promoter. SEQ ID NO: 141 of Bai et al is 78.1% similar to SEQ ID NO: 14 of the instant application and 98% similar to nucleotides 1196-6461 or SEQ ID NO: 14. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARISOL A O'NEILL whose telephone number is (571)272-2490. The examiner can normally be reached Monday - Friday 7:30 - 5:00 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MARISOL ANN O'NEILL/Examiner, Art Unit 1633 /ALLISON M FOX/Primary Examiner, Art Unit 1633 Sequence Alignments Qy: SEQ ID NO: 1 vs DB: SEQ ID NO: 3 (WO2018005867A2) Query Match 100.0%; Score 46; Length 12; Best Local Similarity 100.0%; Matches 9; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AVVWGVTAV 9 ||||||||| Db 2 AVVWGVTAV 10 Qy: SEQ ID NO: 2 vs DB: SEQ ID NO: 4 (WO2018005867A2) Query Match 100.0%; Score 40; Length 12; Best Local Similarity 100.0%; Matches 9; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AVVTGVTAV 9 ||||||||| Db 2 AVVTGVTAV 10 Qy: SEQ ID NO: 3 vs DB: SEQ ID NO: 3 (WO2018005867A2) Query Match 100.0%; Score 62; DB 1; Length 12; Best Local Similarity 100.0%; Matches 12; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GAVVWGVTAVKK 12 |||||||||||| Db 1 GAVVWGVTAVKK 12 Qy: SEQ ID NO: 4 vs DB: SEQ ID NO: 4 (WO2018005867A2) Query Match 100.0%; Score 54; DB 1; Length 12; Best Local Similarity 100.0%; Matches 12; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 RAVVTGVTAVAE 12 |||||||||||| Db 1 RAVVTGVTAVAE 12 Qy: SEQ ID NO: 6 vs DB: SEQ ID NO: 6 (WO2018005867A2) Query Match 100.0%; Score 125; DB 1; Length 24; Best Local Similarity 100.0%; Matches 24; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GAVVWGVTAVKKGRKKRRQRRRPQ 24 |||||||||||||||||||||||| Db 1 GAVVWGVTAVKKGRKKRRQRRRPQ 24 Qy: SEQ ID NO: 7 vs DB: SEQ ID NO: 7 (WO2018005867A2) Query Match 100.0%; Score 107; DB 1; Length 22; Best Local Similarity 100.0%; Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 YGRKKRRQRRRAVVTGVTAVAE 22 |||||||||||||||||||||| Db 1 YGRKKRRQRRRAVVTGVTAVAE 22 Qy: SEQ ID NO: 2 vs DB: A53T Query Match 100.0%; Score 40; DB 1; Length 280; Best Local Similarity 100.0%; Matches 9; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AVVTGVTAV 9 ||||||||| Db 69 AVVTGVTAV 77 Qy: SEQ ID NO: 4 vs DB: pAM/SAR-CAG-WPRE-bGHpA from MJFF Query Match 90.8%; Score 5867.8; DB 1; Length 6210; Best Local Similarity 95.5%; Matches 6172; Conservative 8; Mismatches 30; Indels 251; Gaps 4; Qy 1 TAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 TAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACC 60 Qy 61 TTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATC 120 Qy 121 ACTAGGGGTTCCTTGTAGTTAATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ACTAGGGGTTCCTTGTAGTTAATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGC 180 Qy 181 TCTAGGTACGATCCCCAGCTTGCATGCCTGCAGGTCACTGTTCTCATCACATCATATCAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TCTAGGTACGATCCCCAGCTTGCATGCCTGCAGGTCACTGTTCTCATCACATCATATCAA 240 Qy 241 GGTTATATACCATCAATATTGCCACAGATGTTACTTAGCCTTTTAATATTTCTCTAATTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GGTTATATACCATCAATATTGCCACAGATGTTACTTAGCCTTTTAATATTTCTCTAATTT 300 Qy 301 AGTGTATATGCAATGATAGTTCTCTGATTTCTGAGATTGAGTTTCTCATGTGTAATGA… |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AGTGTATATGCAATGATAGTTCTCTGATTTCTGAGATTGAGTTTCTCATGTGTAATGA… Qy: SEQ ID NO: 4 vs DB: SEQ ID NO: 141 (WO2016073704A1) Query Match 78.1%; Score 5045.6; Length 5373; Best Local Similarity 98.0%; Matches 5161; Conservative 0; Mismatches 24; Indels 81; Gaps 2; Qy 1196 CCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGA 1255 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 189 CCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGA 248 Qy 1256 CGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCAT 1315 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Db 249 CGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCAT 308 Qy 1316 ATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCC 1375 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 309 ATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCC 368 Qy 1376 CAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC… ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 369 CAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC…
Read full office action

Prosecution Timeline

Mar 20, 2023
Application Filed
Sep 05, 2025
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600987
COMPOSITIONS AND METHODS FOR CIRCULAR RNA EXPRESSION
2y 5m to grant Granted Apr 14, 2026
Patent 12582678
METHOD FOR TREATING PLEURAL EFFUSION
2y 5m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 2 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
47%
Grant Probability
99%
With Interview (+75.0%)
3y 7m
Median Time to Grant
Low
PTA Risk
Based on 17 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month