DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Support for the amendments is within the instant application specification. Applicants’ amendment to the claims filed on 12/8/2025 is acknowledged. This listing of claims replaces all prior listings of claims in the application. Claims 70-71, 73-90 are pending. Claims 1-69, 72 are canceled. Election/Restrictions Applicant's election with traverse of Group I, claims 70, 71, 73-82, 90 in the reply dated 12/8/2025 is acknowledged. Applicant contends that Pertel relates to an anti-CD19 chimeric antigen receptor. See e.g., Pertel at Abstract . Pertel does not teach or reasonably suggest the polynucleotide of the presently presented claims. Therefore, Applicant respectfully submits that the claims have unity and kindly requests rejoinder of Claims 83-89 . This argument is found to be not persuasive . Applicant is reminded that the evidence of burden of search does not apply to examination of PCT applications upon entering the national stage. MPEP § 1893.03(d) states "the principles of unity of invention are used to determine the types of claimed subject matter and the combinations of claims to different categories of invention that are permitted to be included in a single international or national stage patent application." See MPEP § 1850 for a detailed discussion of Unity of Invention. The basic principle is that an application should relate to only one invention or, if there is more than one invention, that applicant would have a right to include in a single application only those inventions which are so linked as to form a single general inventive concept." A group of inventions is considered linked to form a single general inventive concept where there is a technical relationship among the inventions that involves at least one common or corresponding special technical feature. The expression special technical features is defined as meaning those technical features that define the contribution which each claimed invention, considered as a whole, makes over the prior art. The inventions of Groups I-IV lack unity because even though the inventions of these groups require the technical feature of a polynucleotide encoding a chimeric polypeptide comprising: an extracellular PD 1 domain , this technical feature is not a special technical feature as it does not make a contribution over the prior art in view of Pertel et al (WO 2020/219848, Date Filed: Examiner cited) {herein Pertel }. Claims 70-71, 73-90 are pending. Claims 83-89 stand withdrawn pursuant to 37 CFR 1.142(b). Claims 1-69, 72 are canceled. Claims 70-71, 73-82, 90 are pending and examined on the merits. Priority Acknowledgement is made of this national stage entry of PCT/US2021/053971 filed on 10/7/2021, which claims domestic priority to U.S. provisional application 63/089,752 filed on 10/9/2020. Information Disclosure Statement The information disclosure statement (IDS) submitted on 4/5/2023, 11/16/2023, 12/13/2024, 9/22/2025 is acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Drawings The Drawings filed on 4/5/2023 are acknowledged and accepted by the examiner. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 70, 73-82, 90 are rejected under 35 U.S.C. 10 3 as being FILLIN "Insert either—clearly anticipated—or—anticipated—with an explanation at the end of the paragraph." \d "[ 3 ]" unpatentable over Jensen et al (WO 2018/111763 A1, Date Published: 21 June 2018, cited in IDS dated 9/22/2025) {Herein Jensen} in view of Molnar et al (2017, EBioMedicine , Examiner cited) {herein Molnar} . Claims 70, 73-75, 90 are drawn to a polynucleotide encoding a chimeric polypeptide comprising: an extracellular PD1 domain , comprising an A132L substitution relative to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:01 ; and an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88). Claims 76-77 are drawn to a vector comprising the polynucleotide of claim 70. Claims 78 is drawn to a polypeptide encoded by the polynucleotide of claim 70. Claims 79-81 are drawn to a cell comprising the polynucleotide of claim 70, or a polypeptide encoded by the polynucleotide . Claim 82 is drawn to a pharmaceutical composition comprising the cell of claim 79 and a pharmaceutically acceptable excipient. With respect to claim s 70 , 73 , 75-80 Jensen teaches a chimeric polynucleotide encoding a chimeric polypeptide comprising an extracellular PD1 domain and an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) (para 120 and Appendix A) in a pharmaceutically acceptable excipient (para 0015) . The extracellular PD1 domain taught by Jensen has 100% sequence identity to the instant application SEQ ID NO: 4 (appendix A). Additionally, s aid construct is in an inducible viral vector such as a lentivirus within host cells (para 0013). Said host cells are selected from CD4+ T-cells, CDB+ T-cells (para 0014). With respect to claim 74 , the recitation ‘ an amino acid sequence comprising 0-24 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 10 ’ reads on any chimeric polypeptide with 0 of the conservation amino acid substitutions within SEQ ID NO: 10. As such, it is the Examiner’s position that SEQ ID NO: 4, taught by Jensen (appendix A) meets the limitations of claim 74 as said sequence is a chimeric polypeptide contain ing 0 conservation amino acid substitutions of SEQ ID NO: 10 as said substitutions are not defined by the instant application claims. With respect to claim 75 , Jensen teaches a nucleic acid encoding a truncated Her2 sequence (para 0203). With respect to claim 81 , Jensen teaches human T lymphocytes can be engineered by gene transfer to express chimeric antigen receptors (CARs ) encoded by nucleic acid (para 0013). With respect to claim 90 , the recitation ‘ ( i ) the extracellular PD1 domain comprises an amino acid sequence comprising 0- 7 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:02; and/or 3 (ii) the intracellular immunostimulatory domain comprises an amino acid sequence comprising 0-14 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 04 ’ reads on any amino acid sequence of extracellular PD1 domain and an intracellular immunostimulatory domain with 0 of the conservation amino acid substitutions within SEQ ID NOs: 2, 3, 4. As such, it is the Examiner’s position that SEQ ID NO: 4 ( PD-1 fusion to MyD88 ) , taught by Jensen (appendix A) meets the limitations of claim 90 as said sequence contains 0 conservation amino acid substitutions of SEQ ID NOs: 2, 3, 4 as said substitutions are not defined by the instant application claims and Jensen teaches SEQ ID NO: 4 is PD-1 fused to MyD88 . However, Jensen does not teach the product of claim 70 of an extracellular PD1 domain comprising an A132L substitution (claim 70). With respect to claim 70 , Molnar teaches an extracellular PD1 domain comprising an A132L substitution that increases the binding affinity of PD1 to PD-L1 and PD-L2 (abstract). Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to apply the teachings of Jensen et al of a chimeric polynucleotide encoding a chimeric polypeptide comprising an extracellular PD1 domain and an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) (para 120 and Appendix A) in a pharmaceutically acceptable excipient (para 0015) or combine the teachings of Molnar of an extracellular PD1 domain comprising an A132L substitution for increased binding affinity to PD-L1 and PD-L2 (abstract). One of ordinary skill in the art would be motivated to either use the teachings of Jensen et al. by itself or combine the teachings Molnar because Molnar provides the motivation for Jensen to mutat e the extracellular PD1 domain by introducing a substitution /amino acid mutation of A132L as doing so results in a n extracellular PD1 domain mutant (A132L) with increased affinity/binding to PD-L1 and PD-L2, thereby inhibiting the proliferation of tumor cells (abstract and page 31, column 1, para 2) by significantly increasing the proliferation and cytokine production of human T-cells (page 31, column 2, para 2). One of ordinary skill in the art knowing the benefit of inhibiting the proliferation of tumor cells in mammals based on the teachings of Jensen and Molnar would have a reasonable expectation of success to combine the extracellular PD1 domain with a A132L mutation as doing so resulted in synergistically decreased local and metastatic tumor burden, increased survival and induced immunological memory responses towards tumor re-challenge (page 31, column 2, para 2). One of skill in the art would have a reasonable expectation of success to make and use the claimed polynucleotide encoding a chimeric polypeptide comprising: an extracellular PD1 domain because Jensen teaches a chimeric polynucleotide encoding a chimeric polypeptide comprising an extracellular PD1 domain and an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) (para 120 and Appendix A) in a pharmaceutically acceptable excipient (para 0015). Whereas, Molnar teaches an extracellular PD1 domain comprising an A132L substitution for increased binding affinity to PD-L1 and PD-L2 (abstract). Therefore there would be a reasonable expectation of success to arrive at the above invention. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Claim 71 is rejected under 35 U.S.C. 103 as being unpatentable over Jensen et al (WO 2018/111763 A1, Date Published: 21 June 2018, cited in IDS dated 9/22/2025) {Herein Jensen} in view of Molnar et al (2017, EBioMedicine , Examiner cited) {herein Molnar} as applied to claims 70, 73- 82, 90 in further view of Noessner et al ( US 11,365,237 B2, Filing Date: Mar. 23, 2017, Examiner cited) {herein Noessner }. Claim 71 is drawn to t he polynucleotide of claim 70, wherein the extracellular PD1 domain comprises a polypeptide encoded by a nucleotide sequence having at least 95% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:01 or 02. The teachings of Jensen in view of Molnar as applied to claims 70, 73-82 , 90 are set forth in the 10 3 rejection. However, Jensen in view of Molnar do not teach the product of claim 71, wherein the extracellular PD1 domain comprises a polypeptide encoded by a nucleotide sequence having at least 95% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:01 or 02 ( claim 71 ) . With respect to claim 71 , Noessner teaches a chimeric polypeptide encoding an extracellular domain containing a polypeptide derived from human PD-1 BB (column 1, lines 6-7, lines 46-48 ; column 19, lines 48-49 ). Said polypeptide is 97.6% identical to the instant application SEQ ID NO: 1 (appendix B ). Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to apply the teachings of Jensen et al of a chimeric polynucleotide encoding a chimeric polypeptide comprising an extracellular PD1 domain and an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) (para 120 and Appendix A) in a pharmaceutically acceptable excipient (para 0015) or combine the teachings of Molnar of an extracellular PD1 domain comprising an A132L substitution that increases the binding affinity of PD1 to PD-L1 and PD-L2 (abstract) and Noessner of a chimeric polypeptide encoding an extracellular domain containing a polypeptide derived from PD-1 BB (column 1, lines 6-7, lines 46-48 ; column 10, lines 48-49 ). One of ordinary skill in the art would be motivated to either use the teachings of Jensen et al. in view of Molnar or combine the teachings of Noessner as Noessner provides the motivation for Jensen in view of Molnar to substitute the extracellular PD1 domain A132L with the PD1-BB taught by Noessner as said PD1-BB fusion offer a synergistic benefit by simultaneously enhancing T cell activation and overcoming immune suppression , leading to a more potent and durable anti-tumor immune response ( Noessner : column 4, lines 1-3) . One of ordinary skill in the art knowing the benefit of PD1-BB and its inhibitory effect on cancer specific T-cell proliferation base d on the teachings of Jensen , Molnar and Noessner would have a reasonable expectation of success that substituting the PD-1 ( A132L ) domain taught by Jensen , in view of Molnar with the human PD-1 BB domain taught by Noessner would yield predictable results in inhibiting the proliferation on tumor specific T-cells, thereby modulating the occurrence of cancer ( Noessner : abstract ; Jensen: para 0004) . One of skill in the art would have a reasonable expectation of success to make and use the claimed polynucleotide encoding a chimeric polypeptide comprising: an extracellular PD1 BB domain because Jensen teaches a chimeric polynucleotide encoding a chimeric polypeptide comprising an extracellular PD1 domain and an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) (para 120 and Appendix A) in a pharmaceutically acceptable excipient (para 0015). Noessner teaches a chimeric polypeptide encoding an extracellular domain containing a polypeptide comprising human PD-1 BB (column 1, lines 6-7, lines 46-48) that is 97.6% identical to the instant application SEQ ID NO: 1 (appendix B) . Whereas, Molnar t eaches an extracellular PD1 domain comprising an A132L substitution that increases the binding affinity of PD1 to PD-L1 and PD-L2 (abstract). Therefore there would be a reasonable expectation of success to arrive at the above invention. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Conclusion Claims 70-71, 73-82, 90 are pending and examined on the merits. Claims 83-89 stand withdrawn pursuant to 37 CFR 1.142(b). Claims 1-69, 72 are canceled. Claims 70 -71, 73-82, 90 are rejected. No claims are in condition for allowance. Any inquiry concerning this communication or earlier communications from the examiner should be directed to FILLIN "Examiner name" \* MERGEFORMAT ERICA NICOLE JONES-FOSTER whose telephone number is FILLIN "Phone number" \* MERGEFORMAT (571)270-0360 . The examiner can normally be reached FILLIN "Work Schedule?" \* MERGEFORMAT mf 7:30a - 4:30p . Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, FILLIN "SPE Name?" \* MERGEFORMAT Manjunath Rao can be reached at FILLIN "SPE Phone?" \* MERGEFORMAT 571-272-0939 . The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ERICA NICOLE JONES-FOSTER/ Examiner, Art Unit 1656 /MANJUNATH N RAO/ Supervisory Patent Examiner, Art Unit 1656 Appendix A Instant Application SEQ ID NO: 4 vs Jensen et al SEQ ID NO: 100 (PDI TM-MyD88) (Jensen: para 120) Query Match 100.0%; Score 888; Length 1035; Best Local Similarity 100.0%; Matches 888; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCTGCTGGCGGACCTGGCGCTGGATCTGCTGCTCCTGTGTCTAGCACCAGCAGCCTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 148 ATGGCTGCTGGCGGACCTGGCGCTGGATCTGCTGCTCCTGTGTCTAGCACCAGCAGCCTG 207 Qy 61 CCTCTGGCCGCCCTGAATATGAGAGTGCGGCGGAGACTGAGCCTGTTCCTGAACGTGCGG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 208 CCTCTGGCCGCCCTGAATATGAGAGTGCGGCGGAGACTGAGCCTGTTCCTGAACGTGCGG 267 Qy 121 ACACAGGTGGCCGCCGATTGGACAGCTCTGGCCGAGGAAATGGACTTCGAGTACCTGGAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 268 ACACAGGTGGCCGCCGATTGGACAGCTCTGGCCGAGGAAATGGACTTCGAGTACCTGGAA 327 Qy 181 ATCCGGCAGCTGGAAACCCAGGCCGACCCTACAGGACGCCTGCTGGATGCTTGGCAGGGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 328 ATCCGGCAGCTGGAAACCCAGGCCGACCCTACAGGACGCCTGCTGGATGCTTGGCAGGGC 387 Qy 241 AGACCAGGCGCTTCTGTGGGGAGACTGCTGGAACTGCTGACCAAGCTGGGCCGGGACGAC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 388 AGACCAGGCGCTTCTGTGGGGAGACTGCTGGAACTGCTGACCAAGCTGGGCCGGGACGAC 447 Qy 301 GTGCTGCTGGAACTGGGCCCTAGCATCGAAGAGGACTGCCAGAAGTACATCCTGAAGCAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 448 GTGCTGCTGGAACTGGGCCCTAGCATCGAAGAGGACTGCCAGAAGTACATCCTGAAGCAG 507 Qy 361 CAGCAGGAAGAGGCCGAGAAGCCTCTGCAGGTGGCAGCCGTGGATAGCAGCGTGCCAAGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 508 CAGCAGGAAGAGGCCGAGAAGCCTCTGCAGGTGGCAGCCGTGGATAGCAGCGTGCCAAGA 567 Qy 421 ACAGCTGAGCTGGCCGGAATCACCACCCTGGACGATCCTCTGGGCCACATGCCCGAGAGA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 568 ACAGCTGAGCTGGCCGGAATCACCACCCTGGACGATCCTCTGGGCCACATGCCCGAGAGA 627 Qy 481 TTCGACGCCTTCATCTGCTACTGCCCCAGCGACATCCAGTTCGTGCAGGAAATGATCAGA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 628 TTCGACGCCTTCATCTGCTACTGCCCCAGCGACATCCAGTTCGTGCAGGAAATGATCAGA 687 Qy 541 CAGCTGGAACAGACCAACTACCGGCTGAAGCTGTGCGTGTCCGACCGGGATGTGCTGCCT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 688 CAGCTGGAACAGACCAACTACCGGCTGAAGCTGTGCGTGTCCGACCGGGATGTGCTGCCT 747 Qy 601 GGCACCTGTGTGTGGTCTATCGCCAGCGAGCTGATCGAGAAGCGGTGCAGACGGATGGTC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 748 GGCACCTGTGTGTGGTCTATCGCCAGCGAGCTGATCGAGAAGCGGTGCAGACGGATGGTC 807 Qy 661 GTGGTGGTGTCCGACGACTACCTGCAGTCCAAAGAGTGCGACTTCCAGACCAAGTTCGCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 808 GTGGTGGTGTCCGACGACTACCTGCAGTCCAAAGAGTGCGACTTCCAGACCAAGTTCGCC 867 Qy 721 CTGAGCCTGAGCCCTGGCGCCCACCAGAAGAGACTGATCCCCATCAAGTACAAGGCCATG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 868 CTGAGCCTGAGCCCTGGCGCCCACCAGAAGAGACTGATCCCCATCAAGTACAAGGCCATG 927 Qy 781 AAGAAAGAGTTCCCCAGCATCCTGCGGTTCATCACCGTGTGCGACTACACCAACCCCTGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 928 AAGAAAGAGTTCCCCAGCATCCTGCGGTTCATCACCGTGTGCGACTACACCAACCCCTGC 987 Qy 841 ACCAAGTCCTGGTTCTGGACCAGACTGGCCAAGGCCCTGTCTCTGCCT 888 |||||||||||||||||||||||||||||||||||||||||||||||| Db 988 ACCAAGTCCTGGTTCTGGACCAGACTGGCCAAGGCCCTGTCTCTGCCT 1035 Appendix B Instant Application SEQ ID NO: 1 vs Noessner et al SEQ ID NO: 23 Query Match 97.6%; Score 559.2; Length 702; Best Local Similarity 98.6%; Matches 564; Conservative 0; Mismatches 8; Indels 0; Gaps 0; Query Match 97.6%; Score 559.2; Length 702; Best Local Similarity 98.6%; Matches 564; Conservative 0; Mismatches 8; Indels 0; Gaps 0; Qy 1 ATGCAGATCCCTCAGGCCCCTTGGCCTGTCGTGTGGGCTGTGCTGCAGCTGGGATGGCGG 60 |||||||| |||||||| |||||||||||||||||||| ||||| ||||||||||||||| Db 1 ATGCAGATTCCTCAGGCTCCTTGGCCTGTCGTGTGGGCCGTGCTCCAGCTGGGATGGCGG 60 Qy 61 CCTGGCTGGTTTCTGGACAGCCCCGACAGACCCTGGAACCCCCCTACATTTTCCCCTGCC 120 ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCTGGATGGTTCCTGGACAGCCCCGACAGACCCTGGAACCCCCCTACATTTTCCCCTGCC 120 Qy 121 CTGCTGGTCGTGACCGAGGGCGACAATGCCACCTTCACCTGTAGCTTCAGCAACACCAGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTGCTGGTCGTGACCGAGGGCGACAATGCCACCTTCACCTGTAGCTTCAGCAACACCAGC 180 Qy 181 GAGAGCTTCGTGCTGAACTGGTACAGAATGAGCCCCAGCAACCAGACCGACAAGCTGGCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GAGAGCTTCGTGCTGAACTGGTACAGAATGAGCCCCAGCAACCAGACCGACAAGCTGGCC 240 Qy 241 GCCTTCCCCGAGGATAGATCTCAGCCCGGCCAGGACTGCCGGTTCAGAGTGACCCAGCTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCCTTCCCCGAGGATAGATCTCAGCCCGGCCAGGACTGCCGGTTCAGAGTGACCCAGCTG 300 Qy 301 CCCAACGGCCGGGACTTCCACATGTCTGTCGTGCGGGCCAGACGGAACGACAGCGGCACA 360 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Db 301 CCCAACGGCCGGGACTTCCACATGTCTGTCGTGCGCGCCAGACGGAACGACAGCGGCACA 360 Qy 361 TATCTGTGCGGCGCCATCAGCCTGGCCCCCAAGGCCCAGATCAAAGAGAGCCTGAGAGCC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TATCTGTGCGGCGCCATCAGCCTGGCCCCCAAGGCCCAGATCAAAGAGAGCCTGAGAGCC 420 Qy 421 GAGCTGAGAGTGACCGAGAGAAGGGCCGAAGTGCCTACCGCCCACCCTAGCCCATCTCCA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GAGCTGAGAGTGACCGAGAGAAGGGCCGAAGTGCCTACCGCCCACCCTAGCCCATCTCCA 480 Qy 481 AGACCTGCCGGCCAGTTCCAGACACTGGTCGTGGGAGTCGTGGGCGGACTGCTGGGATCT 540 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 481 AGACCTGCCGGCCAGTTCCAGACACTGGTCGTGGGAGTCGTGGGCGGCCTGCTGGGATCT 540 Qy 541 CTGGTGCTGCTCGTGTGGGTGCTGGCCGTGAT 572 |||||||||||||||||||||||||||||||| Db 541 CTGGTGCTGCTCGTGTGGGTGCTGGCCGTGAT 572