Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 44-47 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for using ocular administration to deliver the composition of claim 42 to treat an ocular disorder in a subject in need thereof, wherein the subject has glaucoma or IOP, does not reasonably provide enablement for treating a genus of ocular disorders in a subject in need thereof using a genus of administration routes to deliver the composition of claim 42 to the subject in need thereof. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
The claimed invention embraces using an ANGPTL7 chemically modified siRNA to treat an ocular disease in a subject thereof comprising using any route of administration to deliver the siRNA to the subject. The claimed method broadly reads on using any ocular disorder and/or route to deliver the siRNA to the subject treat the ocular disease.
ANGPTL7 is implicated in various physiological conditions, including ocular disorder (IOP and glaucoma). “Although structurally related to the angiopoietins, ANGPTL7's function is poorly understood.” “Because ANGPTL7 is secreted and because extracellular matrix (ECM) deposition and organization is critical for aqueous humor resistance.” See Comes et al. Genes Cells 16, pages 243-259, 2011, cited on an IDS. Targeting ANGPTL7 can be used to treat IOP and glaucoma.
There are various developmental eye disorders that do not appear to involve ANGPTL7 (Fitzpatrick, Developmental eye disorders, 15, 348-353, 2005, cited on an IDS). “Failure of proper retinal development is linked to a heterozygous loss-of-function mutations in OTX2 that affects severe eye malformations ranging from bilateral anophthalmia (absence of the eye) to retinal dystrophy” (pages 351-352). In view of the broadest reasonable interpretation of the claimed method, malformation of the eye would be considered a developmental ocular disorder.
Praveen et al. (Communications Biology, 5, pg. 1-15, 2022, cited on an IDS) disclose that "Angptl7 knockout mice have lower (~2 mmHg) basal IOP [intraocular pressure] compared to wild-type" (Abstract). Thus, ANGPTL7 knockout does not result in anophthalmia and thus its inhibition would not cure anophthalmia, an ocular disorder.
The specification of the instant disclosure recites: "homeostatic intraocular pressure (IOP) is maintained by formation and drainage of the aqueous humor, primarily through the human trabecular meshwork (HTM).” “Approximately 70-90% of the aqueous humor is drained through this tissue and it is believed that a decrease in outflow though the TM leads to elevated IOP." See paragraph 1254 . Although, ANGPTL7 has a role in glaucoma, IOP and ocular hypertension, it does not result in a loss of an eye, and thus oligonucleotide targeting ANGPTL7 would not treat in a subject in need thereof a developmental malformation of an eye.
The teaching in the art for ANGPTL7 and genus of eye disorders is considered unpredictable. For example, eye disorders ranges from genetic disorder causing malformation of the eye to glaucoma, a range of pathophysiology and etiology that makes the art of treating eye disorders complicated. Additionally, as Comes (supra) points out "ANGPTL7's function is poorly understood" since it "is the least studied of all family members (abstract and pg. 243).”
Vicentini et al. (Pharmaceutical Research, 30, 915-931, 2013, cited on an IDS) teach, "considering that the systemic administration of siRNA faces important obstacles, including low bioavailability, systemic toxicity, rapid excretion and inefficient targeting to the affected organ or cell type, local administration has become an attractive and effective route, allowing the use of lower doses and reducing the side effects" (page 916) and provides reasons for these inefficiency: "difficult cellular uptake, a low rate of cell transfection, rapid degradation by endogenous enzymes resulting in a short half-life, a negative charge that prevents the crossing of the cell membranes and insufficient bioavailability.” “Therefore, the in vivo effectiveness of siRNA depends on its delivery to the target tissue and the intracellular compartment of the cell type of interest within the target tissue (page 915).”
Although oligonucleotide modification recited in the instant claims address the issue with nuclease degradation, there are still several enablement issues of siRNA delivery for treating an ocular disease or disorder, including delivery to the target tissue following a non-local administration since there is difficulty in cellular uptake and siRNA's negative charge results in a low transfection efficiency, and systemic toxicity. The current efficient mode of delivery is a local administration routes to specific tissues or organs, including the eye (Vicentini, page 917). For the eye (Vicentini, pages 924-926), there are also further physical barriers: tear film, corneal and conjunctiva epithelial cell, cornea, blood-retinal barrier; and as "a result of these anatomical and physiological constraints, topical application of drug results in a very low ocular bioavailability (page 924).” Table III discloses that for all ocular disorders the mode of treatment of siRNAs were intravitreal injection or topical administration (pg. 925); one noted disorder is glaucoma, and the mode of administration noted is topical administration, i.e. local administration (pg. 925-926).
The specification provides working examples for treating glaucoma and IOP pressure in human cell lines (including 3D model) and murine and non-human primate models using intravitreal, intraocular/intracameral injection. The specification does not appear to teach treating any other ocular disorder and/or using any other route of administration to deliver the siRNA to the animal models.
Thus, in view of the teaching in the art of record and working examples in the specification; the claimed method is only enabled for ocular administration of the chemically modified ANGPTL7 siRNA for treating IOP and glaucoma in a subject in need thereof.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-3, 6, 10-13, 16, 18, 22, 23, 42, and 44-47 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 10941404 (EFD 8/1/19, same inventors, cited on an IDS). Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace a pharmaceutical composition comprising a chemically modified ANGPTL7 siRNA comprising the chemical modification pattern set forth in instant claim 1 (see claims 11-13 of ‘404); and a pharmaceutically acceptable carrier, wherein the sense strand comprises SEQ ID NO: 1424, 1541, and 2091; and the antisense strand comprises SEQ ID NO: 3630, 3747 or 4297 and comprising 2 nucleoside additions (UU) of the sequences. SEQ ID NO: 11186 (Db) and 11306 in claims 11 and 18 of ‘404 appear to be 100% identical to SEQ ID NO: 11474 (Qy) and 11499 recited in instant claims 12, 13, 16, 18, 22, and 23.
Qy 1 AUAUGUACCAAGGAUGUUAUU 21
Db 1 AUAUGUACCAAGGAUGUUAUU 21
Claims 7-10 of ‘404 disclose the limitation of the lipid in instant claims 2, 3, and 6-7. The only difference is the instant claims 44-47 also are directed to treating an ocular disorder in a subject in need thereof. However, these method claims are obvious because when one of ordinary skill in the art looks for how to use the pharmaceutical composition in claims 1-20 of ‘404, they would arrive at columns 3-4 of the ‘404 disclosure. Columns 3-4 discloses using the composition to treat an ocular disorder in a subject in need thereof.
Claims 8 and 9 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 10941404 in view of Bahadur et al. (Mol. Pharmaceutics 2012, 9, 2719-2729) and Tang et al. (US 20090247604).
The rejection under NSDP for claim 1 over claims 1-20 of ‘404 is incorporated herein. The claims of ‘404 do not embrace an RGD peptide attached to the 3’ or 5’ terminus of the siRNA.
However, Bahadur et al teach cyclo (Arg-Gly-Asp-D-Phe-Cys) (cRGD) conjugation to a drug is expected to enhance delivery of the drug to cells overexpressing integrins (αvβ5 and αvβ3) (abstract and page 2720).
In addition, Tang teaches that αvβ5 and αvβ3 integrins are expressed in the eyes (pages 1, 2 and 9).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the claims of ‘404 taken with the teaching Bahadur and Tang to attach an cRGD peptide to a terminus of the siRNA, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to assist in delivery of the siRNA to a subject or a cell line expressing the integrins. A siRNA has four terminal ends, thus it would have been obvious to try attaching the cRGD peptide to the 5’ or 3’ terminus of the sense and/or antisense strand of the siRNA.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 1-3, 6, 10-13, 16, 18, 22, 23, 42, and 44-47 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-19 of U.S. Patent No. 12378556 (EFD 5/24/19, same inventors, cited on an IDS). Although the claims at issue are not identical, they are not patentably distinct from each other because , they are not patentably distinct from each other because both set of claims embrace a method of treating an ocular disorder in a subject in need thereof comprising ocular administration of a pharmaceutical composition comprising a chemically modified ANGPTL7 siRNA comprising the chemical modification pattern set forth in instant claim 1 (see claims 11-13 of ‘556); and a pharmaceutically acceptable carrier, wherein the sense strand is SEQ ID NO: 948, 1424, 1541, or 2091; and the antisense strand is SEQ ID NO: 3154, 3630, 3747, or 4297 and comprising 2 nucleoside additions (UU) of the sequences. SEQ ID NO: 11186 (Db) and 11306 in claim 11 of ‘556 appear to be 100% identical to SEQ ID NO: 11474 (Qy) and 11499 recited in instant claims 12, 13, 16, 18, 22, and 23.
Qy 1 AUAUGUACCAAGGAUGUUAUU 21
Db 1 AUAUGUACCAAGGAUGUUAUU 21
Claims 7-10 of ‘556 disclose the limitation of the lipid in instant claims 2, 3, and 6-7.
Claims 8 and 9 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-19 of U.S. Patent No. 12378556 in view of Bahadur et al. (Mol. Pharmaceutics 2012, 9, 2719-2729) and Tang et al. (US 20090247604).
The rejection under NSDP for claim 1 over claims 1-19 of ‘556 is incorporated herein. The claims of ‘556 do not embrace an RGD peptide attached to the 3’ or 5’ terminus of the siRNA.
However, Bahadur et al teach cyclo (Arg-Gly-Asp-D-Phe-Cys) (cRGD) conjugation to a drug is expected to enhance delivery of the drug to cells overexpressing integrins (αvβ5 and αvβ3) (abstract and page 2720).
In addition, Tang teaches that αvβ5 and αvβ3 integrins are expressed in the eyes (pages 1, 2 and 9).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the claims of ‘556 taken with the teaching Bahadur and Tang to attach an cRGD peptide to a terminus of the siRNA, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to assist in delivery of the siRNA to a subject or a cell line expressing the integrins. A siRNA has four terminal ends, thus it would have been obvious to try attaching the cRGD peptide to the 5’ or 3’ terminus of the sense and/or antisense strand of the siRNA.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Other than the 112(a) rejection for the method claims and the NSDP rejections, the claims appear to be free of the prior art. The claimed invention is directed to a ANGPTL7 siRNA comprising a sense and antisense strand, wherein the antisense strand targets a region of ANGPTL7 nucleotide sequence; wherein the siRNA is chemically modified with the patterns set forth in (i) and/or (ii) recited instant claim 1.
U.S. Patent No. 12378556 and U.S. Patent No. 10941404 list the same inventors and are excluded as a 102(a)(2) reference because of the 102(b)(1)(A) and 102(b)(2)(A) exceptions. The closest art is Gottesman et al. (WO 2021119019 and lists 4 out of 5 inventors of the instant application and is excluded as a 102a2 reference because 102(b)(1)(A) and 102(b)(2)(A) exception apply), which teach making and using a ANGPTL4 siRNA comprising a sense and antisense stand with the chemical modification patterns. Gottesman et al. do not specifically teach ANGPTL7 siRNA having the chemical modification patterns.
While 2’-fluoro-modified nucleosides, 2’-O-methyl modified nucleosides and phosphorothioate linkages are known in the prior art, the prior art does not teach or suggest the patterns set forth in (i) and/or (ii) in instant claim 1. The as-filed specification teaches making and using these siRNA to reduce ANGPTL7 expression in animal models and cell lines. The possible combinations of these three modifications in a 21-mer siRNA is in the millions. Kliuchnikov et al. (Molecular Therapy Nucleic Acids Vol. 36, pages 1-14, 2025) teach that the activity of a chemically modified siRNA has to be empirically determined. There is not a finite number of identified, predictable solutions to try making these chemically modified siRNA. See MPEP 2143(I)E.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to BRIAN WHITEMAN whose telephone number is (571)272-0764. The examiner can normally be reached Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/Primary Examiner, Art Unit 1636
Prosecution Insights