DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Amendments
This action is in response to papers filed 25th June, 2026 in which claims 1-2, 5, 8, and 24 were amended, claims 10, 11, 15, 18, 21, and 26-28 were canceled, and no new claims were added. All of the amendments have been thoroughly reviewed and entered.
Any rejection or objection not reiterated herein has been overcome by amendment.
However, new rejections in view of amendments are set forth that are applicable to the current claims. Applicant's remarks have been fully considered but are moot because they do not specifically address the new rejections.
Election/Restrictions
Restriction:
Applicant's election of Group I (claims 1-9 and 24-25) drawn to a method of altering T-cells, in the reply filed on Nov 25th 2025 was previously acknowledged.
B. Species Selection:
Confirmation for the elected species SEQ ID NO: 1 or complement thereof, encompassed by claims 5 and 7-8, is acknowledged.
Claims 6, 9, 12-14, 16-17, 19-20, 22, and 23 withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected groups, there being no allowable generic or linking claim. The election/restriction is made final.
Status of Claims
Claims 1-5, 7-8, and 24-25 are present for examination.
Priority
Acknowledgment is made for this Application filed on 03/21/2023 which is a national stage application of PCT/US21/49606 filed on 9/9/2021 and claims priority from provisional application 63/083,452 filed on 9/25/2020.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994)
The disclosure of the prior-filed applications, Application Nos. 63/083,452 (22 pgs.) fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. The prior-filed application fails to provide support for the limitation of claim 3 “wherein the expression of the FOXP3S is enhanced relative to FOXP3L by transfecting Tregs with a nucleic acid encoding for the FOXP3S isoform”.
Accordingly, claims 1-2 and 24-25 have an effective filing date of 9/25/2020, and claim 3 and its dependent claims: 4-5 and 7-8, have an effective filing date of 9/9/2021, which is the filing date of PCT/US21/49606, where the earliest support for claim 3 can be found.
Information Disclosure Statement
No new information disclosure statements (IDS) were submitted.
New Claim Objections
Claim 5 is objected to because of the following informalities:
Claim 5 recites the phrase “comprising i) a nucleobase sequence having at a sequence identical to SEQ ID NO: 1 or iii) a complement of i)”
Claim 5 should recite the phrase “comprising i) a nucleobase sequence having a sequence identical to SEQ ID NO: 1 or ii) a complement of i)”.
Appropriate correction is required.
New Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-9 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites the phrase comprising the step of decreasing intracellular concentrations of FOXP3 isoform FOXP3L... And then in the last two lines recites wherein the expression of the FOXP3L is inhibited relative to FOXP3S by transfecting Tregs with an interference oligomer … Thus, the wherein clause recites expression is inhibited but there is no recitation of expression inhibition in the step before rather the step before is broadly drawn to decreasing concentrations, which encompasses expression inhibition but is not limited to it. The specification in pg. 3 states, “administering morpholino antisense oligonucleotides (MOs) to block the inclusion of the exon 2 region during pre-mRNA splicing to shift FOXP3 expression to the FOXP3S isoform” and in further pgs., describes experiments performed by such administration. Thus, nothing can be gleaned from the specification regarding the step of decreasing intracellular concentrations of FOXP3 isoform FOXP3L other than expression inhibition. Therefore, the metes and bounds of the claim are not clear.
Claim 4 recites the limitation “wherein said Tregs are transfected with an amount of said interference oligomer sufficient to induce the isolated Tregs to transdifferentiate into helper-like T cells”. However, claim 1, upon which claim 3 depends, and further upon which claim 4 depends, already recited the limitation transfecting Tregs with an interference oligomer. Thus, it is not clear whether the step wherein said Tregs are transfected of claim 4 is in addition to or the same as that already recited in claim 1. The specification does not state two rounds of transfection, neither does the claim recite, further transfecting. Yet, the step remains unclear because it is unclear how to induce the isolated Tregs to transdifferentiate as recited in the rest of claim is achieved.
Claim 5 recites the phrase wherein … by transfecting said Tregs with a FOXP3L targeting interference oligomer. As discussed for claim 4, claim 5 as written implies a further transfecting step.
Applicants may consider amending the phrase, “wherein the relative expression of the FOXP3L isoform is decreased by transfecting said Tregs with a FOXP3L targeting interference oligomer” to:
wherein the
Claim 5 again, recites the phrase “comprising i) a nucleobase sequence having at a sequence identical to SEQ ID NO: 1 or iii) a complement of i)”. Thus, claim 5 recites a group of alternatives that comprises “but is not limited to” the recited sample types. MPEP § 2173.05(h)(I), “If a Markush grouping requires a material selected from an open list of alternatives … e.g., … selected from the group ‘comprising’ [as in the instant case] … the claim should generally be rejected under 35 U.S.C. § 112(b) as indefinite because it is unclear what other alternatives are intended to be encompassed by the claim.” As noted above, claim 5 impermissibly uses open-ended “comprising” language. Accordingly, it’s unclear which Markush members (in addition to the ones expressly listed) should be included within the scope of these claims consistent with MPEP § 2173.05(h)(I).
The rejection may be overcome by amending the phrase to “consisting of i) a nucleobase sequence having a sequence identical to SEQ ID NO: 1 or ii) a complement of i)”.
Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 4 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claims 4-5 and 62-62 depend from claim 3 which in turn depends from claim 1. Claim 1 is a method with an active step of transfecting Tregs with an interference oligomer, but this claim refers only to the effect of such transfection but is written like a method to which no active step is specified.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
For e.g., Applicant may consider including claim 4 in to claim 1.
Claim Interpretation
The following recitation on pg. 2 forms the basis for understanding the nature of FOXP3S and FOXP3L: the human FOXP3 gene encodes two major isoforms through mRNA alternative splicing- a long full-length isoform (FOXP3L) and a shorter isoform lacking exon 2 region (FOXP3S), mouse Foxp3 gene only encodes the Foxp3L isoform.
Thus, i) FOXP3S is being interpreted as shorter isoform of FOXP3 lacking exon 2. Such an isoform may additionally lack other exons.
ii) FOXP3L is being interpreted as longer isoform of FOXP3 not lacking any exons.
Claim 1 is being given the BRI to mean: A method for altering regulatory T cells (Tregs) activity, said method comprising the step of decreasing intracellular concentrations of FOXP3 isoforms FOXP3L and increasing FOXP3S in said Tregs, wherein the step may occur in the Tregs or the microenvironment around the Tregs such that expression of FOXP3L relative to FOXP3S is reduced, and the step is specifically carried out by administering and interference oligomer that only targets exon 2 of FOXP3L.
Claim 4 and 24 interpretation, "transdifferentiate" as recited in the claim is being interpreted as per pg.14, lns 21-24: an artificial process in which one mature somatic cell is transformed into another mature somatic cell without undergoing an intermediate pluripotent state or progenitor cell type; “helper-like T cells” is not a term of art and so this term is being based on the disclosure on pg.4, lns 20-21: Tregs…transdifferentiated to helper-like T cells, and promote the anti-tumor immune response; therefore, the BRI is: a T cell that does not retain its Treg phenotype.
Claim 4 is being given the BRI to mean the step of transfecting that occurs in claim 1 results in transdifferentiation; i.e., no further transfection occurs.
Claim 5 is being given the BRI to mean the step of transfecting that occurs in claim 1 is with a FOXP3L targeting interference oligomer consisting of a nucleobase sequence; i.e., any length of nucleotides, wherein the sequence of nucleobases is identical to any portion of i) SEQ ID NO: 1 or a ii) a complement of i).
Similarly, Claim 8 is being given the BRI to mean the interference oligomer specifically binds to any length of nucleotides within TCCCTGCCCATTCACCGTCCATACCTGGTG (SEQ ID NO: 1).
Withdrawn Claim Rejections - 35 USC § 102
All previous 35 USC § 102 rejections have been withdrawn in view of amendments.
New Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-2 are rejected under 35 U.S.C. 103 as being unpatentable over Frith (Frith K et al., Journal of Allergy and Clinical Immunology, Volume 144, Issue 1, 2019, Pages 317-320.e8, ISSN 0091-6749) in view of Revenko (US 20200179435 A1, published 2020-06-11, previously cited) and evidenced by Magg (Magg et al., Eur J of Immunology, Volume 42, Issue 6, June 2012, Pages 1627-1638, previously cited) (claim 1).
Regarding claims 1-2, Frith is a clinical study on the role of FOXP3D2 isoforms. Frith teaches FOXP3D2 (instant FOXP3S) isoform supports Treg cell development and protects against severe IPEX syndrome (title). Frith teaches that FOXP3D2 is preferentially induced on Treg cell activation (pg. 317 middle para R col.). Frith teaches that in the absence of exon 2, FOXP3D2 is expressed and can support development of the a Treg cell phenotype (and cite prior art references that show the same in in vitro findings.9; In vitro studies using ectopic expression of FOXP3D2 have shown that this isoform can induce a Treg cell phenotype with dysregulated expression of specific genes and some suppressive function.2,3,9; pg. 318, last para R col). Frith teaches that they present the first evidence that FOXP3D2 alone can confer clinically relevant suppressive activity in Treg cells (pg. 320 second to the last para; findings provide powerful patient-derived evidence for the functional capabilities of the FOXP3D2 isoform, pg. 320 last para).
Thus provide the motivation to inhibit expression of FOXP3D2 alone as sufficient and necessary to suppress Treg activity; i.e., altering regulatory T cells (Tregs) activity.
Frith does not teach a method wherein the expression of the FOXP3L is inhibited relative to FOXP3S by transfecting Tregs with an interference oligomer that targets only exon 2 of FOXP3L.
However, before the effective filing date of instant invention, Revenko had taught compounds and compositions useful for inhibiting FOXP3 expression which can be useful for treating, preventing or ameliorating cancer (see title, and field [0002]). Revenko taught antisense oligonucleotides targeting FoxP3 (see Tables 1 -19) are such treatment options. Revenko taught antisense oligos result in a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal [0286]. Revenko taught the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions, … the target region is entirely within an intron…spans an intron/exon junction, [0287]. Revenko taught an oligonucleotide inhibiting FoxP3 mRNA expression by treating a Treg cell with a FOXP3 specific inhibitor ([0185]; Example 7, [0425]). Revenko also taught the resulting effect of inhibition of FOXP3. See Example 13 – 15, for e.g., Nuclear Foxp3 protein levels were measured in regulatory T-cells using flow cytometry (FOXP3 antibodies (Biolegend), [0457]). As evidenced by Magg, FoxP3L isoform is a transcriptional repressor and localizes to the nucleus but Δ2 isoform lacks such localization signal and therefore does not localize to the nucleus (pg. 1630, left col, middle para; pg. 1632, left col, middle para; Fig. 4). Since nuclear FOXP3 levels were detected, Revenko’s FOXP3 is equivalent to the claimed FoxP3L isoform.
Revenko teaches many interference oligonucleotides. For e.g., the 16 nucleotide long SEQ ID NO 1909 as shown below is identical to 16 nucleotides of instant SEQ ID NO: 1 and the 16 nucleotide long SEQ ID NO 1986 shown below that is identical to 15 nucleotides of instant SEQ ID NO: 10.
RESULT 42
US-16-684-271-1909
Sequence 1909, US/16684271
Patent No. 11547718
GENERAL INFORMATION
APPLICANT: Ionis Pharmaceuticals, Inc.
TITLE OF INVENTION: MODULATORS OF FOXP3 EXPRESSION
FILE REFERENCE: BIOL0344US
CURRENT APPLICATION NUMBER: US/16/684,271
CURRENT FILING DATE: 2019-11-14
PRIOR APPLICATION NUMBER: 62/924,001
PRIOR FILING DATE: 2019-10-21
PRIOR APPLICATION NUMBER: 62/767,123
PRIOR FILING DATE: 2018-11-14
NUMBER OF SEQ ID NOS: 3247
SEQ ID NO 1909
LENGTH: 16
TYPE: DNA
ORGANISM: Artificial sequence
FEATURE:
OTHER INFORMATION: Synthetic oligonucleotide
Query Match 53.3%; Score 16; Length 16;
Best Local Similarity 100.0%;
Matches 16; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 13 CACCGTCCATACCTGG 28
||||||||||||||||
Db 1 CACCGTCCATACCTGG 16
RESULT 8
US-16-684-271-1986
Sequence 1986, US/16684271
Patent No. 11547718
GENERAL INFORMATION
APPLICANT: Ionis Pharmaceuticals, Inc.
TITLE OF INVENTION: MODULATORS OF FOXP3 EXPRESSION
FILE REFERENCE: BIOL0344US
CURRENT APPLICATION NUMBER: US/16/684,271
CURRENT FILING DATE: 2019-11-14
PRIOR APPLICATION NUMBER: 62/924,001
PRIOR FILING DATE: 2019-10-21
PRIOR APPLICATION NUMBER: 62/767,123
PRIOR FILING DATE: 2018-11-14
NUMBER OF SEQ ID NOS: 3247
SEQ ID NO 1986
LENGTH: 16
TYPE: DNA
ORGANISM: Artificial sequence
FEATURE:
OTHER INFORMATION: Synthetic oligonucleotide
Query Match 88.2%; Score 15; Length 16;
Best Local Similarity 73.3%;
Matches 11; Conservative 4; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GUAUGGACGGUGAAU 15
|:|:||||||:|||:
Db 15 GTATGGACGGTGAAT 1
Thus, Revenko’s teachings of treating a Treg with a FOXP3 specific antisense inhibitor, wherein a reduction in FOXP3 in the treated Treg cell occurs, and contemplating the use of such oligomers in the treatment of cancer, reads on instant method of modifying intracellular concentrations of FOXP3 and altering Treg activity with an interference oligomer that targets only exon 2 of FOXP3L.
Therefore, it would be prima facie obvious to administer an interference oligomer that targets only exon 2 of FOXP3L as taught by Revenko in their method for inhibiting FOXP3
expression, to Treg cells to suppress Treg development as suggested by Frith because Frith provide the teachings and motivation to do so. Further, Frith had taught that inhibiting expression of FOXP3D2 (instant FOXP3S) alone is sufficient and necessary to suppress Treg activity. One skilled in the art would have a reasonable expectation of success because the composition used in the method would be performing the same function in the method of suggested by Frith as it was in the method of Revenko. Generally, it is prima facie obvious to select a known material for incorporation into a composition, based on its recognized suitability for its intended use. See MPEP 2144.07 and 2143 G.
Thus, Frith in view of Revenko make obvious instant claims 1-2.
Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Frith (Frith K et al., Journal of Allergy and Clinical Immunology, Volume 144, Issue 1, 2019, Pages 317-320.e8, ISSN 0091-6749) in view of Revenko (US 20200179435 A1, published 2020-06-11, previously cited) as applied to claims 1-2 above and further in view of Magg (Magg et al., Eur J of Immunology, Volume 42, Issue 6, June 2012, Pages 1627-1638, previously cited).
Regarding claim 3, the method of claim 1 made obvious by Frith in view of Revenko is discussed above.
Neither Frith nor Revenko had taught wherein the expression of the FOXP3S is enhanced relative to FOXP3L by transfecting Tregs with a nucleic acid encoding for the FOXP3S isoform.
However, before the effective filing date of instant invention, Magg had taught the significance of FOXP3Δ2 (instant FOXP3S). Magg had taught FOXP3 is a transcriptional repressor and localizes to the nucleus but Δ2 isoform lacks such localization signal and therefore does not localize to the nucleus (pg. 1630, left col, middle para; pg. 1632, left col, middle para; Fig. 4). Magg had further taught that translocation to the nucleus is necessary for T cells’ suppressive properties (pg. 1632, right col, middle para). Magg did not test the functional consequences of overexpressing FOXP3Δ2. Magg taught FOXP3Δ2 isoform expressing plasmid (§Plasmids, pg. 1636 L col.).
It would have been obvious to one of ordinary skills, before the effective filing date of the claimed invention, to have added to the method made obvious by Frith and Revenko (altering Treg cell activity by using FoxP3L antisense oligonucleotide), a step of transfecting Tregs with a nucleic acid encoding for the FOXP3S isoform as taught by Magg (i.e. FOXP3Δ2 plasmid). One with ordinary skills in the art would be motivated to do so for the advantage of increasing the levels of the FOXP3S isoform because Frith and Revenko provide the teachings for this isoform to not contribute to the suppressive effects of Treg cells, rather provide immune protection. One would further be motivated to do so to optimize the activity of T regulatory cells, for e.g., avoid cells’ immune escape and thus enhancing immunotherapy. One could have performed this modification with a reasonable expectation of success because all of Frith, Revenko, and Magg are drawn to optimizing T reg cell activity, focusing on blocking the suppressive activity of T regulatory cells by altering the various isoforms of FOXP3. See MPEP 2143 I A and 2144 II.
Thus, Frith and Revenko in view of Magg make obvious instant claim 3.
Claims 4-5 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Frith (Frith K et al., Journal of Allergy and Clinical Immunology, Volume 144, Issue 1, 2019, Pages 317-320.e8, ISSN 0091-6749) in view of Revenko (US 20200179435 A1, published 2020-06-11, previously cited) in view of Magg (Magg et al., Eur J of Immunology, Volume 42, Issue 6, June 2012, Pages 1627-1638, previously cited) as applied to claim 3 above and further in view of Morse (Morse, M.A. et al., Cancer Gene Therapy , vol. 19 (2012), pp: 30-37, previously cited) and claim 4 is evidenced by eBioscience (Retrieved from the internet <https://www.thermofisher.com/order/catalog/product/77-5776-40>, Technical details, rev 2017 [retrieved on 11the Feb 2026]) 5 pages, previously cited).
Regarding claim 4, the teachings of Frith and Revenko in view of Magg are discussed above and applied to claim 4.
Neither Frith nor Revenko nor Magg taught wherein in the method of claim 3 said Tregs are transfected with an amount of said interference oligomer sufficient to induce the isolated Tregs to transdifferentiate into helper-like T cells.
However, before the effective filing date of instant invention, Morse had taught modulating Treg levels by modulating FOXP3 levels as a means of altering Treg activity (modulation of Treg levels using the FOXP3 PPMO antisense-based genomic strategy has the potential to optimize immunotherapy strategies in cancer and viral immunotherapy, last line of abstract). Morse taught an oligomer, an arginine-rich cell penetrating, peptide-conjugated phosphorodiamidate morpholino oligomer (PPMO) targeting FOXP3 (see title and abstract ). Morse taught incubating the oligomer for 24hours with T cells (see page 32, left column, “Oligomer uptake in immune cells” and “Oligomer uptake in activated T cells” sections). Morse also taught an overnight incubation (i.e. about 12hours; see page 32, left column, last paragraph). Morse taught a resulting reduction is seen in levels of FoxP3 expression by qPCR. Morse taught a reduction in FoxP3 expressing cells during T cell activation (see Figure 5) determined by an anti-human FoxP3 Staining set (eBioscience, San Diego, CA, according to the manufacturer's directions, methods and materials). As evidenced by eBioscience, this antibody will detect the full-length form of FOXP3 (Foxp3 is a 49-55 kDa protein). Therefore, the reduction in FoxP3 seen by Morse, is a reduction in the long isoform of FOXP3; and the increase in T cell activation is an alteration of Treg activity.
Thus, Morse’s teachings of depleting Treg cells by a method of targeting full-length form of FOXP3 expression with a morpholino (PPMO) based antisense and consequently increasing antigen-specific T cells in response reads on instant method of altering Treg activity.
Further, Morse taught treatment of monocytes (PBMCs) for about 12 hour (i.e. overnight) with FoxP3 antisense oligonucleotide and analysis of effects at day 1 and 4. Morse taught the use of the oligonucleotide at 2.5 µM (see Figure 5). Morse taught that such dosing is sufficient to decrease suppressive phenotype and increase an activating (T helper-like) phenotype (These data suggest that the FOXP3-specific PPMO abrogates the increase in Treg that occurs during T-cell activation with IL-2 by reducing FOXP3 expression, lines bridging pg. 34-35). The changed phenotype from a suppressive cell type to an activated T cell type is indicative of transdifferentiating to a helper-like T cell as recited.
It would have been obvious to one of ordinary skills, before the effective filing date of the claimed invention, to have modified the method taught by Frith and Revenko (altering Treg cell activity by using FoxP3L antisense oligonucleotide targeting exon 2) and the method of transfecting Tregs with a nucleic acid encoding for the FOXP3S isoform as taught by Magg (i.e. FOXP3Δ2), by transfecting Tregs with an amount of said interference oligomer sufficient to induce the isolated Tregs to transdifferentiate into helper-like T cells. One with ordinary skills in the art would be motivated to do so for the advantage of dampening Treg activity in favor of an active immune response. One would further be motivated to so to optimize the activity of T regulatory cells to, for e.g., avoid cancer cells’ immune escape and thus enhance cancer immunotherapy. One could have performed this modification with a reasonable expectation of success because all of Frith, Revenko, Magg and Morse are drawn to optimizing T reg cell activity, focusing on blocking the suppressive activity of T regulatory cells by altering the various isoforms of FOXP3. See MPEP 2143 I A and 2144 II.
Regarding claims 5 and 8, as discussed for claim 1 above, Revenko teaches many interference oligonucleotides. For e.g., SEQ ID NO 1909 as shown above is identical to 16 nucleotides of instant SEQ ID NO: 1.
Thus, Frith and Revenko in view of Magg and further in view of Morse make obvious instant claims 4-5 and 8.
Claim 24 is rejected under 35 U.S.C. 103 as being unpatentable over Frith (Frith K et al., Journal of Allergy and Clinical Immunology, Volume 144, Issue 1, 2019, Pages 317-320.e8, ISSN 0091-6749) in view of Revenko (US 20200179435 A1, published 2020-06-11, previously cited) in view of Morse (Morse, M.A. et al., Cancer Gene Therapy , vol. 19 (2012), pp: 30-37, previously cited) and claim 4 is evidenced by eBioscience (Retrieved from the internet <https://www.thermofisher.com/order/catalog/product/77-5776-40>, Technical details, rev 2017 [retrieved on 11the Feb 2026]) 5 pages, previously cited).
Regarding claim 24, the teachings of Frith and Revenko discussed above as applied to claims 1-2 and the teachings of Morse as applied to claim 4 are similarly applied to claim 24. Specifically, Frith provides the motivation to inhibit expression of FOXP3D2 (FOXP3D2 alone as sufficient and necessary to suppress Treg activity; i.e., altering regulatory T cells (Tregs) activity pg. 318, last para R col; pg. 320 second to the last para; pg. 320 last para), Revenko teaches many interference oligonucleotides (SEQ ID NO 1909 as shown below is identical to 16 nucleotides of instant SEQ ID NO: 1), and Morse teaches abrogating increase in Treg that occurs during T-cell activation with IL-2 by reducing FOXP3 expression (lines bridging pg. 34-35).
The changed phenotype from a suppressive cell type to an activated T cell type is indicative of transdifferentiating to a helper-like T cell as recited.
It would have been obvious to one of ordinary skills, before the effective filing date of the claimed invention, to have combined the steps of the method taught by Frith and Revenko (altering Treg cell activity by using FoxP3L antisense oligonucleotide targeting exon 2) with a step of transfecting Tregs with an amount of said interference oligomer sufficient to induce the isolated Tregs to transdifferentiate into helper-like T cells as taught by Morse for the advantage of dampening Treg activity in favor of an active immune response. One would further be motivated to so to optimize the activity of T regulatory cells to for e.g., avoid cancer cells’ immune escape and thus enhance cancer immunotherapy. One could have performed this modification with a reasonable expectation of success because all of Frith, Revenko, and Morse are drawn to optimizing T reg cell activity, focusing on blocking the suppressive activity of T regulatory cells by altering the various isoforms of FOXP3. See MPEP 2143 I A and 2144 II.
Thus, Frith and Revenko in view of Morse make obvious instant claim 24.
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Frith (Frith K et al., Journal of Allergy and Clinical Immunology, Volume 144, Issue 1, 2019, Pages 317-320.e8, ISSN 0091-6749) in view of Revenko (US 20200179435 A1, published 2020-06-11, previously cited) in view of Morse (Morse, M.A. et al., Cancer Gene Therapy , vol. 19 (2012), pp: 30-37, previously cited) and claim 4 is evidenced by eBioscience (Retrieved from the internet <https://www.thermofisher.com/order/catalog/product/77-5776-40>, Technical details, rev 2017 [retrieved on 11the Feb 2026]) 5 pages, previously cited) as applied to claim 24 above in view of Gallego-Perez Nat Nanotechnol. 2017 October ; 12(10): 974–979.
Regarding claim 25, the method of claim 24 made obvious by Frith and Revenko in view of Morse is discussed above and is relevant here. Neither Frith, Revenko, nor Morse had taught wherein transfecting in vivo is via tissue nanotransfection.
However, before the effective filing date of instant invention, Gallego-Perez had taught a method of transfecting in vivo via tissue nanotransfection. Gallego-Perez’s method is a simple to implement non-viral approach to topically and controllably deliver reprogramming factors to tissues through a nanochannelled device (Fig. 1). Gallego-Perez exemplify this method in murine models of injury-induced ischaemia (Methods section pgs. 5-9).
It would have been obvious to one of ordinary skills, before the effective filing date of the claimed invention, to have modified the method taught by Frith and Revenko in view of Morse (altering Treg cell activity by using FoxP3L antisense oligonucleotide) with a protocol of transfecting Tregs in vivo following the method taught by Gallego-Perez. One with ordinary skills in the art would be motivated to do so for the advantages disclosed by Gallego-Perez; i.e., a simple to implement non-viral approach to topically and controllably deliver reprogramming factors to tissues through a nanochannelled device. One would further be motivated to so to optimize the activity of T regulatory cells to for e.g., avoid cancer cells’ immune escape and thus enhance cancer immunotherapy so as to enable a therapeutic means of treating cancer patients. One could have performed this modification with a reasonable expectation of success because all of Frith, Revenko, Morse, and Gallego-Perez are drawn to optimizing therapy for patients, focusing on delivering nucleic acids. See MPEP 2143 I A and 2144 II.
Thus, Frith, Revenko, Magg in view of Morse and further in view of Gallego-Perez make obvious instant claim 25.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
SHABANA S. MEYERING, Ph.D.
Examiner
Art Unit 1635
/SHABANA S MEYERING/Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights