DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status and Election
Claims 1, 3, 8, 10, 12-13, 16, 18-26 and 29 are pending.
Applicant’s election of Invention 1, encompassing claims 1, 3, 8, 10, 12 and 24 and directed to methods of treatment, in the reply filed April 23, 2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Claims 13, 16, 18-23, 25-26 and 29 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
In the reply filed April 23, 2026, Applicant did not elect a species for the genus of “active agent that modifies expression/function” as required by the Restriction requirement, mailed December 23, 2025. Examiner telephoned Applicant on April 20, 2026, wherein Applicant elected an inhibitor nucleic acid (i.e., an siRNA or CRISPR guide RNA) that inhibits the expression of BRI3.
Claims 1, 3, 8, 10, 12 and 24 are under examination along with the species of BRI3 inhibitory nucleic acids.
Drawings
The drawings are objected to because the lines, shadings, numbers and letters of FIGs 1-5 are not sufficient to provide satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.” In the instant case, the text in FIGs 1-3 is very small or otherwise not sufficiently dense and dark to permit satisfactory reproduction characteristics; the letters over shading especially in FIG. 1 is completely illegible; the immunoblots in FIGs 4-5, especially FIG 5A, has shading that obscures the data.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Objections
Claims 1, 3, 12 and 24 are objected to because of the following informalities:
Claims 1, 3 and 12 recite “ATP5F1E (or ATP5E)”. The art recognizes the equivalence of the two names, ATP5F1E and ATP5E. for the gene that encodes the epsilon subunit of the mitochondrial ATP synthase F1 catalytic core. It is suggested to delete “(or ATP5E)” as it is unnecessary and could lead to confusion to those not skilled in the art.
Claim 3 appears to be missing “(iii)” before “the modification takes place…” in the enumerated list of options in the claim.
Claim 24 recites “wherein the neurodegenerative diseases is Parkinson’s…” spanning lines 1-2. “[D]iseases should be the singular form of the word “disease”.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 3, 8, 10, 12 and 24 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites “optionally wherein at least the expression and/or function of BRI3 is modified (increased) in the subject…” Use of the parentheses around “increased” renders the claim indefinite because it is not clear of the optional limitation requires increasing the expression or function of BRI3 (i.e., it is part of the claimed invention) or if that is merely a preference.
Claims 3, 8, 10, 12 and 24 are rejected for depending from claim 1 and not remedying the indefiniteness.
Claim 3 is indefinite for two additional reasons:
Claim 3 recites six options (i)-(vi), but there are no conjunctions between any of the options. It is not clear if all of the options are required, just one, or a subset of the options are required, which renders the scope of the claim indefinite.
Claim 3 recites “an antigen-binding antibody fragment (e.g., scFV, Fab, Fab’…)” in option (v). The use of “e.g.” and the parentheses renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim 8 is indefinite for three additional reasons:
Claim 8 recites “comprises or consists of” in options (ii), (iii), (iv) and (v). A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, “comprises” a specific sequence is a broad recitation, while “consists of” a specific sequence is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. For instance, it is not clear if the agent must ONLY consist of the sgRNA or if the a CRISPR nuclease is also to be included in the administration step.
Claim 8 also recites “(as annotated in Gene ID…or future annotations)”. This terminology is indefinite because it is not clear if the sgRNA must targe the recited genomic sequences specifically as the SEQ ID NOs 4-17, or if the sgRNA-targeted sequence can vary with future annotated sequences.
Claim 8 also recites “(depicted here in the “sense” orientation)” in options (ii) and (v). The inclusion of the parenthetical renders the sequence of the sgRNA indefinite. It is not clear if the sgRNA sequences must comprise the recited SEQ ID NOs, must comprise the antisense version of the SEQ ID NOs, or if the sgRNA sequence could be either the SEQ ID NO sequence or the antisense.
Claim 10 is indefinite for two additional reasons:
Claim 10 recites “a dopamine agonist (e.g., pramipexole, ropinrole…), a monoamine oxidase B (MAO B) inhibitor (e.g. selegiline…)” and two additional “(e.g.)” parenthetical phrases. The use of “e.g.” and the parentheses renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim 10 recites two options (i)-(ii), but there is no conjunction between them. It is not clear if each of the options is required or just one of the options are required, which renders the scope of the claim indefinite.
Claim 24 is indefinite for an additional reason. Claim 24 recites “a prion disease (e.g., Creutzfeldt-Jakob disease (CJD))”. The use of “e.g.” and the parentheses renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim Rejections - 35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3, 8, 10, 12 and 24 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A3.(a).(i) states, “whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention.”
For claims drawn to a genus, MPEP 2163.II.A3.(a).(ii) states, “written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species” where “representative number of species' means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.”
Claim 1 recites “an active agent that modifies the expression and/or function of BRI3…” and 36 additional genes. The specification teaches that agents can be nucleic acids, small molecules, peptides, aptamers, gene editing systems like TALENs and CRISPR/Cas, polymers and expression vectors ([0033]). Thus, the genus of possible agents could include nearly any biological molecule, which is an extremely vast and diverse genus. For the reasons described below, except for nucleic acids that have 100% identity to a DNA open reading frame, a mRNA transcript of the recited genes, or expression vectors that encode one of the recited genes, the genus of active agents that modify, inhibit and/or activate expression or activity of one of 37 genes is not sufficiently described.
The Specification provides no structural information about peptides, small molecules, polymers, aptamers, or antibodies that function to inhibit or activate any of the recited genes. The Specification provides a single example of CRIPSR/Cas guide RNA sequences that are able to produce indels at the BRI3 genomic locus (FIG 5). As such, Applicant has disclosed a single species, CRISPR/Cas9 sgRNAs, within the extremely large and diverse genus of “active agents”, which is not representative of either the breadth or diversity of the genus. SiRNAs and sgRNA have a structure-function relationship (i.e., 100% complementarity between the sequence of the targeted nucleic acid sequence and the siRNA or sgRNA). However, each of the other classes of molecules above do not have a structure-function relationship. How a polymer, peptide, antibody, small molecule or aptamer binds to the targeted protein or mRNA depends on the 3D structure; there is not a 1-for-1 code like for nucleic acid-based agents. As such the skilled artisan could not predict the structure for a polymer, aptamer, small molecule, peptide or antibody to interact with the DNA, mRNA or proteins to modulate the expression or activity of each of the 37 genes or gene products.
No antibody, polymer, peptide, small molecule, or aptamer structure is recited that correlates to the claimed function of inhibiting any of the 37 genes. A definition by function does not suffice to define the genus because it is only an indication of what the antibody, polymer, peptide, small molecule, or aptamer does, rather than what it is. To provide adequate written description and evidence of possession of the claimed antibody, polymer, peptide, small molecule, or aptamer genus, the instant specification in view of the art must structurally describe representative antibody, polymer, peptide, small molecule, or aptamer that function as an inhibitor, or describe structural features common to the members of the genus, which features constitute a substantial portion of the genus. Alternatively, the specification can show that the claimed invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics (see University of California v. Eli Lilly and Co., 119 F.3d 1559, 43 USPQ2d 1398 (Fed. Cir. 1997) and Enzo Biochem, Inc. V. Gen-Probe Inc.).
A few antibodies that can bind to some of the 37 gene products are commercially available that can be used to detect the genes by western blot, immunofluorescence or immune-histochemistry (e.g., Abcam, product ab101389, https://www.abcam.com/en-us/products/primary-antibodies/bri3-antibody-ab101389 [retrieved 5/5/2026]). However, the companies do not provide the structure of the anti-BRI3 antibody or any other antibodies. Additionally, none of the commercially available antibodies are disclosed as capable of inhibiting the activity of their protein target in cells, as would be necessary for enablement of the method.
Although Applicants may argue that it is possible to screen for an antibody, polymer, peptide, small molecule, or aptamer that function as claimed, the court found in that screening assays are not sufficient to provide adequate written description for an invention because they are merely a wish or plan for obtaining the claimed chemical invention. Rochester v. Searle, 358 F.3d 916, Fed Cir., 2004. “As we held in Lilly, “[a]n adequate written description of a DNA … ‘requires a precise definition, such as by structure, formula, chemical name, or physical properties,' not a mere wish or plan for obtaining the claimed chemical invention.” 119 F.3d at 1566 (quoting Fiers, 984 F.2d at 1171). For reasons stated above, that requirement applies just as well to non-DNA (or RNA) chemical inventions.” Knowledge of screening methods provides no information about the structure of any future antibody, polymer, peptide, small molecule, or aptamer yet to be discovered that may function as a modulator or expression and/or activity as claimed.
Additionally, around the time of the filing date, skilled artisans understood that discovering inhibitors of proteins generally was unpredictable. Wu observes that although computer-aided protein-inhibitor discovery technology was available, there is insufficient data to predict inhibitors of many proteins (Wu et al., Molecules (2019), 24: 4428). Wu writes: [U]nder many circumstances, it is hard to find a [compound] library with functionally and structurally diverse molecules with quantitative activity data for a given protein. More importantly, the lack of publications with negative results hinders the identification of inactive molecules, resulting often in the development of qualitative common feature pharmacophores only from active compounds. Finally, as LBVS applications are generally based on the properties of the known ligands, the diversity of the hits discovered are generally limited (Page 3 of 14, ¶2)
Given the lack of representative examples to support the full scope of the modulators of expression and/or activity encompassed by the claim, and lack of reasonable structure-function correlation with regards to the unknown sequences of an antibody, polymer, peptide, small molecule, or aptamer that provide can inhibit function or any of the 37 gene products, the specification does not provide an adequate written description of “active agents” that modifies the expression and/or function of the 37 gene products that is required to practice the claimed invention.
Claim Rejections - 35 USC § 112(a) – Enablement
Claims 1, 3, 8, 10, 12 and 24 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention and Breadth of Claims
The claims are drawn to methods of preventing and/or treatment of a neurodegenerative disease, which encompasses a very large and etiologically diverse genus of diseases, some of which are recited in claim 24. The claims also recite administering “an active agent that modifies the expression and/or function” of one of 37 genes. The structures of such agents are not sufficiently described for the reasons recited in the previous section. Nevertheless, even if they were sufficiently described, their administration would also encompass an extremely large genus that would require different routes, different target cells, and whose effects would vary greatly depending on the gene targeted, the pathway the gene is involved in, and the transcriptional state and environment of the cells. Accordingly, enablement of the method requires one skilled in the art to be able to treat and/or prevent the genus of neurodegenerative diseases by administering a large and diverse genus of “active agents” that targets the genus of recited genes.
Guidance in the Specification
The specification discovered 37 genes that are upregulated in monocytes in patients suffering from Parkinson’s Disease (PD) (Example 1). Of the 37 genes listed, only one gene, BRI3, was disclosed as “consistently upregulated” and was the only gene validated to determine if it played a role in monocyte activity ([0072]). Applicants found that when BRI3 gene was knocked out using Cas9/sgRNAs targeted to the BRI3 gene in a specific monocyte cell line, the cells produced fewer cytokines ([0072], Fig 5). The Specification states that a “growing number of studies implicate monocyte dysregulation in PD, but there is still not enough known about the PD-associated monocyte state” ([0072]). This suggests that it is unknown how monocyte activation and/or cytokine production facilitates PD initiation and/or progression. Applicant does not attempt to inhibit or activate any of the other genes found to be upregulated in PD patients in the monocyte cell line. Applicant does not attempt inhibit or activate the expression of BRI3 in a mouse or other animal model of PD. Applicant does not attempt to understand how decreased monocyte-originated cytokine production affects PD symptoms or disease progression.
Accordingly, in light of the specification, it is highly unpredictable how the skilled artisan could treat and/or prevent the genus of neurodegenerative diseases using the genus of active agents that modify the expression and/or activity of BRI3 or the other 36 genes recited in the claims.
State of the Prior Art
In regards to preventing a neurodegenerative disease, a thorough search of the prior and current art discovered no evidence that a neurodegenerative disease can be prevented by pharmaceutical interventions, let alone specifically modulating the expression and/or activity of the recited genes. An editorial by Ammar Al-Chalabi states “The remarkable ability of the body to buffer and compensate for change means that in fact, neurodegeneration begins well before first symptoms.” (Brain (2021), 144: 1279-1280). In fact, by the time a person first notices symptoms of PD, 90% of their neurons in the substantia nigra have been lost (page 1279, ¶1). Al-Chalabi goes on to discuss the challenges associated with trying to prevent neurodegenerative diseases and notes that “preventative” interventions are life-style (i.e., exercise, sleep, etc) and environmental based, not pharmaceutically based. Thus, it was entirely unpredictable how the skilled artisan could prevent any neurodegenerative diseases by administering the claimed active agents.
In regards to using nucleic acid therapies to treat Parkinson’s Disease, Li discusses the state of the art of nucleic acid therapeutics for PD as of the effective filing date of the claimed invention (Li et al., Med Res Rev. (2020), 40: 2650-2681). Li states “Recently, nucleic acid therapeutics have proven effective in the treatment of a number of severe neurological and neuromuscular disorders, drawing increasing attention to the possibility of developing novel molecular therapies for PD” (Abstract), which underscores the fact that no nucleic acid therapies have been developed to treat PD. Li does highlight the role of neuroinflammation in PD (Section 2.5): Convincing evidence exists that neuroinflammation is “involved” in dopaminergic neuron death and neurodegeneration, but Li only describes the contribution of microglia and T cells, not the monocytes of Applicant’s working model (Section 2.5). Li also teaches that microglia can produce both pro- and anti- inflammatory cytokines (Section 2.5). It is noted that in Applicant’s working example of BRI3-knockout in a monocyte cell line (Example 1; Fig 5), Applicant does not disclose the nature of the increased cytokine production, so it is not clear how to relate Applicant’s findings to the prior art represented by Li. Li lists the status of current nucleic acid therapeutic strategies for some genetic forms of PD (Table 2), which shows that 1) no therapeutic has made it past Phase I of clinical trials, and 2) most therapeutics are still under development. Although methods for administering nucleic acid therapeutics, such as siRNAs, antisense oligonucleotides (ASOs) and miRNAs are known in the art, no nucleic-acid based therapeutics for PD have been developed for any of the claimed gene products. Since the roles of the claimed gene products in PD are unknown, it is not predictable what the affect of a nucleic-acid targeting the claimed gene products would even have on healthy individuals, let along patients of neurodegenerative diseases. Finally, although CRISPR/Cas9 has been used extensively to recapitulate PD-linked mutations in various cell and mouse models, there is no evidence of using CRISPR-based technologies as therapeutics for treating PD (Safari et al., Cellular and Molecular Neurobiology (2020), 40: 477-493).
Regarding specifically inhibiting BRI3 (i.e., the elected active agent) in neurodegenerative disease, the role of BRI3 in any neurodegenerative disease is not well understood. Knocking out ITM2C (i.e., BRI3) in mice has no detectable phenotype, including on antigen secreting cells, although the gene is upregulated in melanoma cells (Trezise et al., International Journal of Molecular Sciences (2018), 19: 2161). MicroRNA-323 was discovered as a mediator of BRI3 mRNA; however, knockdown of BRI3 by siRNA induced neuronal cell death in rats that had been exposed to ischemic conditions, which would not be a predicted therapeutic result (Yang et al., Int. J. Clin. Exp. Pathol (2015), 8: 10725-10733; of record). Finally, Yasukawa and colleagues discovered that BRI3 inhibits Ab processing and aggregation, indicating that higher BRI3 expression is important for the suppression of Alzheimer’s Disease (Yasukawa et al., Cell Reports (2020), 30: 3478-3491). Thus, taken as a whole the prior art suggests that promoting and/or maintaining BRI3 expression might have a therapeutic affect on neurodegenerative diseases, which is the opposite effect proposed by Applicants.
Thus, in view of the prior art, it is highly unpredictable how the skilled artisan could treat and/or prevent the genus of neurodegenerative diseases using the genus of active agents that modify the expression and/or activity of BRI3 or the other 36 genes recited in the claims.
Experimentation Required
In order to practice the invention, one skilled in the art would need to develop active agents from each class of “agents” for each of the 37 claimed genes and administer them to mice models and/or patients in clinical trials for each of the neurodegenerative diseases listed in claim 24. As even a single agent class (once invented) designed to inhibit a single gene or gene product of the 37 listed for a single neurodegenerative disease would in and of itself be a clinical trial, the skilled artisan would conclude that it would have been undue experimentation to enable the invention across its claimed scope.
Taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant, and the lack of working examples of preventing and/or treating any neurodegenerative disease by administering any active agent, it is the conclusion that an undue experimentation would be required to make and use the invention.
Dependent claims
Each of claims 3, 8, 10, 12 and 24 do not limit at least the genes, the agent class, the neurodegenerative disease, and are therefore not enabled for the reasons above for claim 1. Although claim 8 limits the “active agent” to a CRISPR/Cas gene editing agent targeted to BRI3, there is not sufficient teaching in the Specification or prior art as to 1) how to deliver CRISPR/Cas agents to the CNS or 2) the effect of inhibiting BRI3 on neurodegenerative disease progression.
Additional Prior Art
US 2018/0092891 A1 (cited on PCT Written Opinion) discloses increasing BRI3 expression levels by administering a nitroxide antioxidant (i.e., an active agent) for the purpose of inhibiting Ab plaque formation (claim 1). However, the ‘891 publication fails to demonstrate that increasing BRI3 expression levels or providing nitroxide antioxidant actually reduces inhibiting Ab plaque formation. The publication is devoid of any data relating the plaque formation, treatment, or mouse model of Alzheimer’s Disease (AD). As such ‘891 does not appear enabling for a method of treating and/or preventing AD by administering a nitroxide antioxidant, or any BRI activity/expression activator.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3, 8, 10, 12 and 24 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of copending Application No. 18828030 in view of
Copending claim 1 recites, A method of preventing or inhibiting the differentiation of monocytes Into the M2 phenotype and/or for preventing or inhibiting the trafficking or migration of monocytes, e.g., M2 monocytes, into inflammatory sites in a subject in need thereof by inhibiting/preventing the expression and/or function of BRI3 in the subject (i.e., by administering an active agent that modifies the expression and/or function of BRI3). Copending claim 2 recites wherein (iv) the acute or chronic neuroinflammatory condition is caused by … a neurodegenerative disease or other inflammatory condition that affects the central nervous system (CNS); and (viii) the neurodegenerative disease of (iv) is selected from Alzheimer's disease, Parkinson's disease (PD), senility or another memory disorder, ataxia, motor neuron disease, multiple sclerosis (MS), Lewy body disease or Lewy body dementia (LBD), multiple system atrophy (MSA), progressive supranuclear palsy (PSP), amyotrophic lateral sclerosis (ALS) or motor neurone diseases (MND), Huntington's Disease (HD), spinocerebellar ataxia (SCA), Friedreich's ataxia (FA), spinal muscular atrophy (SMA), or prion disease (e.g., Creutzfeldt-Jakob disease (CJD)), optionally wherein the neurodegenerative diseases is PD. Copending claim 5 recites wherein the expression and/or function of BR13 or any of the genes recited in claim 4 is reduced by about 25%, about 30%, about 40%, about 45%, about 50%, about 55% about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%. Copending claim 10 recites wherein the active agent:(i) comprises a CRISPR/Cas gene editing agent against BR13; (ii) comprises or consists of a short-guide RNA (sgRNA) selected from the oligonucleotide sequences AACTCTATCGTGGTCGTAGG (SEQ ID NO:1), CGTCACAGGTGGGCCCGTAA (SEQ ID NO:2), GACTACGCGTGCGGCCCGCA (SEQ ID NO:3). Copending claim 12 recites further comprising administering at least one other active agent, optionally wherein the at least one other active agent is levodopa, carbidopa, a dopamine agonist (e.g., pramipexole, ropinirole, rotigotine, apomorphine), a monoamine oxidase B (MAO B) inhibitor (e.g., selegiline, rasagiline, safinamide), a catechol O- methyltrasnferase (COMT) inhibitor (e.g., entacapone, tolcapone), an anticholinergic (e.g., benztropine), or amantadine, or any combination thereof, further optionally comprising administering deep brain stimulation (DBS). Copending claim 14 recites The method of claim1, further comprising detecting the expression and/or function of BR13 in monocytes of the subject, and optionally one or more of FAM89B, PCBP1, ATP5F1E (or ATP5E), SH2B2, LMO2, TAF10, MAP2K2, TLE4, GRK6, RNF187, TNNT1, PTP4A2, SIAH2, YBX3, LAMP1, RPL8, EID2, CAPG, SRM, TMSB10, FYB, HLA-E, GLRX5, SEC61G, TMEM9, DBP, XRRA1, BLOC1S4, TUFM, HDDC2, EVL, UBB, RAC2, OAS1, LSP1, or ARF5, the expression of which is to be increased or decreased, wherein said detecting occurs prior, during and/or after said administrating, optionally wherein the detecting comprises detecting in one or more samples from the treated subject, optionally a blood sample and/or a brain sample. Therefore, the copending claims anticipated the examined claims.
This is a provisional nonstatutory double patenting rejection.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights