DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Restriction:
Applicant's election of Group I (claims 1-9 and 24-25) drawn to a method of altering T-cells, in the reply filed on Nov 25th 2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
B. Species Selection:
Of NOTE: The species election in the same reply discussed above is overridden by the election made in a subsequent phone call, as depicted below:
During a telephone conversation with Applicant's representative, Ms. Ansuya Das, on 2/10/2026 a provisional election was made without traverse to prosecute the invention of elected species SEQ ID NO: 1 or complement thereof, claims 5 and 7-8. Affirmation of this election must be made by applicant in replying to this Office action.
Claims 6, 9, 12-14, 16-17, 19-20, 22, and 23 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected groups, there being no allowable generic or linking claim.
Status of Claims
Claims 1-5, 7-8, and 24-25 are present for examination.
Priority
Acknowledgment is made for this Application filed on 03/21/2023 which is a national stage application of PCT/US21/49606 filed on 9/9/2021 and claims priority from provisional application 63/083,452 filed on 9/25/2020.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994)
The disclosure of the prior-filed applications, Application Nos. 63/083,452 (22 pgs.) fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. The prior-filed application fails to provide support for the limitation of claim 3 “wherein the expression of the FOXP3S is enhanced relative to FOXP3L by transfecting Tregs with a nucleic acid encoding for the FOXP3S isoform”.
Accordingly, claims 1-2 and 24-25 have an effective filing date of 9/25/2020, and claim 3 and its dependent claims: 4-5 and 7-8, have an effective filing date of 9/9/2021, which is the filing date of PCT/US21/49606, where the earliest support for claim 3 can be found.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 03/21/2023, 10/03/2024, 01/07/2025, and 10/24/2025 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Objection - Specification
The disclosure is objected to because:
1. Trade name
The use of the term CIBERSORT (pg. 24), which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
2. Sequence
A list of 7 sequences that appears on pgs. 21-22, which is the same set of sequences that appears on pgs. 20-21, is missing the SEQ ID Nos. that appears on pgs. 20-21.
SEQ ID Nos. must be associated with the sequences even if they have appeared at the first time of listing these sequences.
3. Misspelling
FOXP3 is misspelled as FOX3. See pg. 4, second to the last para: … exon 2 of FOX3 can be used to shift cellular production of FOXP3L to FOXP3S expression.
Claim Objections
Claim 24 is objected to because of the following informalities: In line 3, the claim recites enhanced. It should recite: enhance.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4-5, 7-8, and 24-25 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 4 and 24 recite the phrase “helper-like T cells”. The disclosure on pg.4, lns 20-21 states: Tregs…transdifferentiated to helper-like T cells, and promote the anti-tumor immune response. However, this is not a limiting definition for “helper-like”. Since the instant specification is silent to a definition for the phrase “helper-like T cells,” and the state of the art does not clearly set forth a definition for the phrase, the scope of the phrase helper-like T cells is indefinite.
Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein.
Claim Interpretation
The following recitation on pg. 2 forms the basis for understanding the nature of FOXP3S and FOXP3L: the human FOXP3 gene encodes two major isoforms through mRNA alternative splicing- a long full-length isoform (FOXP3L) and a shorter isoform lacking exon 2 region (FOXP3S), mouse Foxp3 gene only encodes the Foxp3L isoform.
Thus, i) FOXP3S is being interpreted as shorter isoform of FOXP3 lacking exon 2. Such an isoform may additionally lack other exons.
ii) FOXP3L is being interpreted as longer isoform of FOXP3 not lacking any exons.
Claim 1 is being given the BRI to mean: A method for altering regulatory T cells (Tregs) activity, said method comprising the step of modifying intracellular concentrations of FOXP3 isoforms FOXP3L and FOXP3S in said Tregs, wherein the step of modifying may occur in the Tregs or the microenvironment around the Tregs such that expression of FOXP3L is reduced, and/or expression of FOXP3S is increased.
Claim 4 and 24 interpretation, "transdifferentiate" as recited in the claim is being interpreted as per pg.14, lns 21-24: an artificial process in which one mature somatic cell is transformed into another mature somatic cell without undergoing an intermediate pluripotent state or progenitor cell type; “helper-like T cells” is not a term of art and so this term is being based on the disclosure on pg.4, lns 20-21: Tregs…transdifferentiated to helper-like T cells, and promote the anti-tumor immune response; therefore, the BRI is: a T cell that does not retain its Treg phenotype.
Written Description Rejection
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-5 and 24-25 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 1
Regarding claim 1, the claim recites, “A method for … comprising the step of modifying intracellular concentrations of FOXP3…”. The term, “modifying” is given the broadest reasonable interpretation to mean chemically altering/increasing and / or decreasing levels of gene expression.
However, the specification only provides description for: i) a method of decreasing the levels of FOXP3L isoform which consequently increases levels of FOXP3S isoform (pgs. 14-18) and ii) transfecting Tregs with a gene that encodes the FOXP3S isoform (embodiment 11). In the specification section, for e.g. the following disclosed in pg. 33, altering the ratio of FOXP3 isoforms is seen:
PNG
media_image1.png
200
400
media_image1.png
Greyscale
Similarly, other paragraphs in the disclosure discuss altering ratios of levels of the isoforms. The specification does not have any written matter on "modifying" by for e.g., "chemically altering".
Thus, the specification lacks sufficient written description to show that applicant was in possession of the term “modifying” intracellular concentrations as recited in claim 1.
Claims 2 and 24
The instant specification on pg. 14, 2nd para states ''interference oligomer'' is any nucleic acid oligonucleotide or analog thereof that participates in post-transcriptional gene regulation such as silencing and splicing. Examples of interference oligomers includes, but is not limited to, phosphorodiamidate morpholino, double stranded RNA (dsRNA), small interfering RNA (siRNA), and microRNA (miRNA) that are comprised of sense and/or antisense strands.
Also, the instant specification bridging pgs. 3 and 4 states: In one embodiment the interference oligomer targets FOXP3 exon 2 and the Tregs are transfected either in vitro or in vivo. In one embodiment Tregs are transfected with both an interference oligonucleotide that targets exon 2 (present only in FOXP3L) and a nucleic acid that encodes for the FOXP3S isoform, thus simultaneously decreasing the production of FOXP3L and increasing FOXP3S production.
Thus, it is noted that the embodiments are not limiting means of enabling said function of targeting.
Therefore, an interference oligomer that targets FOXP3L can be interpreted to mean post-transcriptional repression of FOXP3 by any means. For example, such an interference oligomer can target the exon-intron boundary, the introns around exon 2, besides just exon 2 as there is no requirement for exclusively eliminating exon 2 from the pre-mRNA, which is a preferred embodiment, as the claim recites the latter to be optional.
Similarly, as required by claim 24, interference oligomer which is a FOXP3S-promoting oligomer can be interpreted to mean post-transcriptional repression of FOXP3L by any means, as reduction of FOXP3L would alter the ratio of FOXP3L to FOKP3S, even if the interference had no direct effect on FOXP3S.
Thus, the specification only provides description for: i) SEQ ID NO: 1 and variants of it for creating a short version of FOXP3 and ii) targeting exon 2 of FOX3 [sic] can be used to shift cellular production of FOXP3L to FOXP3S expression (see pg. 4, second to the last para).
The specification does not have any written matter on " targeting " by for e.g., complementary base-pairing of exon 2 nor does it have any written matter on FOXP3S-promoting oligomer, other than variants of SEQ ID NO: 1.
Guidance Provided by the Art
Klabenkova (Molecules 2021, 26, 5420) discuss many ways by which interference oligomers may be designed, each method being specific for the intended outcome. See Fig. 1 and also the following recitation from pg. 3:
PNG
media_image2.png
197
802
media_image2.png
Greyscale
Therefore, a generic description of “interference oligomer that targets FOXP3L” or “FOXP3S-promoting oligomer” does not confer sufficient detail that would result in an interference oligomer that would maintain the function of the interfered RNA. The scope of the claim encompasses an increase in FOXP3S isoform with a consecutive decrease in FOXP3L.
Thus, the specification lacks sufficient written description to show that applicant was in possession of the broad term “interference oligomer that targets FOXP3L” and “FOXP3S-promoting oligomer” as recited in claims 2 and 24 respectively.
Dependent Claims
Claims 3 – 4 and 25 are contingent on “interference oligomer that targets FOXP3L” and “FOXP3S-promoting oligomer”, as recited in claims 2 and 24 respectively and are therefore, not sufficiently described for at least the reasons above.
Therefore, these claims are rejected following the same analysis as described for claims 2 and 24.
Claim 5 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A3.(a).(i) states the following:
“The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by I. actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by II. functional characteristics coupled with a known or disclosed correlation between function and structure, or by III. a combination of such identifying characteristics, sufficient to show the inventor was in possession of the claimed genus.”
Satisfactory disclosure of a "representative number" depends on whether one of skill in the art would recognize that the inventor was in possession of the necessary common attributes or features possessed by the members of the genus in view of the species disclosed. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are "representative of the full variety or scope of the genus," or by the establishment of "a reasonable structure-function correlation." Such correlations may be established "by the inventor as described in the specification," or they may be "known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014).”
Claim 5 recites “transfecting said Tregs with a FOXP3L targeting interference oligomer comprising i) a nucleobase sequence having at least 85% sequence identity with SEQ ID NO: 1; or ii) at least a contiguous 10 nucleobase fragment of SEQ ID NO: 1; or iii) a complement of i) or ii)”.
Species Encompassed
For i) a nucleobase sequence having at least 85% sequence identity with SEQ ID NO: 1:
SEQ ID NO: 1 is 30 nucleotides in length. An interference oligomer in its broadest sense, comprises a sequence that comprises all of SEQ ID NO: 1. Thus, a nucleobase sequence having at least 85% sequence identity with SEQ ID NO: 1, as recited, includes a large genus of sequences comprising nucleotide sequences that may be ≤15% different from SEQ ID NO: 1; i.e., 4 nucleotides could be different. Furthermore, a nucleotide sequence could be or have:
up to 15% of the nucleotides removed from SEQ ID NO: 1;
a single chunk comprising ≤15% of the nucleotides different from SEQ ID NO: 1;
every 15th nucleotide (starting at any position) different from SEQ ID NO: 1;
every 15th nucleotide (starting at any position) removed from SEQ ID NO: 1;
any other combination of nucleotides mutated or removed as long as the total adds up to ≤15% of total nucleotides.
For ii) at least a contiguous 10 nucleobase fragment of SEQ ID NO: 1:
The scope encompasses any 10 contiguous bases of SEQ ID NO: 1.
For iii) a complement of i) or ii):
SEQ ID NO: 1 aligns with FOXP3 gene sequence:
NASEQ2_02122026_122351
Query Match 100.0%; Score 30; DB 1; Length 14273;
Best Local Similarity 100.0%;
Matches 30; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TCCCTGCCCATTCACCGTCCATACCTGGTG 30
||||||||||||||||||||||||||||||
Db 7203 TCCCTGCCCATTCACCGTCCATACCTGGTG 7232
Reverse complement of SEQ ID NO: 1 would be:
CACCAGGTATGGACGGTGAATGGGCAGGGA
Such sequence would not be expected to bind to the pre-mRNA of FOXP3. Therefore, would not be able to be an inhibitor of FOXP3. Therefore, the same considerations for a written description analysis would be applied to all three genera as further discussed below:
Each of those categories comprises a broad subgenus with diverse members and different structures that affect their functions. Some of those structures may have altered mRNA binding, to include off-target binding and thus toxicity.
Although the specification discloses what the SEQ ID NO is intended for, it does not teach any core structure that is responsible for the function of SEQ ID NO: 1. It does not teach which 15% of nucleotides may or may not be altered for the modified oligonucleotide to function. It does not teach which 85% of nucleotides must be present or must not be altered for the modified oligonucleotide to function. It does not teach the portion of the sequence necessary to carry out those functions. Although the specification taught what SEQ ID NO: 1 is in terms of their functional characteristic, the functional characteristic is not coupled with a known structure.
The specification has not adequately described the genus of sequences for these reasons.
Species Disclosed in the Specification
The specification discloses the use of one morpholino: “E2 MO” which comprises the sequence of SEQ ID NO: 11 (mouse, pg. 8) and SEQ ID NO: 8 (human morpholino oligo, pg. 9). Several examples with this morpholino are described. See for e.g., Figs. 8A-8F: Efficacy of intratumoral Foxp3 exon 2 targeting morpholino, and Figs. 10A & 10B. Effects of the human exon 2 targeting morpholino on human Tregs.
SEQ ID NO: 11 bears minimal resemblance to SEQ ID NO: 1 while SEQ ID NO: 8 is a fragment of SEQ ID NO: 1. Several other sequences listed are also fragments of SEQ ID NO: 1, as seen in the alignment below:
US-18-027-476-4 ~~CCTGCCCATTCACCGTCCATACC~~~~~~~~~~~~~~~~~~~~~~~~~
US-18-027-476-7 TCCCTGCCCATTCACCGTCCATAC~~~~~~~~~~~~~~~~~~~~~~~~~~
US-18-027-476-2 ~~~~~~~CCATTCACCGTCCATAC~~~~~~~~~~~~~~~~~~~~~~~~~~
US-18-027-476-1 TCCCTGCCCATTCACCGTCCATACCTGGTG~~~~~~~~~~~~~~~~~~~~
US-18-027-476-5 ~~~~TGCCCATTCACCGTCCATACCTG~~~~~~~~~~~~~~~~~~~~~~~
US-18-027-476-6 ~~~~~GCCCATTCACCGTCCATACCTGG~~~~~~~~~~~~~~~~~~~~~~
US-18-027-476-8 ~~~~TGCCCATTCACCGTCCATACCTGGT~~~~~~~~~~~~~~~~~~~~~
US-18-027-476-9 ~~~~~~~CCAUUCACCGUCCAUAC~~~~~~~~~~~~~~~~~~~~~~~~~~
However, other than SEQ ID NO: 8, no other sequence has been tested. Therefore, the specification taught one fragment sequence in the genus of recited species of SEQ ID NO: 1
Because the specification does not describe the locations of the oligonucleotide that may be altered in SEQ ID NO: 1, there is no guidance for the skilled artisan to prepare a modified oligonucleotide with less than 100% identity to SEQ ID NO: 8 that retains the claimed function. It is not predictable based on the species disclosed in the specification, or the level of guidance provided in the specification, that a skilled artisan could prepare an insert with less than 100% identity to SEQ ID NO: 8 and retain the claimed function.
In summary, the specification describes a single species within the claimed genus – a fragment of the sequence consisting of SEQ ID NO: 1. The specification does not provide predictability for sequences i) with less than 100% identity to SEQ ID NO: 8, ii) or ii) at least a contiguous 10 nucleobase fragment of SEQ ID NO: 1 or SEQ ID NO: 12; or iii) a complement of i) or ii) and which also target FOXP3 mRNA/DNA.
Guidance Provided by the Art
Jaschinski (US 2022/0372482 A1) teach that several hybridizing regions are present in the FOXP3 genomic/transcript sequence. See [0042] and pgs. 5-30. However, the efficiency of % inhibition of FoxP3 mRNA varied considerably with sequence and dose. See Table 18.
Inoue CA(3094303) teaches that although it is not necessary for these sequences to be completely complementary in order for hybridizing the antisense sequence portion of the antisense oligonucleotide with at least a part of the target RNA, it is further more preferably completely complementary [0110]. Thus, a nucleic acid having the same sequence as the target (like the complement of SEQ ID NO: 1) would not be predicted to inhibit FOX3PL expression because it would not be complementary to the strand that it is required to hybridize to.
Therefore, the art does not provide the missing details needed to make a nucleobase sequence having at least 85% sequence identity with SEQ ID NO: 1 i) a nucleobase sequence having at least 85% sequence identity with SEQ ID NO: 1; or ii) at least a contiguous 10 nucleobase fragment of SEQ ID NO: 1; or iii) a complement of i) or ii), that is commensurate with the scope of the claims.
Conclusion of Written Description Rejection
Conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. See Amgen v. Sanofi, 872 F.3d 1367 (Fed Cir. 2017) cited in MPEP 2163. Regardless of the percent sequence identity between a candidate sequence and a reference, one of skill in the art knows that the candidate sequence must retain the function of the reference polynucleotide (e.g., the ability to reduce a level of FOXP3L mRNA). Thus, while it is routine and conventional to make and screen antisense oligonucleotides and siRNA, it would require further experimentation to determine if either the oligonucleotide or the siRNA has at least 85% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 1 and possesses the desired biological activity (targets FOXP3L mRNA and inhibit/reduce expression of the mRNA). Therefore, the species disclosed in the instant specification does not represent the generic limitations recited in these claims and it is not clear that the inventors had contemplated the full scope of their generic claims and therefore do not seem to have full possession of the invention at the time of filing.
Therefore, claims 1 – 5 and 24-25 are rejected under 35 USC § 112a for inadequate written description.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-2 and 24 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Andersson (WO 2013/151490 A1, IDS).
Regarding claim 1, Andersson taught a method for amplifying an immune response in an individual, comprising altering the composition of FoxP3 isoforms by inducing expression of a FoxP3 isoform such as FoxP3d2d7, that inhibits the function of FoxP3fl and/or FoxP3d2 (abstract). In this method Treg cells are treated with a morpholino oligonucleotide that targets FOXP3fl which results in altered regulatory T cell activity. See the following two recitations:
pg. 16, lns 20-24: we targeted both exon 2 and exon 7 in TReg cells to be removed by alternative splicing using nucleofection with morpholino oligonucleotides. We confirmed successful deletion of exon 2 and exon 7 in these TReg cells using real-time PCR (data not shown). The TReg cells expressing increased levels of FoxP3d2d7 were less immunosuppressive when compared to control treated TReg cells when assayed in an in vitro suppression assay (Fig. 6)).
pg. 3, In 13-14: In the present study we provide several lines of evidence that we can increase the levels of the dominant negative FoxP3d2d7 isoform and thereby amplify immune responses.
pg. 3, In 28-31: This can also be done by increasing the levels of dominant negative FoxP3 isoforms using compounds that cause preferential upregulation of non-suppressive isoforms of FoxP3 or by shifting the splicing pattern away from FoxP3fl and FoxP3d2 by using antisense oligonucleotides.
Thus Anderson’s FoxP3fl isoform is equivalent to the claimed FoxP3L isoform and both of Anderson’s FoxP3d2 and FoxP3d2d7 are encompassed by the claimed FoxP3S isoform.
Thus, Andersson’s teachings of amplifying an immune response by a method that shifts the splicing pattern away from FoxP3fl and FoxP3d2 and consequently increases the levels of the dominant negative FoxP3d2d7 isoform, in Treg cells, reads instant method of altering Treg activity by increasing FOXP3S isoform (FoxP3d2d7 as taught by Andersson) relative to FOXP3L isoform (FoxP3fl as taught by Andersson).
Regarding claim 2, Andersson taught the method of claim 1, wherein Treg cells treated with a morpholino oligonucleotide that targets FOXP3L results in FOXP3S isoform expression being higher than FOXP3L isoform (pg. 16, lns 13-19: TReg cells delivered a morpholino oligonucleotide by nucleofection, which interfered with the splice events at exon 2 by steric hindrance. We could indeed see that this caused the splice-pattern of FoxP3 to change, as antibodies that bound all FoxP3 isoforms still gave an equally strong signal as control treated cells whereas antibodies that recognized exon 2 gave a much weaker signal than control treated cells (Fig 5). In this experiment a scrambled morpholino oligonucleotide was used as control).
Regarding claim 24, the teachings of Andersson discussed above as applied to claims 1-2 is similarly applied to claim 24. Further, Andersson taught the method wherein the relative expression of the FoxP3fl is decreased relative to FoxP3d2d7 by transfecting Treg cells with an antisense oligo, SEQ ID NO: 14. (pg. 16, lns 13-19: TReg cells and delivered a morpholino oligonucleotide by nucleofection, which interfered with the splice events at exon 2 by steric hindrance; pg. 12, In 13-17: T cells were transfected with 15 M MAO by using a Nucleotransfector device (Lonza) according to the protocol for human primary cells (P3 Primary Cell Nucleofector Kit). Andersson taught assessing the treated TReg cells for the changed phenotype. Andersson taught that Treg cells expressing increased levels of FoxP3d2d7 were less immunosuppressive when compared to control treated TReg cells when assayed in an in vitro suppression assay (Fig. 6) and produced more of the proinflammatory cytokine IL-17 in response to TCR stimulation in the presence of IL-1 (Fig. 7). The changed phenotype from a suppressive cell type to a less immunosuppressive phenotype is indicative of transdifferentiating to a helper-like T cell as recited.
Thus, Andersson anticipates instant claims 1 – 2 and 24.
Claims 1-2 and 24 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Morse (Morse, M.A. et al. "Depleting regulatory T cells with arginine-rich, cell-penetrating, peptide-conjugated morpholino oligomer targeting FOXP3 inhibits regulatory T-cell function". Cancer Gene Therapy , vol. 19 (2012), pp: 30-37) and claim 1 is evidenced by eBioscience (Retrieved from the internet <https://www.thermofisher.com/order/catalog/product/77-5776-40>, Technical details, rev 2017 [retrieved on 11the Feb 2026]) 5 pages).
Regarding claim 1, Morse taught modulating Treg levels by modulating FOXP3 levels as a means of altering Treg activity (modulation of Treg levels using the FOXP3 PPMO antisense-based genomic strategy has the potential to optimize immunotherapy strategies in cancer and viral immunotherapy, last line of abstract). Morse taught an oligomer, an arginine-rich cell penetrating, peptide-conjugated phosphorodiamidate morpholino oligomer (PPMO) targeting FOXP3 (see title and abstract ). Morse taught incubating the oligomer for 24hours with T cells (see page 32, left column, “Oligomer uptake in immune cells” and “Oligomer uptake in activated T cells” sections). Morse also taught an overnight incubation (i.e. about 12hours; see page 32, left column, last paragraph). Morse taught a resulting reduction is seen in levels of FoxP3 expression by qPCR. Morse taught a reduction in FoxP3 expressing cells during T cell activation (see Figure 5) determined by an anti-human FoxP3 Staining set (eBioscience, San Diego, CA, according to the manufacturer's directions, methods and materials). As evidenced by eBioscience, this antibody will detect the full-length form of FOXP3 (Foxp3 is a 49-55 kDa protein). Therefore, the reduction in FoxP3 seen by Morse, is a reduction in the long isoform of FOXP3; and the increase in T cell activation is an alteration of Treg activity.
Thus, Morse’s teachings of depleting Treg cells by a method of targeting full-length form of FOXP3 expression with a morpholino (PPMO) based antisense and consequently increasing antigen-specific T cells in response reads on instant method of altering Treg activity.
Regarding claim 2, Morse taught the method of claim 1 further comprising an oligomer, wherein the oligomer sequence is 19 bp in length and provide the sequence (see page 32, left column, lines 10-11). The limitation, optionally by targeting exon 2 of FOXP3, has not been considered because it has been recited as optional.
Regarding claim 24, the teachings of Morse discussed above as applied to claims 1-2 are similarly applied to claim 24. Further, Morse taught treatment of monocytes (PBMCs) for about 12 hour (i.e. overnight) with FoxP3 antisense oligonucleotide and analysis of effects at day 1 and 4. Morse taught the use of the oligonucleotide at 2.5 µM (see Figure 5). Morse taught that such dosing is sufficient to decrease suppressive phenotype and increase an activating (T helper-like) phenotype (These data suggest that the FOXP3-specific PPMO abrogates the increase in Treg that occurs during T-cell activation with IL-2 by reducing FOXP3 expression, lines bridging pg. 34-35).The changed phenotype from a suppressive cell type to an activated T cell type is indicative of transdifferentiating to a helper-like T cell as recited.
Thus, Morse anticipates instant claims 1-2 and 24.
Claims 1,2, and 24 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Cabon (US 20190336520) and claim 1 evidenced by Szylberg (ANTICANCER RESEARCH 36: 3789-3794, 2016).
Regarding claim 1, Cabon taught the use of a siRNA inhibiting the synthesis of the FoxP3 transcription factor as a medicament in the prevention and/or treatment of a condition associated with the expression of the FoxP3 factor (see [0033] and claim 28). As evidenced by Szylberg, eliminating exon 2 from FOXP3FL, the full-length isoform to result in FOXP3∆E2, is needed to suppress regulatory T cell (Tregs) function (The consequence of this phenomenon is higher interleukin (IL)-2 secretion and also proliferation because of T-cell stimulation, R col, 2nd para). Examiner interprets that “a condition associated with the expression of FoxP3” as taught by Cabon is a condition with an excess of FoxP3L.
Cabon taught a siRNA hybridizing with a FoxP3 mRNA and induces its degradation (see abstract, and [0031]-[0041]). Cabon taught combination therapy for a primary tumor or metastatic tumor or a pathology associated with the presence of suppressor or immunosuppressive cells, with the used of siRNA in combination with at least one anti-angiogenic agent or an anti-tumor agent or an immunotherapeutic agent (see page 33, claims 31 and 34, and see page 12, Table 2). The siRNAs are particularly used to suppress FOXP3 in Treg cells. See pertinent recitation:
[0032]: The FoxP3 targeting siRNAs are more particularly
used to target suppressive or immunosuppressive cells,
particularly suppressor T cells, also called regulatory T cells,
Thus Cabon’s FoxP3 and Szylberg’s FOXP3FL, is equivalent to the claimed FXP3L isoform.
Thus, Cabon’s teachings of treating cells/a subject with a FOXP3 siRNA, wherein a reduction in FOXP3 in the treated cell occurs, and contemplating the use of such oligomers in the treatment of cancer, reads on instant method of modifying intracellular concentrations of FOXP3 in Treg cells and altering Treg activity.
Regarding claim 2, Cabon taught the method of claim 1 further comprising oligonucleotides that are 19 to 23 nucleotides in length (see pages 22-32). Cabon’s SEQ ID NO: 49 (siFoxP3-2; see page 11, Table 1 ; [0137]) aligns with the following position on FOXP3 gene, where Cabon’s sequence is Qy:
Query Match 100.0%; Score 19; DB 1; Length 14273;
Best Local Similarity 68.4%;
Matches 13; Conservative 6; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CAUGGACUACUUCAAGUUC 19
||:||||:||::||||::|
Db 2752 CATGGACTACTTCAAGTTC 2734
As per information on this gene in the NCBI record, this portion does not lie in the region that would be missing in a deletion of Exon 2. Therefore, the siRNA taught by Cabon “targets” FOXP3L. Thus, by reducing FOXP3L levels, it is expected that levels of FOXP3L relative to FOXP3S will change.
Regarding claim 24, the teachings of Cabon discussed above as applied to claims 1-2 are similarly applied to claim 24. Since Cabon’s teachings anticipates the active steps of claim 24, no further teachings of Cabon are considered here.
Thus, Cabon anticipates instant claims 1-2 and 24.
Claim 1 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Revenko (US 20200179435 A1, published 2020-06-11) and evidenced by Magg (Magg et al., Eur J of Immunology, Volume 42, Issue 6, June 2012, Pages 1627-1638).
Regarding claim 1, Revenko taught compounds and compositions useful for inhibiting FOXP3 expression for treating, preventing or ameliorating cancer (see title). Revenko taught antisense oligonucleotides targeting FoxP3 (see Tables 1 -19) are such treatment options. Revenko taught antisense oligos result in a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal [0286]. Revenko taught the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions, … the target region is entirely within an intron…spans an intron/exon junction, [0287]. Revenko taught an oligonucleotide inhibiting FoxP3 mRNA expression by treating a Treg cell with a FOXP3 specific inhibitor ([0185]; Example 7, [0425]). Revenko also taught the resulting effect of inhibition of FOXP3. See Example 13 – 15, for e.g., Nuclear Foxp3 protein levels were measured in regulatory T-cells using flow cytometry (FOXP3 antibodies (Biolegend), [0457]). Since nuclear FOXP3 levels were detected, Revenko’s FOXP3 is equivalent to the claimed FoxP3L isoform. (As evidenced by Magg, FoxP3S isoform is a transcriptional repressor and localizes to the nucleus but Δ2 isoform lacks such localization signal and therefore does not localize to the nucleus (pg. 1630, left col, middle para; pg. 1632, left col, middle para; Fig. 4).
Thus, Revenko’s teachings of treating a Treg with a FOXP3 specific antisense inhibitor, wherein a reduction in FOXP3 in the treated Treg cell occurs, and contemplating the use of such oligomers in the treatment of cancer, reads on instant method of modifying intracellular concentrations of FOXP3 and altering Treg activity.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 3-5 and 7-8 are rejected under 35 U.S.C. 103 as being unpatentable over Andersson (WO 2013/151490 A1) as applied to claims 1-2 and 24 above and further in view of Magg (Eur J of Immunology, Volume 42, Issue 6, June 2012, Pages 1627-1638).
Regarding claim 3, the method of claim 1 as anticipated by Andersson is discussed above and is relevant here. Andersson had not taught wherein the expression of the FOXP3S is enhanced relative to FOXP3L by transfecting Tregs with a nucleic acid encoding for the FOXP3S isoform.
However, before the effective filing date of instant invention, Magg had taught the significance of FOXP3Δ2, which is recited as FOXP3S in instant application. Magg had taught FOXP3 is a transcriptional repressor and localizes to the nucleus but Δ2 isoform lacks such localization signal and therefore does not localize to the nucleus (pg. 1630, left col, middle para; pg. 1632, left col, middle para; Fig. 4). Magg had further taught that translocation to the nucleus is necessary for T cells’ suppressive properties (pg. 1632, right col, middle para). Magg did not test the functional consequences of overexpressing FOXP3Δ2.
It would have been obvious to one of ordinary skills, before the effective filing date of the claimed invention, to have added to the method taught by Andersson (altering Treg cell activity by using FoxP3L antisense oligonucleotide) a step of transfecting Tregs with a nucleic acid encoding for the FOXP3S isoform as taught by Magg (i.e. FOXP3Δ2). One with ordinary skills in the art motivated would be motivated to do so for the advantage of increasing the levels of the FOXP3S isoform as Magg speculate that this isoform may not contribute to the suppressive effects of Treg cells. One would further be motivated to so to optimize the activity of T regulatory cells to for e.g., avoid cancer cells’ immune escape and thus enhance cancer immunotherapy. One could have performed this modification with a reasonable expectation of success because both Andersson and Magg are drawn to optimizing T reg cell activity, focusing on blocking the suppressive activity of T regulatory cells by altering the various isoforms of FOXP3. See MPEP 2143 I A and 2144 II.
Regarding claim 4, Andersson in view of Magg taught the method of claim 3. Andersson further taught the method comprising assessing the treated TReg cells for the changed phenotype. Andersson taught, expressing increased levels of FoxP3d2d7 were less immunosuppressive when compared to control treated TReg cells when assayed in an in vitro suppression assay (Fig. 6) and produced more of the proinflammatory cytokine IL-17 in response to TCR stimulation in the presence of IL-1 (Fig. 7). The changed phenotype from a suppressive cell type to a less immunosuppressive phenotype is indicative of transdifferentiating to a helper-like T cell as recited.
Regarding claim 5, Andersson and Magg taught the method of claim 4, wherein the relative expression of the FoxP3fl is decreased relative to FoxP3d2d7 by transfecting Treg cells with an antisense oligo, SEQ ID NO: 14. (pg. 16, lns 13-19: TReg cells and delivered a morpholino oligonucleotide by nucleofection, which interfered with the splice events at exon 2 by steric hindrance; pg. 12, In 13-17: T cells were transfected with 15 M MAO by using a Nucleotransfector device (Lonza) according to the protocol for human primary cells (P3 Primary Cell Nucleofector Kit). MAO Sequences were as followed: 5'-TGCCCATTCACCGTCCATACCTGGT-3' (SEQ ID NO: 14)). As seen by sequence alignment, SEQ ID·NO: 14 nucleic acids 1-25 exhibit 100% identity to claimed SEQ ID NO: 1 residues 1-25 :
Query Match 83.3%; Score 25; DB 1; Length 25;
Best Local Similarity 100.0%;
Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 5 TGCCCATTCACCGTCCATACCTGGT 29
|||||||||||||||||||||||||
Db 1 TGCCCATTCACCGTCCATACCTGGT 25
Because the limitation recites “…i) a nucleobase sequence having at least 85% sequence identity with SEQ ID NO: 1 …”, this is being interpreted as a sequence having at least 85% sequence identity with any portion of SEQ ID NO: 1; the cited prior art anticipates the embodiments were administration of any fragment of the recited SEQ ID NO is required.
Regarding claim 7, the teachings of Andersson discussed above as applied to claim 5 is similarly applied to claim 7. Because the limitation of claim 7 recites “targeting interference oligomer that specifically binds to a sequence comprising CCATTCACCGTCCATAC (SEQ ID NO: 2)…”, this is being interpreted as any sequence of which SEQ ID NO: 2 is a part of; the cited prior art that makes obvious SEQ ID NO: 1, makes obvious SEQ ID NO: 2.
Regarding claim 8, the teachings of Andersson discussed above as applied to claim 5 is similarly applied to claim 8. Because the limitation recites “the interference oligomer specifically binds to a sequence selected from…”, this is being interpreted as any sequence of two nucleotides or more; the cited prior art that makes obvious the embodiments where administration of any fragment of the recited SEQ ID NO is required.
Thus, Andersson in view of Magg make obvious instant claims 3-5 and 7-8.
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Andersson (WO 2013/151490 A1, IDS) as applied to claim 24 above in view of Gallego-Perez Nat Nanotechnol. 2017 October ; 12(10): 974–979.
Regarding claim 25, the method of claim 24 as anticipated by Andersson is discussed above and is relevant here. Andersson had not taught wherein transfecting in vivo is via tissue nanotransfection.
However, before the effective filing date of instant invention, Gallego-Perez had taught a method of transfecting in vivo via tissue nanotransfection. Gallego-Perez’s method is a simple to implement non-viral approach to topically and controllably deliver reprogramming factors to tissues through a nanochannelled device (Fig. 1). Gallego-Perez exemplify this method in murine models of injury-induced ischaemia (Methods section pgs. 5-9).
It would have been obvious to one of ordinary skills, before the effective filing date of the claimed invention, to have modified the method taught by Andersson (altering Treg cell activity by using FoxP3L antisense oligonucleotide) a protocol of transfecting Tregs in vivo following the method taught by Gallego-Perez. One with ordinary skills in the art would be motivated to do so for the advantages disclosed by Gallego-Perez; i.e., a simple to implement non-viral approach to topically and controllably deliver reprogramming factors to tissues through a nanochannelled device. One would further be motivated to so to optimize the activity of T regulatory cells to for e.g., avoid cancer cells’ immune escape and thus enhance cancer immunotherapy so as to enable a therapeutic means of treating cancer patients. One could have performed this modification with a reasonable expectation of success because both Andersson and Gallego-Perez are drawn to optimizing therapy for patients, focusing on delivering nucleic acids. See MPEP 2143 I A and 2144 II.
Conclusion
No claims are allowed.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
SHABANA S. MEYERING, Ph.D.
Examiner
Art Unit 1635
/SHABANA S MEYERING/Examiner, Art Unit 1635
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635