Prosecution Insights
Last updated: April 19, 2026
Application No. 18/030,265

OLIGOMERIC COMPOUND FOR DYSTROPHIN RESCUE IN DMD PATIENTS THROUGHOUT SKIPPING OF EXON-51

Non-Final OA §102§103§112§DP
Filed
Apr 04, 2023
Examiner
ARIETI, RUTH SOPHIA
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
INSERM
OA Round
1 (Non-Final)
46%
Grant Probability
Moderate
1-2
OA Rounds
2y 7m
To Grant
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allow Rate
37 granted / 81 resolved
-14.3% vs TC avg
Strong +73% interview lift
Without
With
+72.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
37 currently pending
Career history
118
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
12.3%
-27.7% vs TC avg
§112
29.2%
-10.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 81 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 1-13 and 16-19 are pending. Priority Acknowledgment is made of applicant's claim for foreign priority based on an application filed in EPO on 10/05/2020. A certified copy of the EPO 20200140.0 application is in the application file. Note that the pages in the certified copy are in reverse order. Specification The disclosure is objected to because of the following informalities: On p. 90 L 8 the Spec says: Advantageously, SQY51 does not activate complement in human serum… . This is understood to mean SQY51 does not activate the complement system of the immune system. If this understanding is incorrect, please state that (and the correct interpretation) on the record. On p. 91 L25 a word is missing. The Spec. says: Note that M23D is a full tc-DNA oligomer, while SYN51 and SQY51 both comprise a within the tc-DNA chain. The Spec. does not say what is comprised within the tc-DNA chain: comprise a ______ within the tc-DNA chain. The context indicates that SYN51 and SQY51 each comprise a 2’-OMe. Appropriate correction is required. Information Disclosure Statement The IDS has been considered. The Spec. cites references. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Claim Interpretation The claims recite an oligomeric compound comprising from 10-50 monomer subunits. In the interest of compact prosecution the oligomeric compound is interpreted as an oligomeric nucleic acid compound and each monomer subunit is interpreted as a nucleotide. Claims 1-2 and claims depending therefrom recite …at least part of the sequence of the oligomeric compound is complementary…. In the interest of compact prosecution, at least part is broadly interpreted as requiring at least one single nucleotide is complementary.... Claim 2 recites … the sequence corresponding to the region +48+62 of SEQ ID NO 2. In the art, the terminology +48+62 is used to refer to the position of nucleotides (nt) in relation to a splice site within an exon. The language used in relation to a sequence itself is confusing. In the interest of compact prosecution, the region +48+62 of SEQ ID NO 2 is interpreted as the nucleotides at positions 48-62 of SEQ ID NO 2. Claim 10 recites …the oligomeric compound comprises a nucleotide sequence selected from: …SEQ ID NO 4… SEQ ID NO 5…SEQ ID NO 6 and …SEQ ID NO 7. In the interest of compact prosecution, a nucleotide sequence selected from… is interpreted as requiring the entirety of any one of SEQ ID NOs 4-7 including the modification pattern and conjugate/linker. Claim Objections Claims 2, 4, 9-10, 12, and 19 are objected to because of the following informalities: Claim 2 recites …is complementary to the sequence corresponding to the region +48+62 of SEQ ID NO 2 but the claim will be better if it recites …is complementary to the sequence comprising the region +48+62 of SEQ ID NO 2 Claim 3 recites the limitation the oligomeric compound according to Claim 1 wherein the oligomeric compound comprises an antisense oligont. Claim 1 can be interpreted as reciting/encompassing an antisense oligont (ASO). The recitation in Claim 3 wherein the oligomeric [nucleic acid] compound comprises an antisense oligonucleotide [ASO] can be broadly interpreted as further comprising an additional antisense oligonucleotide (i.e., in addition to the at least part of the nucleotide sequence of the oligomeric nucleic acid compound that is complementary to SEQ ID NO 1) or as meaning that the oligomeric nucleic acid compound that is complementary to SEQ ID NO 1 is the ASO. Note that because under one of these interpretations, Claim 1 can be interpreted as already reciting/encompassing an ASO and Claim 3 can be interpreted as merely reciting an intended use. Under that interpretation, Claim 3 doesn’t further limit Claim 1, so it will be rejected under 112(d). In the interest of compact prosecution, Claim 3 is interpreted as reciting that the oligomeric nucleic acid compound is an ASO. The claims are interpreted that way because nothing in the Spec. envisions any second ASO or ASO in addition to the oligomeric compound of Claim 1. Claims 4, 12, and 19 recite tc-DNA but have not disclosed what it means. For consistency with Claims 5-7 and clarity the claims should spell out tc-DNA on first use. (Claim 10 is not included in this objection because it depends from Claim 7 which spells out tc-DNA.) Note also that currently, there is no hyphen between tc and DNA in Claims 12 and 19. For consistency, the claims should abbreviate tc-DNA the same in all claims. In the interest of compact prosecution tc-DNA/tcDNA in those claims is interpreted as tricyclo-DNA. The claims are interpreted that way because the Spec. discloses (p. 1 L17-20) tc-DNA is tricyclo-deoxyribonucleic acid (i.e., tc-DNA). Claim 10 should include a hyphen in between tc and DNA so the claim is consistent with Claim 7 where tricyclo-DNA is abbreviated tc-DNA. Claim 17 recites: the oligomeric compound according to claim 8, wherein the one or more lipid moiety… but should recite the oligomeric compound according to claim 8, wherein the one or more lipid moieties…. By pluralizing “moieties” the claim will be consistent with Claims 11 and 16. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-11, 13, and 16-18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection. Claim 1 recites an oligomeric compound comprising from 10 to 50 monomer subunits wherein at least part of the sequence of the oligomeric compound is complementary to the sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1). Claim 2 recites the oligomeric compound according to Claim 1, wherein at least part of the sequence of the oligomeric compound is complementary to the sequence corresponding to the region +48+62 of SEQ ID NO 2. Claim 10 recites oligomeric compounds wherein the compound comprises any of SEQ ID NOs 4-7. Broad Claims 1-2 encompass the large genus of compounds comprising a sequence that has at least 1 nt complementary to the SEQ ID NO 1 or at least 1 nt complementary to positions 48-62 in SEQ ID NO 2. As discussed in §Claim interpretation, at least part of the sequence is interpreted as even a single nucleotide (nt). The claims recite that the oligomeric compound comprises 10-50 monomer subunits but comprises is open language that allows for additional components. Since SEQ ID NO 1 and positions 48-62 in SEQ ID NO 2 comprise each nucleobase A, T, C, and G, and the claims recite the open language, the claims encompass any nucleotide sequence in existence. Any kind of nucleotide sequence would be encompassed by the claims as instantly presented. Broad Claim 10 encompasses the large genus of compounds comprising a sequence that is any of SEQ ID NOs 4-7. Since the claims recite the open language of comprises, the claims encompass sequences that comprise any of SEQ ID NOs 4-7 which includes sequences longer than those SEQ ID NOs. Claim 3 recites the oligomeric compound comprises an ASO. As discussed in §Objections/§112(b) that claim can be interpreted in various ways including that the oligomeric compound comprises an additional ASO. Therefore the broad claim encompasses the large genus of oligomeric compounds comprising, in addition to the limitations of Claim 1, any additional ASO. Any ASO would be encompassed by the claims as instantly presented. Claim 4 recites the oligomeric compound according to Claim 1, wherein the oligomeric compound comprises at least one nucleotide sequence having at least 70% identity with the following tc-DNA nucleotide sequence: GGAGATGGCAGTTTC (SEQ ID NO: 3). That broad claim encompasses the large genus of oligomeric compounds comprising at least one nucleotide sequence and having at least 70% identity with SEQ ID NO 3. That means as many as 4 nt could be missing or different from SEQ ID NO 3, so every 4th nt could be altered or missing or different. Any nucleic acid sequence that has at least 70% identity with SEQ ID NO 3 would be encompassed by the claims as instantly presented. Furthermore, Claim 18 explicitly recites a use (namely treating DMD) for all the compounds encompassed by Claim 1. The compounds of Claims 2-4 have an implied use: treating DMD. Applicant hasn’t demonstrated that all the compounds encompassed by their claims would be useful for treating DMD. All the claims recite an oligomeric compound comprising from 10-50 monomer subunits. As discussed in §112b, there are many kinds of oligomeric compound comprised of different kinds of monomers. As discussed in §Claim interpretation, that is interpreted as an oligomeric nucleic acid compound comprised of monomer subunits that are nucleotides. However, as written, the broad claim reciting an oligomeric compound comprising from 10-50 monomer subunits encompasses the large genus of various kinds of oligomeric compound and various kinds of monomer subunits. An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163. The Spec. describes nucleic acid sequences (pp. 2-3) useful in their invention. The Spec. doesn’t describe using sequences wherein only part of the sequence is complementary to SEQ ID NO 1 or only part of the sequence is complementary to positions 48-62 in SEQ ID NO 2 or wherein the nt sequence has only 70% identity to SEQ ID NO 3. Regarding what structure is encompassed by the sequences wherein at least part of the sequence is complementary to SEQ ID NO 1 or is complementary to positions 48-62 in SEQ ID NO 2 or wherein the nt sequence has at least 70% identity to SEQ ID NO 3, the Spec. does not provide information describing its features. The Spec. does not disclose any physical structure—any minimal physical structure that is at least partly complementary to SEQ ID NO 1 or to positions 48-62 in SEQ ID NO 2 or wherein the nt sequence has at least 70% identity to SEQ ID NO 3—that is required for the invention or that is necessary for the implied function of treating DMD or even just causing exon skipping in vitro. Applicant’s examples show the following: Examples 1 and 2 discuss devising the claimed compound SQY51 and evaluating toxicity in vitro. Example 3/Fig. 6 shows SQY51 binds to albumin in human and macaque serum. Example 4 shows (Fig. 7) plasma concentration and half-life of SQY51, SQY51 without PS linkages results in (Fig. 8) less complement activation and (Fig. 9) less coagulation misfunctioning, and results in (Fig. 10) less complement activation than SYN51. Fig. 11 shows SQY51 administered to monkeys distributes to organs. Table 2 shows SQY51 administered to cynomolgus monkeys causes more exon-51 skipping in muscles (vs. SYN51) after a 4 week treatment. Example 5 shows (Fig. 12) SQY51 results in exon-51 sipping in monkey tissues after systematic administration. Fig. 13 shows SQY51 shows improved biodistribution in monkey muscles after systemic delivery. The Spec. also asserts subsequent exon-51 skipping levels in striated muscles were 10 times higher but provides no data showing that. All the examples used SQY51 which is a specific sequence with specific modifications, namely SEQ ID NO 5. None of the examples uses any compound representing the full breadth of what is claimed (i.e., an oligomeric compound comprising from 10-50 monomer subunits wherein at least part of the sequence of the oligomeric compound is complementary to SEQ ID NO 1 or at least part of the sequence is complementary to certain positions in SEQ ID NO 2 or which has at least 70% identity to SEQ ID NO 3). None of those examples uses any oligomeric compound besides a nucleic acid sequence. Those examples demonstrate possession of only the oligomeric compounds recited in Claims 12 and 19. However, those examples are not sufficient to provide written description support for oligomeric compounds comprising sequences wherein at least part of the sequence is complementary to SEQ ID NO 1 or at least part of the sequence is complementary to positions 48-62 in SEQ ID NO 2 or wherein the nt sequence has at least 70% identity to SEQ ID NO 3, which are the broad genera claimed. Although the claims recite (Claim 18) or imply (Claims 1-11, 13, and 16-17) certain functional characteristics (i.e., treating DMD by causing exon 51 skipping), the functional characteristic is not coupled with any known structure. Although the Specification teaches the examples discussed above, it does not identify a core structure required for the claimed oligomeric compounds (Claims 1-11, 13, and 16-17) or necessary for performing the explicitly recited (Claim 18) or implied (Claims 1-11, 13, and 16-17) function(s) of treating DMD by causing exon 51 skipping. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for treating DMD by causing exon 51 skipping in such a way to demonstrate possession of the full invention as claimed at time of filing. The claimed sequences wherein at least part of the sequence is complementary to SEQ ID NO 1 or to positions 48-62 in SEQ ID NO 2 or wherein the nt sequence has at least 70% identity to SEQ ID NO 3 do not share a core structure. The specification teaches only these species within the claimed genus/genera, namely SEQ ID NOs 3-7, but those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims: any kind of oligomeric compound comprising 10-50 monomers and a sequence wherein at least part of the sequence is complementary to SEQ ID NO 1 or is complementary to positions 48-62 in SEQ ID NO 2 or wherein the nt sequence has at least 70% identity to SEQ ID NO 3. While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 1-11, 13, 16-18 are rejected for failing to demonstrate possession of the claimed invention. Claims 2-11, 13, and 16-18 are rejected because they depend from Claim(s) 1, 7, and/or 8 and do not remedy the issues. Claims 18-19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for: A method of treating Duchenne Muscular Dystrophy (DMD) in a subject in need thereof by administering to the subject a therapeutically effective amount of a composition comprising the oligomeric compound according to any one of SEQ ID NOs 4-7, wherein the subject’s DMD is caused by a mutation that can be remediated by exon 51 skipping, and A method of treating Duchenne Muscular Dystrophy (DMD) in a subject in need thereof by administering to the subject a therapeutically effective amount of a composition comprising the oligomeric compound selected from: palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4), palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5), palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6), and palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7) in which tc-DNA nucleotides are typed in capital letters while the modified ribonucleic acid nucleoside is typed in lowercase letter, wherein the subject’s DMD is caused by a mutation that can be remediated by exon 51 skipping, does not reasonably provide enablement for the full scope of the claims that encompass treating any DMD caused by any mutation using any oligomeric compound comprising from 10 to 50 monomer subunits wherein at least part of the sequence of the oligomeric compound is complementary to the sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1). The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. This is a scope of enablement rejection. The factors to be considered in determining whether a disclosure would require undue experimentation include: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the specification; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 8 USPQ2d, 1400 (CAFC 1988) and MPEP 2164.01. The breadth of the claims and the nature of the invention: With respect to claim breadth, the standard under 35 U.S.C. §112(a) entails determining what the claims recite and what the claims mean as a whole. Claim 18 explicitly recites using any of the compounds of Claim 1 to treat DMD. The broadest reasonable interpretation (BRI) of the methods of Claim 18 is that an artisan would be able to treat any DMD in any subject by administering any of the compounds encompassed by Claim 1. The BRI of Claim 1 is any oligomeric compound that comprises from 10-50 monomer subunits wherein the oligomeric compound comprises at least 1 nt complementary to the SEQ ID NO 1. As discussed in §Claim interpretation, at least part of the sequence is interpreted as even a single nucleotide (nt). The claims recite that the oligomeric compound comprises 10-50 monomer subunits but comprises is open language that allows for additional components. Since SEQ ID NO 1 comprise each nucleobase A, T, C, and G, and the claims recite the open language, the claims encompass any nucleotide sequence in existence. Any kind of nucleotide sequence would be encompassed by the claims as instantly presented. The BRI of the methods of Claim 19 is that an artisan would be able to treat any DMD in any subject by administering any of the compounds recited in the claim (i.e., palmitate-NH-C6alkylene-OP[=S][H]-SEQ ID NOs 4-7). The nature of the invention is ASO compounds for treating any DMD and a method for treating any DMD by administering any of the broad genus of compounds recited in Claim 1 (i.e., Claim 18) or any of the specific compounds recited in Claim 19. A skilled artisan would not be able to use the method as claimed with a reasonable expectation of success based solely on what is disclosed in the specification. The state of the art and prior art, the level of one of ordinary skill, and the level of predictability in the art: The art and prior art shows: it would not be possible to treat any DMD caused by mutations in any exon with the full breadth of the claimed compounds. it would not be possible to treat any DMD caused by any mutation in any exon with the compounds claimed in Claims 12 or 19. Regarding point (1), as discussed in the Written Description rejection and above, instant Claim 1 encompasses a huge number of ASO compounds that can comprise a huge breadth of sequences. An artisan would determine that, without presentation of evidence to the contrary, it is not possible to treat DMD using any ASO comprised by the genus and sub-genera encompassed by the claims because the claims encompass a huge number of compounds and the art teaches ASO must have sequence specificity to a target in order to hybridize. The art of Aartsma-Rus (and van Ommen. 2007. Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications. RNA 13[10]:1609–1624, “Aartsma”) teaches (§Introduction ¶1) antisense oligos (ASO/AON) must hybridize to their target. Aartsma teaches (§AON DESIGN AND MODE OF ACTION, entire § but especially ¶4; Fig. 1 caption) ASO/AON must be designed to be specific to a target site and target location affects efficacy because location of hybridization determines what portion(s) are hidden from splicing machinery. Aartsma teaches (§AON specificity) one of the most important features of the AON has to be specificity, in order to avoid long-term side effects. Those teachings indicate that an ASO/AON must have sequence specificity for a specific target in order to provide exon skipping function. Regarding point (2), Aartsma teaches (§The exon skipping approach ¶5; § AONS TO STUDY SPLICING ¶2) the ASO/AON approach is mutation specific in that different mutations require the skipping of different exons to restore the open reading frame. Furthermore, the art of Aslesh (et al. 2018. Skipping Multiple Exons to Treat DMD—Promises and Challenges. Biomedicines 6:1, “Aslesh”) teaches that (§Abstract) only approximately 13% of DMD patients could be treated with a specific exon 51 skipping drug. Aslesh teaches (§Abstract, §1. Introduction ¶2-4) treating some patients would require administering multiple ASOs that result in skipping of multiple exons. Similarly, Aartsma-Rus (et al. 2016. The importance of genetic diagnosis for Duchenne muscular dystrophy. J. Med. Genet. 0:1–7, “Aartsma 2016”) teaches (§ESTABLISHING A GENETIC DIAGNOSIS ¶4) establishing a genetic diagnosis is important because it is necessary to assess whether a patients is eligible for mutation-specific therapies like exon skipping. Those teachings indicate that, without presentation of evidence to the contrary, an artisan would not be able to predictably treat any DMD caused by any mutation(s) by using ASOs that induce skipping of exon 51. Therefore, the art regarding the effect of the full breadth of the claimed compounds in treating any DMD is unpredictable. The amount of direction provided by the specification and the existence of working examples: What is enabled by the working examples is narrow compared to the breadth of the claims. Examples 1 and 2 discuss devising the claimed compound SQY51 and evaluating toxicity in vitro. Example 3/Fig. 6 shows SQY51 binds to albumin in human and macaque serum. Example 4 shows (Fig. 7) plasma concentration and half-life of SQY51, SQY51 without PS linkages results in (Fig. 8) less complement activation and (Fig. 9) less coagulation misfunctioning, and results in (Fig. 10) less complement activation than SYN51. Fig. 11 shows SQY51 administered to monkeys distributes to organs. Table 2 shows SQY51 administered to cynomolgus monkeys causes more exon-51 skipping in muscles (vs. SYN51) after a 4 week treatment. Example 5 shows (Fig. 12) SQY51 results in exon-51 sipping in monkey tissues after systematic administration. Fig. 13 shows SQY51 shows improved biodistribution in monkey muscles after systemic delivery. The Spec. also asserts subsequent exon-51 skipping levels in striated muscles were 10 times higher but provides no data showing that. Those examples demonstrate (Fig. 12) only an ability to skip exon 51, not any exon. They demonstrate the ability to skip exon 51 only by using a specific sequence comprising specific modifications. That is because all the examples used SQY51 which is a specific sequence with specific modifications, namely SEQ ID NO 5. None of the examples uses any compound representing the full breadth of what is claimed (i.e., an oligomeric compound comprising from 10-50 monomer subunits wherein at least part of the sequence of the oligomeric compound is complementary to SEQ ID NO 1) to cause such a variety of exon skipping as to treat any DMD caused by any mutation(s). None of those examples uses any oligomeric compound besides a nucleic acid sequence. Therefore nothing in Applicant’s Examples make the compounds and methods any less unpredictable. The Specification provides no evidence of using any compounds besides those comprising the specific sequence of nucleotides comprising SEQ ID NO 3 (i.e., SEQ ID NOs 4-7) to induce skipping of any exon besides exon 51. Although the level of an artisan is high, the art of treating DMD caused by any mutation is unpredictable. The art of treating DMD using the full breadth of the claimed compounds (i.e., literally any oligonucleotide or any ASO) is unpredictable. The art teaches ASOs must be specific to a sequence and teaches that treating DMD using exon skipping must take into account a patient’s specific mutation(s). The Spec. does not provide guidance on overcoming any of these issues. Therefore an artisan of ordinary skill would have to determine that successfully using the full scope of the claims is unpredictable. The quantity of experimentation needed to make or use the invention: The standard of an enabling disclosure is not the ability to make and test if the invention works but one of the ability to make and use with a reasonable expectation of success. A patent is granted for a completed invention, not the general suggestion of an idea (MPEP 2164.03 and Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1325-26 (Fed. Cir. 2004). The instant specification is not enabling because one cannot follow the guidance presented therein or within the art at the time of filing, and practice the claimed method without first making a substantial inventive contribution. Given teachings in the art and what is disclosed in the Spec., an artisan of ordinary skill would not be able to use the invention as claimed with a reasonable expectation of success. The amount of experimentation required for enabling guidance commensurate in scope with what is claimed goes beyond what is considered “routine” within the art and constitutes undue further experimentation in order to successfully use the method of treating any DMD using any of the compounds encompassed by Claim 1 or treating any DMD using the specific compounds recited in Claim 19 with any reasonable expectation of success. Claims 18-19 are rejected for those reasons. In conclusion, the specification provides enablement for: A method of treating Duchenne Muscular Dystrophy (DMD) in a subject in need thereof by administering to the subject a therapeutically effective amount of a composition comprising the oligomeric compound according to any one of SEQ ID NOs 4-7, wherein the subject’s DMD is caused by a mutation that can be remediated by exon 51 skipping, and A method of treating Duchenne Muscular Dystrophy (DMD) in a subject in need thereof by administering to the subject a therapeutically effective amount of a composition comprising the oligomeric compound selected from: palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATgGCAGTTTC-3' (SEQ ID NO: 4), palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGgCAGTTTC-3' (SEQ ID NO: 5), palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGcAGTTTC-3' (SEQ ID NO: 6), and palmitate-NH-C6alkylene-OP(=S)(OH)-GGAGATGGCaGTTTC-3' (SEQ ID NO: 7) in which tc-DNA nucleotides are typed in capital letters while the modified ribonucleic acid nucleoside is typed in lowercase letter, wherein the subject’s DMD is caused by a mutation that can be remediated by exon 51 skipping. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-13 and 16-19 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claims 1-13 and 16-19 recite the broad recitation an oligomeric compound comprising from 10-50 monomer subunits, and the claims also recite the sequence indicating a nucleic acid sequence which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. There are numerous kinds of oligomeric compounds—not just nucleic acids. The genus oligomeric compounds merely means a molecule that consists of repeating units which are smaller units or monomers. Therefore amino acids, lipids, carbohydrates, and more compounds can be considered oligomeric compounds. Similarly, there are numerous kinds of monomer subunits that comprise an oligomeric compound. The Spec. teaches (p. 4 L13-15) “oligomeric compound” refers to synthetic compounds comprising from 10-50 monomer subunits linked by internucleosidic linkage groups but nothing in the Spec. limits oligomeric compounds to specifically nucleic acids and Fig. 1 shows a linker that is not a nucleic acid joined by an internucleosidic linkage group, demonstrating that subunits other than nt can be joined by such linkages. In addition, Claims 1-2 recite the limitation "the sequence" in L2. There is insufficient antecedent basis for this limitation in the claim because as discussed, an oligomeric compound is not necessarily a nucleic acid sequence or even a sequence of any type, and therefore the claim doesn’t recite any antecedent basis for “the sequence”. Claims 1-13 and 16-19 are rejected for those reasons. Claims 2-13 and 16-18 are rejected because they depend from Claims 1-13 and/or 16-19 and don’t remedy the issues. In the interest of compact prosecution the recitation oligomeric compound is interpreted as requiring an oligomeric nucleic acid compound comprising a sequence of nucleotides. The recitation the sequence is interpreted as the nucleic acid sequence. The monomers are interpreted as nucleotides. Further regarding a lack of antecedent basis, Claims 1-2 recite multiple instances of the sequence and each instance refers to a different sequence. In the interest of compact prosecution, the claims are interpreted as the following: Claim 1. An oligomeric nucleic acid compound comprising a sequence of 10-50 nucleotides wherein at least part of the sequence of the oligomeric nucleic acid compound is complementary to: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1). Claim 2. The oligomeric nucleic acid compound according to claim 1, wherein at least part of the sequence of the oligomeric nucleic acid compound is complementary to a nucleotide sequence comprising the region +48+62 of SEQ ID NO: 2. Claims 16 and 17 recite the limitation "the one or more lipid moieties" in L1-2 (Claim 16) and “the one or more lipid moiety" in L1-2 (Claim 17). There is insufficient antecedent basis for this limitation in the claim because Claim 8 doesn’t recite any lipid moiety. Either amending to the below (as interpreted) or changing the dependency of Claims 16 and 17 to depend from Claim 11 will obviate this rejection. In the interest of compact prosecution the claims are interpreted as reciting: The oligomeric nucleic acid compound according to claim 8, wherein the oligomeric nucleic acid compound comprises one or more lipid… Claim 17 recites derived from palmitoleic acid. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. What is considered to “derive from” anything varies depending on the eye of the beholder. Two artisans would not necessarily agree on whether they consider any particular saturated fatty acid moiety to be “derived from” palmitoleic acid. Claim 17 is rejected for those reasons. In the interest of compact prosecution the claim is interpreted as requiring the saturated fatty acid moiety is palmitoleic acid. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 3 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 3 depends from Claim 1 but under at least one interpretation (see above) fails to limit the subject matter of Claim 1 because both claims are drawn to nucleic acid compounds comprising 10-50 nucleotides. Claim 3 merely recites an intended use for the compound of Claim 1, namely that the compound comprises an antisense oligonucleotide. Alternatively, Claim 3 can be interpreted to merely recite a component of Claim 1 that is already comprised. Under either of those interpretations, nothing in Claim 3 further limits the structure of Claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 1-9, 11, 13, and 16-18 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by International Publication Number WO 2019/241385 (published 19 December 2019, “WO385”, of record on IDS). References to p. # in WO documents refer to PDF p. #. WO385 is drawn to exon 51 skipping ASOs that are used to treat muscular dystrophy. WO385 teaches (p. 2 L14-20) ASO or pharmaceutically acceptable salts thereof, for inducing skipping of exon 51 in the human dystrophin gene, and pharmaceutical compositions thereof. WO385 teaches (same §) methods for treating a subject with the ASO. WO385 teaches (p. 5, p. 177) numerous ASO sequences for inducing exon 51 skipping. WO385 teaches SEQ ID NO 6 (“AON 6”) and SEQ ID NO 90 (“AON 90”) and provides data (p. 183) that AON 6 induces exon 51 skipping. WO385’s SEQ ID NO 6 is a 26-mer and WO385’s SEQ ID NO 90 is a 25-mer; each sequence comprises at least one nt sequence having 100% identity to claimed SEQ ID NOs 3-7, as shown by the following alignments: RESULT 1 NASEQ2_01302026_142740 Query Match 100.0%; Score 15; DB 1; Length 26; Best Local Similarity 100.0%; Matches 15; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGAGATGGCAGTTTC 15 SEQ ID NO 3 ||||||||||||||| Db 12 GGAGATGGCAGTTTC 26 WO385 SEQ ID NO 6 NASEQ2_01302026_154233 Query Match 100.0%; Score 15; DB 1; Length 25; Best Local Similarity 100.0%; Matches 15; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGAGATGGCAGTTTC 15 SEQ ID NO 3 ||||||||||||||| Db 4 GGAGATGGCAGTTTC 18 WO385 SEQ ID NO 90 Those WO385 sequences also share complementarity with SEQ ID NO 1 and positions 48-62 of SEQ ID NO 2; only WO385 SEQ ID NO 6 is shown as an example: NASEQ2_01302026_154550/c Query Match 85.0%; Score 17; DB 1; Length 26; Best Local Similarity 82.4%; Matches 14; Conservative 3; Mismatches 0; Indels 0; Gaps 0; Qy 4 GAAACUGCCAUCUCCAA 20 SEQ ID NO 1 |||||:||||:|:|||| Db 26 GAAACTGCCATCTCCAA 10 WO385 SEQ ID NO 6 US-18-030-265A-2/c Query Match 100.0%; Score 26; DB 1; Length 233; Best Local Similarity 100.0%; Matches 26; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATTTCTAGTTTGGAGATGGCAGTTTC 26 WO385 SEQ ID NO 6 |||||||||||||||||||||||||| Db 73 ATTTCTAGTTTGGAGATGGCAGTTTC 48 positions 48-73 of SEQ ID NO 2 Therefore WO385 anticipates Claims 1-3. Regarding Claims 4-6: WO385 also teaches (starts at p. 76 L18) using tc-DNA and tc-DNA linked by PS linkages in their ASO, including that (p. 77 L1-10) the ASOs can comprise one or more tc-DNA subunits or may be entirely comprised of tc-DNA subunits. Therefore WO385 anticipates Claims 4-6. Regarding Claims 7-9, WO385 teaches (p. 71 L18-29) their ASOs can comprise various kinds of ASO chemistries including, without limitation and in various combinations, ASOs comprising (among others) tc-DNA and 2’OMe subunits and PS-modified oligos. WO385 teaches (p. 75 L1) typical intersubunit linkers include phosphodiester [PO] and phosphorothioate moieties. That indicates that WO385 envisioned ASOs wherein nucleotides were linked by PO linkages. Therefore WO385 anticipates Claims 7-9. Regarding Claims 11, 13, and 16-17, WO385 teaches (pp. 119-121 L11-16) pharmaceutical compositions comprising the ASO and a pharmaceutically acceptable carrier (“pharmaceutically acceptable carrier” is simply a different term for “pharmaceutically acceptable vehicle”). WO385 teaches (same §) formulating the ASO by conjugating it to various lipid moieties including PEG or a phospholipid. WO385 teaches (p. 122 L3-4) including the oil soluble antioxidant ascorbyl palmitate or (p. 139 L25-31) the fatty acid palmitic acid. Therefore WO385 anticipates Claims 11, 13, and 16-17. Regarding Claim 18, WO385 teaches (pp. 42-44 L2-2; pp. 70-72 L 1-17; p. 148 L16-25) methods of treating DMD in a subject by administering the ASOs, including SEQ ID NO 90. Therefore WO385 anticipates Claim 18. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-13 and 16-19 are rejected under 35 U.S.C. 103 as being unpatentable over International Publication Number WO 2019/241385 (published 19 December 2019, “WO385”, of record on IDS) as applied to Claims 1-9, 11, 13, and 16-18 in the 102 rejection above, and further in view of International Publication Number WO 2018/193428 (published 25 October 2018, “WO428”, of record on IDS), Aartsma-Rus (and van Ommen. 2007. Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications. RNA 13[10]:1609–1624, “Aartsma”), and Prakash (et al. 2019. Fatty acid conjugation enhances potency of antisense oligonucleotides in muscle. Nuc. Acid Res. 47[12]:6029-6044, “Prakash”). The teachings of WO385 as applicable to Claim(s) 1-9, 11, 13, and 16-18 have been described in the 102 rejection above. WO385 does not teach an ASO comprising any of the modified nt sequences shown in Claims 10, 12, or 19, wherein tc-DNA nt are shown in capital letters and a modified RNA nucleoside is shown in a lower case letter. However, WO428, drawn to lipid-conjugated tc-DNA sequences comprising 4-40 monomer subunits and methods of using the ASOs to treat DMD, teaches (¶5) exon-skipping therapies to treat DMD by inducing skipping of exon 51. WO428 teaches: (¶10) compositions comprising an oligomeric compound and one or more lipid moiety covalently linked to said oligomeric compound are much more efficient and active in penetrating skeletal muscles, cardiac tissue and CNS after systemic delivery than their tcDNA counterparts not comprising said one or more lipid moiety. WO428 teaches (same §) their ASOs have markedly improved safety profiles and lower toxicity while maintaining high efficacy. WO428 teaches (¶114) ASOs comprising 1 or more nt or nucleosides that are nucleosides other than tc-DNA nucleosides, wherein the non–tc-DNA nucleoside(s) is a 2’-modified RNA and can be specifically (¶117) a 2’-OMe modified RNA nucleoside. WO428 teaches (¶237) attaching the ASO to a lipid moiety via a linker or spacer. WO428 teaches (¶194-195) the lipid moiety can be derived from palmitic acid. WO428 teaches (¶138-140, ¶164, ¶237) using PS linkages to attach a lipid moiety (via a linker or spacer) to the ASO. WO428 teaches (Table 2 which starts at ¶340) various ASOs comprising modification patterns comprising PO-linked 15-mer ASO wherein all nt are tc-DNA except for the nt at positions 8, 9, or 10, which are 2’-OMe RNA nt (see specifically Table 2 SEQ ID NOs 5-6 and 15). Those ASO comprise the same modification pattern(s) as the claimed sequences. WO428 teaches (¶340) those are very preferred embodiments. Aartsma, drawn to a review about exon skipping therapies for DMD, teaches (§AON DESIGN AND MODE OF ACTION entire §) general strategies for designing ASO/AON. Aartsma teaches (same §, ¶1) targeting exon-internal sites can be a good way to reduce the risk of mistargeting splice sites of genes other than DMD. Aartsma teaches (same §, ¶4-5) it is common in the art to use various strategies to design exon skipping ASO/AON. Aartsma teaches (same §) one research group tested 470 ASO/AON in this manner. Aartsma’s teachings indicate it is routine and conventional for an artisan to design large numbers—even hundreds—of overlapping ASO/AON for a single target site and screen them to determine which particular ASO/AON work best. WO385, WO428, and Aartsma do not explicitly teach the exact palmitate conjugate and linker of Claims 10, 12, and 19. However, Prakash, drawn to conjugates for enhancing functional uptake of ASO in muscle, teaches (§Abstract) applying a palmitic acid conjugate to ASO to improve uptake by muscles. Prakash teaches (same §) their conjugates improve albumin binding which facilitates traversal of ASO to muscle tissues and enhances uptake. Prakash teaches (same §) their approach is widely applicable to ASOs for developing more effective ASOs for muscle disorders. Prakash demonstrates (Figs. 5-8) conjugation with palmitoyl enhances ASO potency and uptake. Prakash (Figs. 1 and 5) shows the same structures as what comprises the claimed structure palmitate-NH-C6 alkylene, modified excerpts shown here: PNG media_image1.png 103 559 media_image1.png Greyscale Prakash shows a PO linkage between the linker and the ASO and the instant claims disclose a PS linkage between the linker and the ASO but as discussed above, WO428 teaches (¶95, ¶138-140, ¶237) preferably attaching a lipid moiety to an ASO via a spacer through a PS moiety. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the ASO sequences of WO385 with the teachings and modification patterns of WO428, teachings about testing many different ASO/AON that target the same site of Aartsma, and the palmitic acid conjugate of Prakash for the benefits of producing ASO that are optimized for skipping of exon 51 and for increasing uptake of the ASO by muscle cells. One would have been motivated to do so with a reasonable expectation of success because WO385 teaches their ASO result in skipping of exon 51, because WO428 teaches ASO comprising PO-linked tc-DNA nt, wherein the ASO is conjugated to a lipid moiety improve penetration to skeletal muscles and cardiac tissue while improving safety and lowering toxicity, and because Aartsma teaches it is routine and conventional in the art of exon skipping ASO/AON to test large numbers of overlapping ASO/AON that are directed to the same target. Those teachings indicate it would have been routine and conventional for an artisan to have shortened the sequences of WO385 and applied the modification pattern of WO428. One would have been motivated to modify the ASOs with the conjugate of Prakash with a reasonable expectation of success because Prakash demonstrates that palmitic acid conjugates improve uptake and potency in muscle cells and provides a mechanism by which that occurs, namely binding to albumin. An artisan wanting to use any ASO to treat DMD would have applied the teachings of Prakash to their ASO because those of ordinary skill in the art understand that DMD is a disease that affects muscles and because Prakash teaches (§Abstract) their approach provides a foundation for developing more effective therapeutic ASOs for muscle disorders. Therefore the limitations of Claims 10, 12, and 19 (and Claims 1-9, 11, 13, and 16-18) would have been obvious in view of WO385, WO428, Aartsma, and Prakash. Obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). The motivation to combine falls under an “obvious to try” rationale; see MPEP 2143(I)(E): To reject a claim based on this rationale, Office personnel must resolve the Graham factual inquiries. Then, Office personnel must articulate the following: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success; and (4) whatever additional findings based on the Graham factual inquiries may be necessary, in view of the facts of the case under consideration, to explain a conclusion of obviousness. The rationale to support a conclusion that the claim would have been obvious is that "a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely that product [was] not of innovation but of ordinary skill and common sense. Regarding (1): WO385, WO428, and Aartsma teach there was a design need for ASOs to induce skipping of exon 51, and that it was routine and conventional to produce numerous ASOs that target a specific region to determine which ones work best. Regarding (2): the references teach only a finite, though large, number of ASO sequences and modification patterns. Specifically, WO385 teaches SEQ ID NOs 6 and 90, shows their SEQ ID NO 6 works to induce exon skipping, and teaches that their SEQ ID NO 90 can be used in their methods. WO428 teaches very preferred modification patterns and benefits of those modification patterns. Regarding (3): the teachings of the references indicate one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success because testing combinations of ASO sequences and modification patters was routine and conventional, because WO428 teaches benefits of their specific (and very preferred) modification patterns, and because Prakash teaches benefits of using their lipid conjugate for muscle-targeting ASOs. Therefore all of the instant claims are deemed obvious in view of the prior art. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-13 and 16-19 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 4-10, and 15 of U.S. Patent No. 10,465,191 (“US191”) in view of International Publication Number WO 2019/241385 (published 19 December 2019, “WO385”), International Publication Number WO 2018/193428 (published 25 October 2018, “WO428”), Aartsma-Rus (and van Ommen. 2007. Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications. RNA 13[10]:1609–1624, “Aartsma”), and Prakash (et al. 2019. Fatty acid conjugation enhances potency of antisense oligonucleotides in muscle. Nuc. Acid Res. 47[12]:6029-6044, “Prakash”). Although the claims at issue are not identical they are drawn to overlapping subject matter because the patented US191 claims are drawn to methods for delivering to a human patient tc-DNA AON that induce exon skipping, including skipping of exon 51, wherein the AON can be 10-18-mer or 15-mer, and wherein the patient can have DMD. The US191 claims broadly encompass delivering tc-DNA AON. The instant claims are directed to ASOs that are 10-50-mer and comprise complementarity to SEQ ID NO 1 or 2, or comprise identity to SEQ ID NO 3 or the nt sequence of SEQ ID NO 3, can have a tc-DNA, or can have tc-DNA and 2’-OMe and other modifications, including a lipid conjugate that is palmitate, and to methods of using the ASO to treat DMD. The US191 claims don’t recite the exact sequences of the instant claims, or various modifications, or the palmitate, but those limitations and benefits of using them in ASO are taught by WO385 (p. 2 L14-20; p. 5, p. 177; p. 183; starts at p. 76 L18; p. 77 L1-10; p. 71 L18-29; pp. 119-121 L11-16; p. 122 L3-4; p. 139 L25-31; pp. 42-44 L2-2; pp. 70-72 L 1-17; p. 148 L16-25), WO428 (¶5, ¶10, ¶114, ¶117, ¶237, ¶194-195, ¶138-140, ¶164, ¶237, Table 2 which starts at ¶340, see specifically Table 2 SEQ ID NOs 5-6 and 15, ¶340), and Prakash (§Abstract and Figs. 1 and 5-8). In addition, Aartsma teaches (§AON DESIGN AND MODE OF ACTION entire §) it is routine and conventional in the art of exon skipping ASO to produce and screen numerous overlapping AON comprising sequences designed for any one target, and then further optimize the most effective ASO. It would have therefore been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the invention of the US191 claims with the teachings of WO385, WO428, and Prakash and the teachings of Aartsma for the benefits of optimizing ASO for treating DMD. Therefore the instant claims would have been obvious in view of the US191 claims and WO385, WO428, Prakash, and Aartsma. Claim 1-13 and 16-19 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 4-10, and 15 of U.S. Patent No. 10,471,089 (“US089”) in view of WO385, WO428, Aartsma, and Prakash. Although the claims at issue are not identical they are drawn to overlapping subject matter because the patented US089 claims are drawn to a combination therapy comprising administering to a human patient a 10-40-mer ASO that induces exon skipping in a dystrophin pre-mRNA, and other components. The US089 claims broadly encompass delivering treating DMD with ASO/AON that induce exon skipping. The instant claims are directed to ASOs that are 10-50-mer and comprise complementarity to SEQ ID NO 1 or 2, or comprise identity to SEQ ID NO 3 or the nt sequence of SEQ ID NO 3, can have a tc-DNA, or can have tc-DNA and 2’-OMe and other modifications, including a lipid conjugate that is palmitate, and to methods of using the ASO to treat DMD. The US089 claims don’t recite the exact sequences of the instant claims, or various modifications, or the palmitate, but those limitations and benefits of using them in ASO are taught by WO385 (p. 2 L14-20; p. 5, p. 177; p. 183; starts at p. 76 L18; p. 77 L1-10; p. 71 L18-29; pp. 119-121 L11-16; p. 122 L3-4; p. 139 L25-31; pp. 42-44 L2-2; pp. 70-72 L 1-17; p. 148 L16-25), WO428 (¶5, ¶10, ¶114, ¶117, ¶237, ¶194-195, ¶138-140, ¶164, ¶237, Table 2 which starts at ¶340, see specifically Table 2 SEQ ID NOs 5-6 and 15, ¶340), and Prakash (§Abstract and Figs. 1 and 5-8). In addition, Aartsma teaches (§AON DESIGN AND MODE OF ACTION entire §) it is routine and conventional in the art of exon skipping ASO to produce and screen numerous overlapping AON comprising sequences designed for any one target, and then further optimize the most effective ASO. It would have therefore been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the invention of the US089 claims with the teachings of WO385, WO428, and Prakash and the teachings of Aartsma for the benefits of optimizing ASO for treating DMD. Therefore the instant claims would have been obvious in view of the US089 claims and WO385, WO428, Prakash, and Aartsma. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. RUTHIE S ARIETI Examiner (Ruth.Arieti@uspto.gov) Art Unit 1635 /RUTH SOPHIA ARIETI/Examiner, Art Unit 1635 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Apr 04, 2023
Application Filed
Feb 02, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594349
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Apr 07, 2026
Patent 12584134
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 24, 2026
Patent 12540324
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12540326
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12534728
RNAi Agents for Inhibiting Expression of 17beta-HSD Type 13 (HSD17B13), Compositions Thereof, and Methods of Use
2y 5m to grant Granted Jan 27, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+72.7%)
2y 7m
Median Time to Grant
Low
PTA Risk
Based on 81 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month