DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1-2, 5-6, 8-13 and 16-22 are pending.
Priority
Acknowledgment is made of applicant's claim for foreign priority based on an application filed in EPO on 10/05/2020. A certified copy of the EPO 20200140.0 application is in the application file. Note that the pages in the certified copy are in reverse order.
Status of the Application
Applicant’s response and amendment filed 05 May 2026 are acknowledged and entered.
Applicant has amended Claims 1-2, 10-12, 16-19. Applicant has added Claims 20-22. Applicant has cancelled claims 3-4 and 7. 1996.01+7748.28+1193.69
Response to Amendment
Applicant has amended the Spec. to overcome Objections; the objections are withdrawn.
Applicant has amended the Claims. to overcome Objections; the previous objections are withdrawn.
Applicant has amended Claims 1-2, 10-11, 16-18 to overcome the 112(a) Written Description rejection; the 112(a) rejection is maintained.
Applicant has amended Claims 18-19 to overcome the 112(a) Scope of Enablement rejection; the 112(a) Scope of Enablement rejection is maintained for Claim 18 and withdrawn for Claim 19.
Applicant has amended the claims to overcome the 112b rejections; the previous 112b rejections are withdrawn.
Applicant has amended the claims to overcome the 102 rejection; the 102 rejection is maintained.
Applicant has amended Claims 1-2, 10-12, 16-19 to overcome the 103 rejection; the 103 rejection is maintained.
The NSDP rejections are maintained.
Claims 1-2, 5-6, 8-13 and 16-22 are examined.
Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed.
Rejections not reiterated here are withdrawn.
Claim Interpretation
Claim 1 and claims depending therefrom recite … a sequence having at least 70% identity with SEQ ID NO 3…. A sequence having at least 70% identity with SEQ ID NO 3 has been broadly interpreted as requiring at least two consecutive nucleotides (i.e., “a sequence”) that have the recited identity to SEQ ID NO 3.
Claim 2 recites …the oligomeric compound has a sequence at least 70% complementary to positions 48-62 of SEQ ID NO 2. That claim has been interpreted as requiring a sequence at least 70% complementary to the entire sequence that is positions 48-62 of SEQ ID NO 2.
Claim 19 has been interpreted to depend from Claim 1 (see §Claim Objections).
Claim Objections
Claims 1, 5-6, 10, 12, and 19 are objected to because of the following informalities:
Claim 1 should recite one or more 2’ modified ribonucleic acid nucleosides in L4.
Claims 5 and 6 recite the limitation the oligomeric compound according to Claim 1… wherein the oligomeric compound comprises a tricyclo-DNA antisense oligont or a tricyclophosphorothioate DNA antisense oligont. Claim 1 can be interpreted as reciting/encompassing an antisense oligont (ASO). The recitation in Claims 5-6 wherein the oligomeric [nucleic acid] compound comprises a… antisense oligonucleotide [ASO] can be broadly interpreted as further comprising an additional antisense oligonucleotide (i.e., in addition to the oligomeric nucleic acid compound of Claim 1) or as meaning that the oligomeric nucleic acid compound of Claim 1 is the ASO.
In the interest of compact prosecution, Claim 5 is interpreted as reciting that the oligomeric nucleic acid compound of Claim 1 is an ASO and it’s required to comprise a [single] tc-DNA nucleotide. Claim 6 is interpreted as reciting that the oligomeric nucleic acid compound of Claim 1 is an ASO and it’s required to comprise a [single] tc-PS-DNA nucleotide. The claims are interpreted that way because nothing in the Spec. envisions any second ASO or ASO in addition to the oligomeric compound of Claim 1.
To be consistent with other claims, Claims 5 and 6 should recite tc-DNA instead of spelling out tricyclo.
Claims 10, 12, and 19 should revert to reciting the SEQ ID NOs in the claims.
Claims 12 and 19 will be better if they recite similar to Claim 10: in which capital letters designate tc-DNA nucleotides, and a lowercase letter designates a 2’ modified RNA nucleoside…
These claims should recite a 2’ modified RNA nucleoside. Since Claim 12 depends from Claim 1, a person of ordinary skill would understand that the modified RNA nucleoside refers to the one or more 2’ modified RNA nucleosides of Claim 1. Since Claim 19 recites the modified RNA nucleoside is typed in lowercase letter, Claim 19 is interpreted to depend from Claim 1 which recites that the oligomeric compound comprises one or more 2’ modified nucleosides.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 5-6, 8-11, 13, 16-18, and 20-22 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection. This rejection is maintained and updated in response to the claim amendments.
Claim 1 recites:
an oligomeric compound comprising 10 to 50 nucleosides comprising:
one or more tc-DNA nucleosides; and
one or more 2’ modified RNA nucleosides;
wherein the oligomeric compound has a sequence having at least 70% identity with SEQ ID NO 3, and the nucleosides of the oligomeric compound are joined by PO inter-nt linkages.
Claim 2 recites the oligomeric compound according to Claim 1, wherein the oligomeric compound has a sequence at least 70% complementary to positions +48+62 of SEQ ID NO 2.
Claim 10 recites oligomeric compounds wherein the compound comprises any of SEQ ID NOs 4-7.
Broad Claim 1 encompasses the large genus of compounds comprising a sequence that has any sequence of at least 2 or more nt that have at least 70% identity with SEQ ID NO 3. Claim 2 encompasses the large genus of compounds comprising a sequence that has at least 70% complementarity to positions 48-62 in SEQ ID NO 2. As discussed in §Claim interpretation, the recitation of Claim 1 a sequence having at least 70% identity with SEQ ID NO 3… is broadly interpreted as requiring at least two consecutive nucleotides (i.e., “a sequence”) that have the recited identity to SEQ ID NO 3. That could be a sequence of 2 nt that have 100% identity with SEQ ID NO 3 or a sequence of 5 nt that have at least 4 nt of identity (i.e., 4 out of 5 nt = 80% identity) with SEQ ID NO 3. Even if Claim 1 were interpreted narrowly, a narrower reading would mean as many as 4 nt could be missing or different from SEQ ID NO 3, so more than every 4th nt could be altered or missing or different.
The claims recite that the oligomeric compound comprises 10-50 nucleosides but comprises is open language that allows for additional components. Since SEQ ID NO 3 recites the open language, the claims encompass a huge number of nucleotide sequences that have at least 2 consecutive nt with 100% identity with any 2 consecutive nt in SEQ ID NO 3. Any 10-50-mer nucleotide sequence comprising a 2-mer that is 100% identical to SEQ ID NO 3—any 10-50-mer nt sequence comprising GG, GA, AG, AT, TG, GC, CA, GT, TT, and/or TC—would be encompassed by the claims as instantly presented.
Regarding Claim 2, a sequence having at least 70% complementarity to positions 48-62 of SEQ ID NO 2 requires a sequence of only 11 nt of complementarity (i.e., 70% × 15 nt = 10.5 nt but nt can’t be portions so = 11 nt). That means as many as 4 nt could be missing or different from SEQ ID NO 2, so every 4th nt could be altered or missing or different. Any nucleic acid sequence that has at least 70% identity with SEQ ID NO 2 would be encompassed by the claims as instantly presented.
Many nucleotide sequences would be encompassed by Claims 1 and 2 as instantly presented and Applicant hasn’t disclosed what specific structure(s) those oligomeric compounds must comprise to possess any useful function.
Broad Claim 10 encompasses the large genus of compounds comprising a sequence that is any of SEQ ID NOs 4-7. Since the claims recite the open language of comprises, the claims encompass sequences that comprise any of SEQ ID NOs 4-7 which includes sequences longer than those SEQ ID NOs as long as they are a maximum of 50 nucleosides long.
Claims 5-6 recite the oligomeric compound comprises an ASO. As discussed in §Objections, that claim can be interpreted in various ways including that the oligomeric compound comprises an additional ASO. Therefore the broad claim encompasses the large genus of oligomeric compounds comprising, in addition to the limitations of Claim 1, any additional ASO. Any ASO would be encompassed by the claims as instantly presented.
Furthermore, Claim 18 explicitly recites a use (namely treating DMD) for all the compounds encompassed by Claim 1. The compounds of Claim 2 also have an implied use: treating DMD. Applicant hasn’t demonstrated that all the compounds encompassed by their claims would be useful for treating DMD.
An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163.
The Spec. describes nucleic acid sequences (pp. 2-3) useful in their invention. The Spec. doesn’t describe using sequences wherein a sequence of as few as 2 or 5 nt has only at least 70% identity to SEQ ID NO 3 or wherein the nt sequence has at least 70% complementarity to positions 48-62 in SEQ ID NO 2.
Regarding what structure is encompassed by the oligomeric compounds having a sequence having at least 70% identity with SEQ ID NO 3 or having a sequence at least 70% complementary to positions 48-62 of SEQ ID NO 2, the Spec. does not provide information describing its features. The Spec. does not disclose any physical structure—any minimal physical structure that has at least 70% identity with SEQ ID NO 3 or has a sequence at least 70% complementary to positions 48-62 of SEQ ID NO 2 —that is required for the invention or that is necessary for the implied function of treating DMD or even just causing exon skipping in vitro.
Applicant’s examples show the following:
Examples 1 and 2 discuss devising the claimed compound SQY51 and evaluating toxicity in vitro.
Example 3/Fig. 6 shows SQY51 binds to albumin in human and macaque serum.
Example 4 shows (Fig. 7) plasma concentration and half-life of SQY51, SQY51 without PS linkages results in (Fig. 8) less complement activation and (Fig. 9) less coagulation misfunctioning, and results in (Fig. 10) less complement activation than SYN51. Fig. 11 shows SQY51 administered to monkeys distributes to organs. Table 2 shows SQY51 administered to cynomolgus monkeys causes more exon-51 skipping in muscles (vs. SYN51) after a 4 week treatment.
Example 5 shows (Fig. 12) SQY51 results in exon-51 sipping in monkey tissues after systemic administration. Fig. 13 shows SQY51 shows improved biodistribution in monkey muscles after systemic delivery. The Spec. also asserts subsequent exon-51 skipping levels in striated muscles were 10 times higher but provides no data showing that.
All the examples used SQY51 which is a specific sequence with specific modifications, namely SEQ ID NO 5. None of the examples uses any compound representing the full breadth of what is claimed (i.e., oligomeric compounds having a sequence having at least 70% identity with SEQ ID NO 3 or having a sequence at least 70% complementary to positions 48-62 of SEQ ID NO 2).
Those examples demonstrate possession of only the oligomeric compounds recited in Claims 12 and 19.
However, those examples are not sufficient to provide written description support for oligomeric compounds having a sequence having at least 70% identity with SEQ ID NO 3 or having a sequence at least 70% complementary to positions 48-62 of SEQ ID NO 2, which are the broad genera claimed. Although the claims recite (Claim 18) or imply (Claims 1-2, 5-6, 8-11, 13, and 16-17) certain functional characteristics (i.e., treating DMD by causing exon 51 skipping), the functional characteristic is not coupled with any known structure.
Although the Specification teaches the examples discussed above, it does not identify a core structure required for the claimed oligomeric compounds (Claims 1-2, 5-6, 8-11, 13, and 16-17) or necessary for performing the explicitly recited (Claim 18) or implied (Claims 1-2, 5-6, 8-11, 13, and 16-17) function(s) of treating DMD by causing exon 51 skipping. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for treating DMD by causing exon 51 skipping in such a way to demonstrate possession of the full invention as claimed at time of filing. The claimed oligomeric compounds having a sequence having at least 70% identity with SEQ ID NO 3 or having a sequence at least 70% complementary to positions 48-62 of SEQ ID NO 2 do not share a core structure.
The specification teaches only these species within the claimed genus/genera, namely SEQ ID NOs 3-7, but those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims: oligomeric compounds having a sequence having at least 70% identity with SEQ ID NO 3 or having a sequence at least 70% complementary to positions 48-62 of SEQ ID NO 2.
While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 1-2, 5-6, 8-11, 13, 16-18 are rejected for failing to demonstrate possession of the claimed invention. Claims 2, 5-6, 8-11, 13, 16-18 and 20-22 are rejected because they depend from Claim(s) 1 and/or 11 and do not remedy the issues.
Claim 18 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
A method of treating Duchenne Muscular Dystrophy (DMD) in a subject in need thereof by administering to the subject a therapeutically effective amount of a composition comprising the oligomeric compound according to any one of SEQ ID NOs 4-7, wherein the subject’s DMD is caused by a mutation that can be remediated by exon 51 skipping,
does not reasonably provide enablement for the full scope of the claims that encompass treating any DMD using any oligomeric compounds having a sequence having at least 70% identity with SEQ ID NO 3.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. This is a scope of enablement rejection. This rejection is maintained and updated in response to the claim amendments.
The factors to be considered in determining whether a disclosure would require undue experimentation include: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the specification; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 8 USPQ2d, 1400 (CAFC 1988) and MPEP 2164.01.
The breadth of the claims and the nature of the invention: With respect to claim breadth, the standard under 35 U.S.C. §112(a) entails determining what the claims recite and what the claims mean as a whole.
Claim 18 explicitly recites using any of the compounds of Claim 1 to treat DMD that can be remediated by exon 51 skipping. The broadest reasonable interpretation (BRI) of the methods of Claim 18 is that an artisan would be able to treat any DMD that can be remediated by exon 51 skipping in any subject by administering any of the compounds encompassed by Claim 1. The BRI of Claim 1 is any oligomeric compound that comprises from 10-50 nucleosides and one or more tc-DNA nucleosides and one or more 2’ modified RNA nucleosides, wherein the oligomeric compound has a sequence having at least 70% identity with SEQ ID NO 3. As discussed in §Claim interpretation, a sequence having at least 70% identity with SEQ ID NO 3 is interpreted as even as few as two nts that have 100% identity with SEQ ID NO 3 or any sequence of 2 or more nt that has at least 70% identity with SEQ ID NO 3. The claims recite that the oligomeric compound comprises 10-50 nucleosides but comprises is open language that allows for additional components. As explained in §112(a) Written Description, the claims encompass a huge number of nucleotide sequences that have at least 2 consecutive nt with identity with any 2 consecutive nt in SEQ ID NO 3. Any 10-50-mer nucleotide sequence comprising 2-mer that is 100% identical to SEQ ID NO 3—any 10-50-mer nt sequence comprising GG, GA, AG, AT, TG, GC, CA, GT, TT, and/or TC—would be encompassed by the claims as instantly presented.
The nature of the invention is ASO compounds for treating any DMD that can be remediated by exon 51 skipping and a method for treating any DMD that can be remediated by exon 51 skipping by administering any of the broad genus of compounds recited in Claim 1 (i.e., Claim 18). A skilled artisan would not be able to use the method as claimed with a reasonable expectation of success based solely on what is disclosed in the specification.
The state of the art and prior art, the level of one of ordinary skill, and the level of predictability in the art: The art and prior art shows: it would not be possible to treat any DMD caused by mutations in any exon with the full breadth of the claimed compounds.
Regarding the point above, as discussed in the Written Description rejection and above, instant Claim 1 encompasses a huge number of ASO compounds that can comprise a huge breadth of sequences. An artisan would determine that, without presentation of evidence to the contrary, it is not possible to treat DMD using any ASO comprised by the genus and sub-genera encompassed by the claims because the claims encompass a huge number of compounds and the art teaches ASO must have sequence specificity to a target in order to hybridize. The art of Aartsma-Rus (and van Ommen. 2007. Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications. RNA 13[10]:1609–1624, “Aartsma”, of record) teaches (§Introduction ¶1) antisense oligos (ASO/AON) must hybridize to their target. Aartsma teaches (§AON DESIGN AND MODE OF ACTION, entire § but especially ¶4; Fig. 1 caption) ASO/AON must be designed to be specific to a target site and target location affects efficacy because location of hybridization determines what portion(s) are hidden from splicing machinery. Aartsma teaches (§AON specificity) one of the most important features of the AON has to be specificity, in order to avoid long-term side effects.
Those teachings indicate that an ASO/AON must have sequence specificity for a specific target in order to provide exon skipping function.
Therefore, the art regarding the effect of the full breadth of the claimed compounds encompassed by Claim 1 in treating any DMD that can be remediated by exon 51 skipping is unpredictable.
The amount of direction provided by the specification and the existence of working examples: What is enabled by the working examples is narrow compared to the breadth of the claims.
Examples 1 and 2 discuss devising the claimed compound SQY51 and evaluating toxicity in vitro.
Example 3/Fig. 6 shows SQY51 binds to albumin in human and macaque serum.
Example 4 shows (Fig. 7) plasma concentration and half-life of SQY51, SQY51 without PS linkages results in (Fig. 8) less complement activation and (Fig. 9) less coagulation misfunctioning, and results in (Fig. 10) less complement activation than SYN51. Fig. 11 shows SQY51 administered to monkeys distributes to organs. Table 2 shows SQY51 administered to cynomolgus monkeys causes more exon-51 skipping in muscles (vs. SYN51) after a 4 week treatment.
Example 5 shows (Fig. 12) SQY51 results in exon-51 sipping in monkey tissues after systematic administration. Fig. 13 shows SQY51 shows improved biodistribution in monkey muscles after systemic delivery. The Spec. also asserts subsequent exon-51 skipping levels in striated muscles were 10 times higher but provides no data showing that.
Those examples demonstrate (Fig. 12) only an ability to skip exon 51, not any exon. They demonstrate the ability to skip exon 51 only by using a specific sequence comprising specific modifications. That is because all the examples used SQY51 which is a specific sequence with specific modifications, namely SEQ ID NO 5. None of the examples uses any compound representing the full breadth of the compounds encompassed by Claim 1 (i.e., an oligomeric compound comprising from 10-50 nucleosides wherein the oligomeric compound has a sequence having at least 70% identity to SEQ ID NO 3) to treat any DMD caused by a mutation that can be remediated by exon 51 skipping.
Therefore nothing in Applicant’s Examples make the compounds and methods any less unpredictable. The Specification provides no evidence of using any compounds besides those comprising the specific sequence of nucleotides comprising SEQ ID NO 3 (i.e., SEQ ID NOs 4-7) to induce skipping of exon 51. Although the level of an artisan is high, the art of treating DMD using the full breadth of the claimed compounds (i.e., an oligomeric compound comprising from 10-50 nucleosides wherein the oligomeric compound has a sequence having at least 70% identity to SEQ ID NO 3) is unpredictable. The art teaches ASOs must be specific to a sequence. The Spec. does not provide guidance on overcoming any of these issues. Therefore an artisan of ordinary skill would have to determine that successfully using the full scope of the claims is unpredictable.
The quantity of experimentation needed to make or use the invention: The standard of an enabling disclosure is not the ability to make and test if the invention works but one of the ability to make and use with a reasonable expectation of success. A patent is granted for a completed invention, not the general suggestion of an idea (MPEP 2164.03 and Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1325-26 (Fed. Cir. 2004). The instant specification is not enabling because one cannot follow the guidance presented therein or within the art at the time of filing, and practice the claimed method without first making a substantial inventive contribution. Given teachings in the art and what is disclosed in the Spec., an artisan of ordinary skill would not be able to use the invention as claimed with a reasonable expectation of success. The amount of experimentation required for enabling guidance commensurate in scope with what is claimed goes beyond what is considered “routine” within the art and constitutes undue further experimentation in order to successfully use the method of treating any DMD using any of the compounds encompassed by Claim 1 with any reasonable expectation of success. Claim 18 is rejected for those reasons.
In conclusion, the specification provides enablement for:
A method of treating Duchenne Muscular Dystrophy (DMD) in a subject in need thereof by administering to the subject a therapeutically effective amount of a composition comprising the oligomeric compound according to any one of SEQ ID NOs 4-7, wherein the subject’s DMD is caused by a mutation that can be remediated by exon 51 skipping.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 8-10, 12, and 19 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This rejection is new in response to the claim amendments.
Claim 8 recites the limitation "the oligomeric compound according to claim 7, wherein the modified RNA nucleoside is…" in L1-2. There is insufficient antecedent basis for these limitations in the claim because there is no Claim 7 and because the preceding claims don’t recite any modified RNA nucleoside. Claim 1 recites one or more 2’ modified RNA nucleosides.
In the interest of compact prosecution, Claim 8 is interpreted to depend from Claim 1.
Claim 9 recites the limitation "the oligomeric compound according to claim 7, wherein the monomer subunits of said oligomeric compound are joined by PO inter-nt linkages" in L1-2. There is insufficient antecedent basis for these limitations in the claim because there is no Claim 7 and because the preceding claims don’t recite any monomer subunits. Claim 1 recites an oligomeric compound comprising 10-50 nucleosides… wherein… the nucleosides of the oligomeric compound are joined by PO inter-nt linkages.
In the interest of compact prosecution, Claim 9 is interpreted to depend from Claim 1 and the monomer subunits of Claim 9 are interpreted to be the nucleosides of Claim 1. Since Claim 9 doesn’t further limit Claim 1 (which already recites that the nucleosides… are joined by PO linkages), Claim 9 is subject to a 112(d) rejection.
Claim 10 recites the limitation "the oligomeric compound according to claim 7 " in L1. There is insufficient antecedent basis for these limitations in the claim because there is no Claim 7.
In the interest of compact prosecution, Claim 10 is interpreted to depend from Claim 1.
Claim 12 recites the limitation "the conjugated compound according to claim 11… the modified RNA nucleoside is…" in the last two lines. There is insufficient antecedent basis for the limitation the modified RNA nucleoside in the claim because Claim 12 depends from Claims 11 and 1 which recites no modified RNA nucleoside. Claim 1 recites one or more 2’ modified RNA nucleosides.
Similarly, Claim 19 recites the limitation "an oligomeric compound… the modified RNA nucleoside is…" in the third- and second-to-last lines. There is insufficient antecedent basis for the limitation the modified RNA nucleoside in the claim because Claim 19 recites no modified RNA nucleoside.
While Claims 12 and 19 previously recited SEQ ID NOs, therefore referring to a SEQ Listing which describes that the lowercase letter is a 2’-OMe RNA nucleoside, the amended claims have removed those SEQ ID NOs from the claims. Whereas an artisan reading the previous Claim 12 would have understood that the modified RNA nucleoside in Claim 12 was the 2’-OMe nucleoside recited in Claim 1 and shown in the SEQ Listing, the amended claim has no SEQ ID NOs and therefore lacks proper antecedent basis for Claim 12’s recitation the modified RNA nucleoside. The same is true for Claim 19: an artisan reading the previous Claim 19 would have understood that the modified RNA nucleoside in Claim 19 referred to the 2’-OMe nucleoside shown in the SEQ Listing, but the amended claim has no SEQ ID NOs and therefore lacks proper antecedent basis for Claim 19’s recitation the modified RNA nucleoside.
Claims 12 and 19 are rejected for those reasons. In the interest of compact prosecution, the claims are interpreted as if they recite the SEQ ID NOs and sequences, including their modifications, shown in the SEQ Listing. Amending the claims as described in §Claim Objections, as appropriate, will obviate this rejection.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 9 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. This rejection is new in response to the claim amendments.
As discussed above in §112b, Claim 9 has been interpreted to depend from Claim 1. Claim 9 fails to further limit the subject matter of Claim 1 because Claim 1 already recites an oligomeric compound comprising 10-50 nucleosides … wherein … the nucleosides of the oligomeric compound are joined by PO inter-nt linkages. As discussed above, Claim 9 recites the monomer subunits (i.e., “nucleosides”) are joined by PO linkages. Since Claim 1 already recites joining by PO linkages, Claim 9 does not further limit Claim 1.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1-2, 5-6, 8-9, 11, 13, 16-18, and 21-22 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by International Publication Number WO 2019/241385 (published 19 December 2019, “WO385”, of record on IDS) as evidenced by SciFinder (2026. CAS registry No: 137-66-6. Accessed on 16 June 2026, “SciFinder”). This rejection is maintained and updated in response to the claim amendments.
References to p. # in WO documents refer to PDF p. #.
WO385 is drawn to exon 51 skipping ASOs that are used to treat muscular dystrophy.
WO385 teaches (p. 2 L14-20) ASO or pharmaceutically acceptable salts thereof, for inducing skipping of exon 51 in the human dystrophin gene, and pharmaceutical compositions thereof. WO385 teaches (same §) methods for treating a subject with the ASO.
WO385 teaches (p. 5, p. 177) numerous ASO sequences for inducing exon 51 skipping. WO385 teaches SEQ ID NO 6 (“AON 6”) and SEQ ID NO 90 (“AON 90”) and provides data (p. 183) that AON 6 induces exon 51 skipping.
Regarding the claimed sequences: WO385’s SEQ ID NO 6 is a 26-mer and WO385’s SEQ ID NO 90 is a 25-mer; each sequence comprises a 15-mer nt sequence having 100% identity (which encompasses at least 70% identity) to claimed SEQ ID NOs 3-7, as shown by the following alignments:
RESULT 1
NASEQ2_01302026_142740
Query Match 100.0%; Score 15; DB 1; Length 26;
Best Local Similarity 100.0%;
Matches 15; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGAGATGGCAGTTTC 15 SEQ ID NO 3
|||||||||||||||
Db 12 GGAGATGGCAGTTTC 26 WO385 SEQ ID NO 6
NASEQ2_01302026_154233
Query Match 100.0%; Score 15; DB 1; Length 25;
Best Local Similarity 100.0%;
Matches 15; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGAGATGGCAGTTTC 15 SEQ ID NO 3
|||||||||||||||
Db 4 GGAGATGGCAGTTTC 18 WO385 SEQ ID NO 90
Those WO385 sequences also share 100% complementarity (which encompasses at least 70% complementarity) with positions 48-62 of SEQ ID NO 2; only WO385 SEQ ID NO 6 is shown as an example:
US-18-030-265A-2/c
Query Match 100.0%; Score 26; DB 1; Length 233;
Best Local Similarity 100.0%;
Matches 26; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATTTCTAGTTTGGAGATGGCAGTTTC 26 WO385 SEQ ID NO 6
||||||||||||||||||||||||||
Db 73 ATTTCTAGTTTGGAGATGGCAGTTTC 48 positions 48-73 of SEQ ID NO 2
Therefore WO385 anticipates the sequences recited in Claims 1-2.
Regarding Claims 1-2, 5-6, and 9: WO385 teaches (p. 75 L1) typical intersubunit linkers include phosphodiester [PO] and phosphorothioate [PS] moieties. WO385 also teaches (starts at p. 76 L18) using tc-DNA and tc-DNA linked by PS linkages in their ASO, including that (p. 77 L1-10) the ASOs can comprise one or more tc-DNA subunits or may be entirely comprised of tc-DNA subunits. That indicates that WO385 envisioned ASOs wherein nucleotides are linked by PO or PS linkages, and ASOs comprising tc-DNA nucleosides, including wherein tc-DNA nucleosides are linked by PS linkages.
Regarding Claims 1-2 and 8, WO385 teaches (p. 71 L18-29; p. 81 L8-10) their ASOs can comprise various kinds of ASO chemistries including, without limitation and in various combinations, ASOs comprising (among others) one or more tc-DNA and 2’OMe subunits. That indicates that WO385 envisioned ASOs comprising 2’-OMe RNA nucleosides.
Therefore WO385 anticipates Claims 1-2, 5-6, and 8-9.
Regarding Claims 11, 13, 16-17, and 21-22: WO385 teaches (pp. 119-121 L11-16) pharmaceutical compositions comprising the ASO and a pharmaceutically acceptable carrier (“pharmaceutically acceptable carrier” is simply a different term for “pharmaceutically acceptable vehicle”). WO385 teaches (same §) formulating the ASO for delivery by conjugating it to various lipid moieties including PEG or a phospholipid. WO385 teaches (p. 122 L3-4) including the oil soluble antioxidant ascorbyl palmitate or (p. 139 L25-31) the fatty acid palmitic acid.
Evidence from SciFinder shows (see §31 Other Names for this Substance) ascorbyl palmitate is also called 6-O-Palmitoyl-L-ascorbic acid (among other names). Therefore an artisan would recognize that ascorbyl palmitate is a species within the claimed genus of a palmitoyl moiety.
Therefore WO385 anticipates Claims 11, 13, 16-17, and 21-22.
Regarding Claim 18, WO385 teaches (pp. 42-44 L2-2; pp. 70-72 L 1-17; p. 148 L16-25) methods of treating DMD in a subject by administering the ASOs, including SEQ ID NO 90. As discussed above, WO385 teaches(§Abstract) exon 51 skipping ASOs for treating muscular dystrophy. Therefore WO385 anticipates Claim 18.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-2, 5-6, 8-13 and 16-22 are rejected under 35 U.S.C. 103 as being unpatentable over International Publication Number WO 2019/241385 (published 19 December 2019, “WO385”, of record on IDS) as applied to Claims 1-2, 5-6, 8-9, 11, 13, 16-18, and 21-22 in the 102 rejection above, and further in view of International Publication Number WO 2018/193428 (published 25 October 2018, “WO428”, of record on IDS), Aartsma-Rus (and van Ommen. 2007. Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications. RNA 13[10]:1609–1624, “Aartsma”, of record), and Prakash (et al. 2019. Fatty acid conjugation enhances potency of antisense oligonucleotides in muscle. Nuc. Acid Res. 47[12]:6029-6044, “Prakash”, of record). This rejection is maintained and updated in response to the claim amendments.
The teachings of WO385 as applicable to Claim(s) 1-2, 5-6, 8-9, 11, 13, 16-18, and 21-22 have been described in the 102 rejection above.
WO385 does not teach an ASO comprising any of the modified nt sequences shown in Claims 10, 12, or 19, wherein capital letters designate tc-DNA nts and a lower case letter designates a 2’ modified RNA nucleoside.
However, WO428, drawn to lipid-conjugated tc-DNA sequences comprising 4-40 monomer subunits and methods of using the ASOs to treat DMD, teaches (¶5) exon-skipping therapies to treat DMD by inducing skipping of exon 51. WO428 teaches:
(¶10) compositions comprising an oligomeric compound and one or more lipid moiety covalently linked to said oligomeric compound are much more efficient and active in penetrating skeletal muscles, cardiac tissue and CNS after systemic delivery than their tcDNA counterparts not comprising said one or more lipid moiety.
WO428 teaches (same §) their ASOs have markedly improved safety profiles and lower toxicity while maintaining high efficacy. WO428 teaches (¶114) ASOs comprising 1 or more nt or nucleosides that are nucleosides other than tc-DNA nucleosides, wherein the non–tc-DNA nucleoside(s) is a 2’-modified RNA and can be specifically (¶117) a 2’-OMe modified RNA nucleoside.
Regarding Claim 20: WO428 teaches (¶237) attaching the ASO to a lipid moiety via a linker or spacer and that (§Abstract) the lipid moiety is covalently linked to the ASO.
Regarding Claims 16-17 and 21-22: WO428 teaches the lipid moiety can be (¶12) a fatty acid such as a palmitoyl moiety and (¶442) joining a palmitoyl lipid moiety to the oligomeric compound via an -NH-C6-alkylene-OP(O)(SH)-. WO428 teaches the lipid moiety can be (¶43) a saturated fatty acid, and (¶194-195) the lipid moiety can be derived from palmitic acid.
Regarding the PS linkages of Claims 12 and 19: WO428 teaches (¶138-140, ¶164, ¶237) using PS linkages to attach a lipid moiety (via a linker or spacer) to the ASO.
Regarding the specific ASO modification patterns recited in Claims 10, 12, and 19: WO428 teaches (Table 2, which starts at ¶340) various ASOs comprising modification patterns comprising PO-linked 15-mer ASO wherein all nt are tc-DNA except for the nt at positions 8, 9, or 10, which are 2’-OMe RNA nt (see specifically Table 2 SEQ ID NOs 5-6 and 15). Those ASO comprise the same modification pattern(s) as the claimed sequences. WO428 teaches (¶340) those are very preferred embodiments.
Aartsma, drawn to a review about exon skipping therapies for DMD, teaches (§AON DESIGN AND MODE OF ACTION entire §) general strategies for designing ASO/AON. Aartsma teaches (same §, ¶1) targeting exon-internal sites can be a good way to reduce the risk of mistargeting splice sites of genes other than DMD. Aartsma teaches (same §, ¶4-5) it is common in the art to use various strategies to design exon skipping ASO/AON. Aartsma teaches (same §) one research group tested 470 ASO/AON in this manner. Aartsma’s teachings indicate it is routine and conventional for an artisan to design large numbers—even hundreds—of overlapping ASO/AON for a single target site and screen them to determine which particular ASO/AON work best.
WO385, WO428, and Aartsma do not explicitly teach the exact palmitate conjugate and linker of Claims 10, 12 and 19.
However, Prakash, drawn to conjugates for enhancing functional uptake of ASO in muscle, teaches (§Abstract) applying a palmitic acid conjugate to ASO to improve uptake by muscles. Prakash teaches (same §) their conjugates improve albumin binding which facilitates traversal of ASO to muscle tissues and enhances uptake. Prakash teaches (§Results-Palmitoyl conjugation improves plasma protein binding of cEt BNA ASO) palmitoyl conjugation improves plasma protein binding. Prakash teaches (same §) their approach is widely applicable to ASOs for developing more effective ASOs for muscle disorders.
Prakash demonstrates (Figs. 5-8) conjugation with palmitoyl enhances ASO potency and uptake. Prakash (Figs. 1 and 5) shows the same structures as what comprises the claimed structure palmitate-NH-C6 alkylene, modified excerpts shown here:
PNG
media_image1.png
103
559
media_image1.png
Greyscale
Prakash shows a PO linkage between the linker and the ASO and the instant claims disclose a PS linkage between the linker and the ASO but as discussed above, WO428 teaches (¶95, ¶138-140, ¶237) preferably attaching a lipid moiety to an ASO via a spacer through a PS moiety.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the ASO sequences of WO385 with the teachings and modification patterns of WO428, teachings about testing many different ASO/AON that target the same site of Aartsma, and the palmitic acid conjugate of Prakash for the benefits of producing ASO that are optimized for skipping of exon 51 and for increasing uptake of the ASO by muscle cells. One would have been motivated to do so with a reasonable expectation of success because WO385 teaches their ASO results in skipping of exon 51, because WO428 teaches ASO comprising PO-linked tc-DNA nt, wherein the ASO is conjugated to a lipid moiety improve penetration to skeletal muscles and cardiac tissue while improving safety and lowering toxicity, and because Aartsma teaches it is routine and conventional in the art of exon skipping ASO/AON to test large numbers of overlapping ASO/AON that are directed to the same target. Those teachings indicate it would have been routine and conventional for an artisan to have shortened the sequences of WO385 and applied the modification pattern of WO428.
One would have been motivated to modify the ASOs with the conjugate of Prakash with a reasonable expectation of success because Prakash demonstrates that palmitic acid conjugates improve uptake and potency in muscle cells and provides a mechanism by which that occurs, namely binding to albumin. An artisan wanting to use any ASO to treat DMD would have applied the teachings of Prakash to their ASO because those of ordinary skill in the art understand that DMD is a disease that affects muscles and because Prakash teaches (§Abstract) their approach provides a foundation for developing more effective therapeutic ASOs for muscle disorders. Therefore the limitations of Claims 10, 12, and 19-22 (and Claims 1-2, 5-6, 8-9, 11, 13, and 16-18) would have been obvious in view of WO385, WO428, Aartsma, and Prakash.
Obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). The motivation to combine falls under an “obvious to try” rationale; see MPEP 2143(I)(E):
To reject a claim based on this rationale, Office personnel must resolve the Graham factual inquiries. Then, Office personnel must articulate the following:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem;
(2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem;
(3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success; and
(4) whatever additional findings based on the Graham factual inquiries may be necessary, in view of the facts of the case under consideration, to explain a conclusion of obviousness.
The rationale to support a conclusion that the claim would have been obvious is that "a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely that product [was] not of innovation but of ordinary skill and common sense.
Regarding (1): WO385, WO428, and Aartsma teach there was a design need for ASOs to induce skipping of exon 51, and that it was routine and conventional to produce numerous ASOs that target a specific region to determine which ones work best.
Regarding (2): the references teach only a finite, though large, number of ASO sequences and modification patterns. Specifically, WO385 teaches SEQ ID NOs 6 and 90, shows their SEQ ID NO 6 works to induce exon skipping, and teaches that their SEQ ID NO 90 can be used in their methods. WO428 teaches very preferred modification patterns and benefits of those modification patterns.
Regarding (3): the teachings of the references indicate one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success because testing combinations of ASO sequences and modification patters was routine and conventional, because WO428 teaches benefits of their specific (and very preferred) modification patterns, and because Prakash teaches benefits of using their lipid conjugate for muscle-targeting ASOs.
Therefore all of the instant claims are deemed obvious in view of the prior art.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-2, 5-6, 8-13 and 16-22 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 4-10, and 15 of U.S. Patent No. 10,465,191 (“US191”) in view of International Publication Number WO 2019/241385 (published 19 December 2019, “WO385”), International Publication Number WO 2018/193428 (published 25 October 2018, “WO428”), Aartsma-Rus (and van Ommen. 2007. Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications. RNA 13[10]:1609–1624, “Aartsma”), and Prakash (et al. 2019. Fatty acid conjugation enhances potency of antisense oligonucleotides in muscle. Nuc. Acid Res. 47[12]:6029-6044, “Prakash”). All references of record. This rejection is maintained and updated in response to the claim amendments.
Although the claims at issue are not identical they are drawn to overlapping subject matter because the patented US191 claims are drawn to methods for delivering to a human patient tc-DNA AON that induce exon skipping, including skipping of exon 51, wherein the AON can be 10-18-mer or 15-mer, and wherein the patient can have DMD. The US191 claims broadly encompass delivering tc-DNA AON.
The instant claims are directed to ASOs that are 10-50-mer and comprise complementarity to SEQ ID NO 1 or 2, or comprise identity to SEQ ID NO 3 or the nt sequence of SEQ ID NO 3, can have a tc-DNA, or can have tc-DNA and 2’-OMe and other modifications, including a lipid conjugate that is palmitate, and to methods of using the ASO to treat DMD.
The US191 claims don’t recite the exact sequences of the instant claims, or various modifications, or the palmitate, but those limitations and benefits of using them in ASO are taught by WO385 (§Abstract, p. 2 L14-20; p. 5, p. 177; p. 183; starts at p. 76 L18; p. 77 L1-10; p. 81 L8-10; p. 71 L18-29; pp. 119-121 L11-16; p. 122 L3-4; p. 139 L25-31; pp. 42-44 L2-2; pp. 70-72 L 1-17; p. 148 L16-25), WO428 (§Abstract, ¶5, ¶10, ¶12, ¶43, ¶114, ¶117, ¶237, ¶194-195, ¶138-140, ¶164, ¶237, Table 2 which starts at ¶340, see specifically Table 2 SEQ ID NOs 5-6 and 15, ¶340, ¶442), and Prakash (§Abstract and Figs. 1 and 5-8). In addition, Aartsma teaches (§AON DESIGN AND MODE OF ACTION entire §) it is routine and conventional in the art of exon skipping ASO to produce and screen numerous overlapping AON comprising sequences designed for any one target, and then further optimize the most effective ASO.
It would have therefore been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the invention of the US191 claims with the teachings of WO385, WO428, and Prakash and the teachings of Aartsma for the benefits of optimizing ASO for treating DMD. Therefore the instant claims would have been obvious in view of the US191 claims and WO385, WO428, Prakash, and Aartsma.
Claim 1-2, 5-6, 8-13 and 16-22 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 4-10, and 15 of U.S. Patent No. 10,471,089 (“US089”) in view of WO385, WO428, Aartsma, and Prakash. All references of record. This rejection is maintained and updated in response to the claim amendments.
Although the claims at issue are not identical they are drawn to overlapping subject matter because the patented US089 claims are drawn to a combination therapy comprising administering to a human patient a 10-40-mer ASO that induces exon skipping in a dystrophin pre-mRNA, and other components. The US089 claims broadly encompass delivering treating DMD with ASO/AON that induce exon skipping.
The instant claims are directed to ASOs that are 10-50-mer and comprise complementarity to SEQ ID NO 1 or 2, or comprise identity to SEQ ID NO 3 or the nt sequence of SEQ ID NO 3, can have a tc-DNA, or can have tc-DNA and 2’-OMe and other modifications, including a lipid conjugate that is palmitate, and to methods of using the ASO to treat DMD.
The US089 claims don’t recite the exact sequences of the instant claims, or various modifications, or the palmitate, but those limitations and benefits of using them in ASO are taught by WO385 (§Abstract, p. 2 L14-20; p. 5, p. 177; p. 183; starts at p. 76 L18; p. 77 L1-10; p. 71 L18-29; p. 81 L8-10; pp. 119-121 L11-16; p. 122 L3-4; p. 139 L25-31; pp. 42-44 L2-2; pp. 70-72 L 1-17; p. 148 L16-25), WO428 (§Abstract, ¶5, ¶10, ¶12, ¶43, ¶114, ¶117, ¶237, ¶194-195, ¶138-140, ¶164, ¶237, Table 2 which starts at ¶340, see specifically Table 2 SEQ ID NOs 5-6 and 15, ¶340, ¶442), and Prakash (§Abstract and Figs. 1 and 5-8). In addition, Aartsma teaches (§AON DESIGN AND MODE OF ACTION entire §) it is routine and conventional in the art of exon skipping ASO to produce and screen numerous overlapping AON comprising sequences designed for any one target, and then further optimize the most effective ASO.
It would have therefore been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the invention of the US089 claims with the teachings of WO385, WO428, and Prakash and the teachings of Aartsma for the benefits of optimizing ASO for treating DMD. Therefore the instant claims would have been obvious in view of the US089 claims and WO385, WO428, Prakash, and Aartsma.
Response to Arguments
Applicant's arguments filed 05 May 2026 have been fully considered but they are not persuasive. Arguments are addressed below. Arguments that are no longer relevant are not addressed.
Claim Objections
The claims are objected to for minor informalities. Suggestions are made to fix grammatical errors, make the claims more consistent, or improve the claims.
112a Written Description Rejections
Applicant argues that the genus of amended claim 1 does not encompass any oligomeric compound but a scope of oligomeric compounds with clear structural limitations.
That is not found persuasive because, as discussed in the rejection, Claim 1 recites:
an oligomeric compound comprising 10 to 50 nucleosides comprising:
one or more tc-DNA nucleosides; and
one or more 2’ modified RNA nucleosides;
wherein the oligomeric compound has a sequence having at least 70% identity with SEQ ID NO 3, and the nucleosides of the oligomeric compound are joined by PO inter-nt linkages.
The rejection explains that Claim 1 encompasses a large genus of compounds comprising a sequence that has any sequence of at least 2 or more nt that have at least 70% identity with SEQ ID NO 3. As discussed in §Claim interpretation, the recitation of Claim 1 a sequence having at least 70% identity with SEQ ID NO 3… is broadly interpreted as requiring at least two consecutive nucleotides (i.e., “a sequence”) that have the recited identity to SEQ ID NO 3. That sequence having at least 70% identity with SEQ ID NO 3 could be a sequence of 2 nt that have 100% identity with SEQ ID NO 3 or a sequence of 5 nt that have at least 80% identity with SEQ ID NO 3. The rejection explains that the claims encompass a huge number of nucleotide sequences that have at least 2 consecutive nt with 100% identity with any 2 consecutive nt in SEQ ID NO 3. Any 10-50-mer nucleotide sequence comprising a 2-mer that is 100% identical to SEQ ID NO 3—any 10-50-mer nt sequence comprising GG, GA, AG, AT, TG, GC, CA, GT, TT, and/or TC—would be encompassed by the claims as instantly presented.
The rejection explains that the Spec. does not provide information describing the features of a structure that is encompassed by the oligomeric compounds having a sequence having at least 70% identity with SEQ ID NO 3. The Spec. does not disclose any physical structure—any minimal physical structure that has at least 70% identity with SEQ ID NO 3—that is required for the invention or that is necessary for the implied function of treating DMD or even just causing exon skipping in vitro.
The Written Description (WD) rejection is maintained for those reasons.
112a Scope of Enablement (SoE) Rejections
Applicant argues that the full scope of amended claims 18-19 is now enabled. That is found persuasive for Claim 19 but not for Claim 18. Claim 18 still encompasses a huge number of oligomeric compounds and a representative number of them haven’t been shown to cause exon 51 skipping. The WD and SoE rejections explain that Claim 1 encompasses a huge number of oligomeric compounds. The SoE rejection explains that an artisan would determine that, without presentation of evidence to the contrary, it is not possible to treat DMD using any ASO comprised by the genus and sub-genera encompassed by the claims because the claims encompass a huge number of compounds and the art teaches ASO must have sequence specificity to a target in order to hybridize. The SoE rejection of Claim 18 is maintained for those reasons.
112b Rejections
Claims 8-10 have antecedent basis problems as explained in the rejection.
Claims 12 and 19 also have antecedent basis problems. While the claims previously recited SEQ ID NOs which describe that the lowercase letter is a 2’-OMe RNA nucleoside, the amended claims have removed those SEQ ID NOs from the claims. Whereas an artisan would have previously understood that the modified RNA nucleoside in Claim 12 was the 2’-OMe nucleoside recited in Claim 1 and shown in the SEQ Listing, the amended claim lacks proper antecedent basis for Claim 12’s recitation the modified RNA nucleoside. The same is true for Claim 19: an artisan would have previously understood that the modified RNA nucleoside in Claim 19 referred to the 2’-OMe nucleoside shown in the SEQ Listing, the amended claim lacks proper antecedent basis for Claim 19’s recitation the modified RNA nucleoside.
112d Rejections
Claim 9 recites the monomer subunits (i.e., “nucleosides”) are joined by PO linkages but since Claim 1 already recites joining by PO linkages, Claim 9 does not further limit Claim 1.
102 Rejections
Applicant argues that WO385 doesn’t disclose an oligomeric compound with all the limitations of amended Claim 1.
That is not found persuasive because the rejection explains that WO385 teaches sequences comprising at least 70% identity to claimed SEQ ID NO 3 and at least 70% complementarity to claimed SEQ ID NO 2. The rejection explains that WO385 teaches modified ASOs comprising one or more tc-DNA nt, one or more 2’-OMe modified RNA nt, tc-PS-DNA nt, and that PO moieties typically subunits in an antisense oligo. WO385 shows (p. 78 L3-5) nucleic acid monomers connected by PO bonds. WO385 teaches (p. 72 L19-30) their ASO can comprise any of those modifications in any combination(s).
Note that evidence has been added to show that the ascorbyl palmitate taught in WO385 is a kind of palmitoyl moiety (which is a limitation of new Claim 22).
Since WO385’s SEQ ID NOs 6 and 90 each comprise a 15-mer nt sequence having 100% identity (which encompasses at least 70% identity) to claimed SEQ ID NOs 3-7, and since WO385 teaches all the modifications recited in Claim 1 (as well as all the other elements of the claims rejected under 102), WO385 anticipates Claim 1.
103 Rejections
Applicant argues that WO385 doesn’t disclose an oligomeric compound with all the limitations of amended Claim 1. That is found unpersuasive for reasons discussed in the preceding §.
Applicant also argues that:
the oligomeric compounds according to amended claim 1 differ from the sequences disclosed in the '385 publication by the presence of one or more tc-DNA nucleotides and one or more 2' modified ribonucleic acid nucleosides in a sequence having at least 70% identity with SEQ ID NO: 3. Neither the '428 publication, Aartsma, nor Prakash remedy this deficiency.
That is not found persuasive because WO385 teaches a sequence (i.e., WO385’s SEQ ID NOs 6 and 90) that (as recited in Claim 1) has a sequence having at least 70% identity with SEQ ID NO 3. Alignments are shown in the 102 rejection above. Additionally, WO385 teaches all the modifications recited in Claim 1 and the other claims rejected under 102.
Furthermore, in contrast to Applicant’s assertion that none of the '428 publication, Aartsma, nor Prakash remedy the deficiency of failing to teach the presence of one or more tc-DNA nucleotides and one or more 2' modified ribonucleic acid nucleosides, WO428 clearly teaches (see Table 2) modification patterns wherein a 15-mer ASO has all PO linkages and tc-DNA nt except for a 2’-OMe RNA at position 8, 9, or 10. Therefore the limitations of Claim 1 would have been obvious in view of WO385 and WO428. The requirement of an obviousness rejection is not that all claim elements must be disclosed in a reference, but that the combination would have been obvious in view of the prior art.
Regarding Applicant’s arguments that (p. 10, first full ¶) the compounds in amended claim 1 possess a technical effect of reduced dimerization, those arguments aren’t found persuasive for at least the following reasons:
The claims are compound claims and the prior art teaches incorporating tc-DNA nt into ASOs. Any ASO comprising a tc-DNA would possess the same technical benefit of reduced dimerization because the structure of a tc-DNA is what imparts the reduced dimerization. That is, any ASO comprising tc-DNA nt would inherently possess the benefit of reduced homodimerization.
WO385 teaches (p. 76 L18-25) tc-DNA are a class of constrained DNA analogs in which each nucleotide is modified by the introduction of a cyclopropane ring to restrict conformational flexibility of the backbone and to optimize the backbone geometry of the torsion angle γ. A person of ordinary skill would have understood that a constrained nt is, by definition, less flexible than an unconstrained nt and is therefore less likely to form a homodimer with another tc-DNA nt. Two constrained oligo-nt would be less likely to homodimerize because, being constrained and less flexible, they would be less likely to contact each other in ways that would result in dimerization.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., reduced homodimerization) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
The 103 rejections are maintained for those reasons.
NSDP Rejections
Applicant’s arguments against the NSDP rejections are not persuasive for the same reasons the arguments against the 102 and 103 rejections are not persuasive, and the NSDP rejections are maintained.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636
Prosecution Insights