DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Drawings
The drawings are objected to because the view numbers for Figures 2A-B, 3A-B and 10A-B are preceded by the word Figures instead of the abbreviation “FIG.” See 37 CFR 1.84(u)(1).
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. Figure 1 is an enumerated nucleotide sequence with at least ten defined nucleotides. It appears to be SEQ ID NO: 1.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). See page 8, paragraph 32; and page 36.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Objections
Applicant is advised that should claim 10 be found allowable, claim 12 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).
Claim 1 is objected to because of the following informalities: the abbreviation (TLR9) after the term ‘toll-like receptor 9 agonist’ is missing. The dependent claims refer to the abbreviation of the term instead of the term. One of skill in the art would understand the metes and bounds of the term “TLR9 agonist” in the dependent claims because the term is well-known in the prior art to refer to a toll-like receptor 9 agonist as set forth in claim 1.
The term “method” is missing after The on line 1 of claim 2.
Claim 7 is objected to because of the following informalities: There appears to be two periods at the end of the claim.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6, 7, 8, 10 and 12 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 6 recites the limitation "the catheter device" in line 2. There is insufficient antecedent basis for this limitation in the claim. It appears that the claim should depend on claim 4.
Claim 7 recites the limitation "the method of claim 1" in line 1. There is insufficient antecedent basis for this limitation in the claim. The Office cannot reasonably determine what the claim should depend from and the claims will not be examined further under prior art (103 rejection). Second, where there is a great deal of confusion and uncertainty as to the proper interpretation of the limitations of a claim, it would not be proper to reject such a claim on the basis of prior art. As stated in In re Steele, 305 F.2d 859, 134 USPQ 292 (CCPA 1962), a rejection under 35 U.S.C. 103 should not be based on considerable speculation about the meaning of terms employed in a claim or assumptions that must be made as to the scope of the claims. See MPEP 2173.06(II). Claim 8 is also rejected because it depends on claim 7.
Claim 10 recites the limitation "the method of claim 10" in line 1. There is insufficient antecedent basis for this limitation in the claim. Claim 12 is also rejected because it depends on claim 10. The Office can reasonably determine what the claim should depend from and it will be considered to be dependent on claim 9 because claim 9 is the first time the term checkpoint inhibitors is recited.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 9, 10 and 12 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Merck & Sharp & Dohme Corp. (US 20180169229, cited on an IDS).
One of the alternatives of Claim 40 on Page 20 of Merck discloses a method, medicament, use or kit for treating pancreatic cancer in a subject in need thereof comprising administering a therapeutically effective amount of PD-1 antagonist and a TLR9 agonist, wherein the PD-1 antagonist is pembrolizumab, or nivolumab and a toll-like receptor 9 (TLR9) agonist having the structure: SEQ ID NO: 45 (Db): 5' -TCG AAC GTT CGA ACG TTC GAA CGT TCG AAT-3'. SEQ ID NO: 45 of Merck is 100% identical to instant SEQ ID NO: 1 (Qy).
Qy 1 TCGAACGTTCGAACGTTCGAACGTTCGAAT 30
Db 1 TCGAACGTTCGAACGTTCGAACGTTCGAAT 30
The limitation ‘therapeutically effective amount’ is not specifically defined by the instant specification, thus any amount that can treat pancreatic cancer as taught by Merck would read on the limitation.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 2, 4-6 and 11 are rejected under 35 U.S.C. 103 as being obvious Merck & Sharp & Dohme Corp. (US 20180169229, cited on an IDS) as applied to claims 1, 9, 10 and 12 above, and further in view of Chomas et al. (US 20200038586, published 2/6/20 and EFD 8/1/18).
The applied reference has a common assignee with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
Merck does not specifically teach administering the TLR9 agonist by pancreatic retrograde venous infusion (PRVI) using a catheter.
However, ‘586 teaches PRVI of a therapeutic agent using a catheter to treat pancreatic cancer in a subject (pages 10-13). The method can be applied to range of chemotherapeutic, biologicals and other therapeutic agents (page 9). The catheter is a temporary occlusion device (pages 1-4). The drug is administered thru the catheter device via pressure-enabled delivery (abstract).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Merck taken with ‘586 to use PRVI for administering the TLR9 agonist to the subject having pancreatic cancer, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to successfully deliver the agonist to the subject having pancreatic cancer. ‘586 teaches the catheter is a temporary occlusion device. ‘586 also teaches that the drug is administered thru the catheter device via pressure-enabled delivery. Example 4 of Merck teaches anti-tumor activity of a combination of systemic administration of a checkpoint inhibitor and intra-tumoral injection of CpG oligonucleotide (TLR9 agonist). It would have been a simple substitution to use PVRI taught by ‘586 for delivering the TLR9 agonist to the subject and systemic administration of the checkpoint inhibitor to the subject to arrive at the claimed method steps in instant claim 11.
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 2, 4-6, and 11 are rejected under 35 U.S.C. 103 as being unpatentable Merck & Sharp & Dohme Corp. (US 20180169229, cited on an IDS) as applied to claims 1, 9, 10 and 12 above, and further in view of Jaroch et al. (WO 2019140381, published 7/18/19 and EFD 1/15/18).
Merck does not specifically teach administering the TLR9 agonist by PRVI using a catheter.
However, ‘381 teaches PRVI of a therapeutic agent using a catheter to treat pancreatic cancer in a subject (pages 1-7 and 40-43). The method can be applied to range of chemotherapeutic, biologicals and other therapeutic agents (pages 6-7 and 40-43). The catheter is a temporary occlusion device (pages 6-7 and 40-43). The drug is administered thru the catheter device via pressure-enabled delivery (abstract).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Merck taken with ‘381 to use PRVI for administering the TLR9 agonist to the subject having pancreatic cancer, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to successfully deliver the agonist to the subject having pancreatic cancer. ‘381 teaches the catheter is a temporary occlusion device (pages 6-7). ‘381 also teaches that the drug is administered thru the catheter device via pressure-enabled delivery (pages 6-7). Example 4 of Merck teaches anti-tumor activity of a combination of systemic administration of a checkpoint inhibitor and intra-tumoral injection of CpG oligonucleotide (TLR9 agonist). It would have been a simple substitution to use PVRI taught by ‘381 for delivering the TLR9 agonist to the subject and systemic administration of the checkpoint inhibitor to the subject to arrive at the claimed method steps in instant claim 11.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 2, 4, 6, and 11 are rejected under 35 U.S.C. 103 as being unpatentable Merck & Sharp & Dohme Corp. (US 20180169229, cited on an IDS) as applied to claims 1, 9, 10 and 12 above, and further in view of NCT04270929, ClinicalTrials.gov, version 1, posted 02/17/2020, retrieved on-line 3/4/26, pages 1-12.
Merck does not specifically teach administering the TLR9 agonist by PRVI using a catheter.
However, clinical trial NCT04270929 is directed to pressure enabled drug delivery by pancreatic retrograde venous infusion (PRVI) for advanced pancreatic carcinoma.
Brief Summary
This is an open label, single institution, dose-escalation phase 1 study designed to assess the feasibility, safety, and efficacy of oxaliplatin administered via Pancreatic Retrograde Venous Infusion (PRVI) using Pressure Enabled Drug Delivery (PEDD) technology. Oxaliplatin PEDD-PRVI is administered with systemic FOLFIRI (Folinic Acid (leucovorin), 5-FU, Irinotecan) followed by FOLFIRINOX (Folinic Acid (leucovorin), 5-FU, Irinotecan, oxalipatin) therapy for the treatment of patients with unresectable or metastatic pancreatic adenocarcinoma.
Arms:
Experimental: Oxaliplatin PEDD-PRVI
Two infusions of oxaliplatin (dose escalation: 20-40 mg) over the course of 4 weeks by Pancreatic Retrograde Venous Infusion (PRVI) utilizing Pressure Enabled Drug Delivery (PEDD) technology
Assigned Interventions:
Drug: FOLFIRI During Cycles 1 and 2, standard of care systemic FOLFIRI will be delivered on Days 2-4 following oxaliplatin PEDD-PRVI.
Drug: FOLFIRINOX
During Cycles 3-6, standard of care systemic FOLFIRINOX will be administered on Days 1-3.
Device: TriSalus Infusion System
The TriSalus Infusion System administers therapeutics using PEDD technology.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Merck taken with clinical trial NCT04270929 to use PEDD-PRVI using a catheter to administer the TLR9 agonist to a subject having pancreatic cancer, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to study the effectiveness of treatment of the cancer in the subject using the administration route taught in the clinical trial. Example 4 of Merck teaches anti-tumor activity of a combination of systemic administration of a checkpoint inhibitor and intra-tumoral injection of CpG oligonucleotide (TLR9 agonist). It would have been a simple substitution to use the PEDD-PVRI in place of intra-tumoral administration for delivering the TLR9 agonist to the subject and systemic administration of the checkpoint inhibitor to the subject to arrive at the claimed method steps in instant claim 11.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Merck & Sharp & Dohme Corp. (US 20180169229, cited on an IDS) as applied to claims 1, 9, 10 and 12 above.
Merck discloses:
The optimal dose for pembrolizumab in combination with CpG-C type oligonucleotide may be identified by dose escalation or dose de-escalation of one or both of these agents. In an embodiment, pembrolizumab is administered at 200 mg Q3W and the oligonucleotide of SEQ ID NO: 45 is intratumorally administered at a dose of from 1 to 16 mg once a week, preferably 1.0, 2.0, 4.0, 8.0 or 16.0 mg once a week. In one embodiment, a patient is treated with 200 mg of pembrolizumab Q3W on Day 1 and treated with the oligonucleotide of SEQ ID NO: 45 administered intratumorally at a dose from 1 to 16 mg on Day 1, preferably 1.0, 2.0, 4.0, 8.0 or 16.0 mg on Day 1, once a week for four weeks, followed by a dose of from 1 to 16 mg, preferably 1.0, 2.0, 4.0, 8.0 or 16.0 mg once every three weeks. In one embodiment, the oligonucleotide of SEQ ID NO: 45 is administered until progression or for up to 24 weeks after the first dose. In a further embodiment, the oligonucleotide of SEQ ID NO: 45 is administered intratumorally at a dose of from 1 to 16 mg, preferably 1.0, 2.0, 4.0, 8.0 or 16.0 mg on Day 1, once a week for four weeks, followed by a dose of from 1 to 16 mg, preferably 1.0, 2.0, 4.0, 8.0 or 16.0 mg once every three weeks for nine weeks. In another embodiment, the oligonucleotide of SEQ ID NO: 45 is administered until progression or for up to 24 weeks after the first dose. In an embodiment, the patient is confirmed to have progressive disease while receiving prior anti-PD-1 therapy. In another embodiment, pembrolizumab is administered intravenously and administered until progression or up to 45 weeks. See paragraph 193.
However, Merck does not specifically teach SEQ ID NO: 1 is administered at 0.5 mg, 2 mg, 4 mg, 8 mg, or 12 mg to treat pancreatic cancer in a subject in need thereof.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to use the amount set forth in instant claim 3, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to use the amounts set forth instant claim 3 to determine the optimal amount of the TLR9 agonist since Merck teaches that the instant doses are in the workable range of amounts of the agonist for treating pancreatic cancer.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Conclusion
See attached PTO-326 for disposition of claims.
Arepally et al. (US 20200108239, published 4/9/20 and EFD 10/8/18) and US 10780250 (cited on an IDS) could be used in a 103 rejections for claims 2 and 4-6, but another pre-grant publication with an earlier publication date was cited in a 103 rejection for claims 2 and 4-6.
Agah (US10099040) teaches occlusion catheter system for delivering a biologic agent or drug to a subject having pancreatic cancer (columns 43-48), but does not teach administering SEQ ID NO: 1 and/or using PRVI to administer an agent or drug to the pancreas of the subject.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636