Prosecution Insights
Last updated: October 04, 2026
Application No. 18/030,476

METHODS AND COMPOSITIONS COMPRISING PD1 CHIMERIC POLYPEPTIDES

Non-Final OA §103
Filed
Apr 05, 2023
Priority
Oct 09, 2020 — provisional 63/089,752 +1 more
Examiner
JONES-FOSTER, ERICA NICOLE
Art Unit
1656
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seattle Children's Hospital (dba Seattle Children's Research Institute)
OA Round
3 (Non-Final)
48%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
93%
With Interview

Examiner Intelligence

Grants 48% of resolved cases
48%
Career Allowance Rate
38 granted / 79 resolved
-11.9% vs TC avg
Strong +45% interview lift
Without
With
+44.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
56 currently pending
Career history
155
Total Applications
across all art units

Statute-Specific Performance

§101
7.5%
-32.5% vs TC avg
§103
39.1%
-0.9% vs TC avg
§102
20.1%
-19.9% vs TC avg
§112
22.8%
-17.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 79 resolved cases

Office Action

§103
DETAILED CORRESPONDENCE Application Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Support for the amendments are within the instant application specification. A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 7/28/2026 has been entered. Applicant’s amendment to the claims filed on 7/28/2026 in response to the Final Rejection mailed on 5/5/2026 is acknowledged. This listing of claims replaces all prior listings of claims in the application. Claims 70-71, 74-90 are pending. Claims 83-89 stand withdrawn pursuant to 37 CFR 1.142(b). Claims 1-69, 72-73 are canceled. Claims 70-71, 74-82, 90 are pending and examined on the merits. Applicant’s remarks filed on 7/28/2026 in response to the Final Rejection mailed on 5/5/2026 have been fully considered and are not deemed persuasive to overcome at least one of the rejections and/or objections as previously applied. The text of those sections of Title 35 U.S. Code not included in the instant action can be found in the prior Office Action. Maintained Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The rejection of claims 70-71, 74-82, 90 under 35 U.S.C. 103 as being unpatentable over Molnar et al (2017, EBioMedicine, cited on PTO-892 dated 12/23/2025) {herein Molnar in view of Jensen et al (WO 2018/111763 A1, Date Published: 21 June 2018, cited in IDS dated 9/22/2025) {Herein Jensen} in further view of Noessner et al (US 11,365,237 B2, Filing Date: Mar. 23, 2017, cited on PTO-892 dated 12/23/2025) {herein Noessner} is maintained. The rejection has been modified in view of Applicant’s amendment to claim 70 to recite ‘comprising an amino acid sequence comprising 0- 14 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:04,’ and cancellation of claim 73. Claims 70-71, 74-82, 90 are drawn to a polynucleotide encoding a chimeric polypeptide comprising: an extracellular PD1 domain comprising an A132L substitution relative to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:01; and an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88); comprising an amino acid sequence comprising 0- 14 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:04. With respect to claims 70, 71, 74, 76, Molnar teaches an extracellular mutant human PD-1 with increased binding affinity (abstract, page 31, para 2.1). Noessner teaches human PD-1 (SEQ ID NO: 23) is at least 95% identical to the instant application SEQ ID NO: 1 (appendix A). As such, it is the Examiner’s position that the human PD-1 taught by Molnar would inherently be at least 95% identical to the instant application SEQ ID NO: 1 since both Molnar and the instant application SEQ ID NO: 1 teaches human PD-1. Molnar further teaches the human PD-1 has a substitution of A132L (abstract, page 31, column 2, para 3). Said mutant was cloned into a pET3a vector (page 31, column 2, para 3). When said mutant is synergized with radiation therapy, the combination decreased local metastatic tumor burden and established immunological memory responses in murine lung carcinoma cells (abstract). Molnar further teaches PD-1 and its ligands are single-pass type I transmembrane proteins, similar to other members of the CD28/B7 family (page 31, column 1, para 3). PD-1 consists of an extracellular immunoglobulin variable (IgV) domain, a transmembrane segment and a cytoplasmic tail harboring two tyrosine-based signaling motifs (page 31, column 1, para 3). Furthermore, since the instant application SEQ ID NO: 1 is 99.4% identical to the instant application SEQ ID NO: 10, it is the Examiner’s position that Molnar teaches the instant application claim 74 of ‘(i) an amino acid sequence having at least 95% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 10; or (ii) an amino acid sequence comprising 0-24 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 10’ (appendix C). It is noted that the recitation ‘an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88); comprising an amino acid sequence comprising 0- 14 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:04’ of the instant application claim 70 reads on any amino acid sequence of MyD88 comprising an amino acid sequence comprising 0- 14 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:04 as Applicant has not defined the conservation amino acid substitutions. However, Molnar does not teach the product of claim 70 of an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88); comprising an amino acid sequence comprising 0- 14 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:04 (claim 70). Molnar does not teach the polynucleotide of claim 70, further comprising:(i) a nucleic acid encoding a cell surface selectable marker selected from a truncated HER2 (Her2tG) polypeptide, a truncated EGFR (EGFRt) polypeptide, or a truncated CD19 (CD19t);(ii) a promoter operably linked to a nucleic acid encoding the chimeric polypeptide, wherein the promoter is selected from a constitutive promoter, an El a promoter, an inducible promoter, or a promoter comprising the nucleotide sequence set forth in SEQ ID NO:14; and/or (iii) a nucleic acid encoding a chimeric antigen receptor (CAR) (claim 75). Molnar does not teach the vector of claim 76, wherein the vector comprises a viral vector selected from a lentiviral vector, an adeno-associated viral vector, or an adenoviral vector (claim 77). Molnar does not teach a polypeptide encoded by the polynucleotide of claim 70 (claim 78). Molnar does not teach a cell comprising the polynucleotide of claim 70, or a polypeptide encoded by the polynucleotide (claim 79). Molnar does not teach the cell of claim 79, further comprising a nucleic acid encoding a chimeric antigen receptor (CAR) (claim 81). Molnar does not teach a pharmaceutical composition comprising the cell of claim 79 and a pharmaceutically acceptable excipient (claim 82). Molnar does not teach the polynucleotide of claim 70, wherein:(i) the extracellular PD1 domain comprises an amino acid sequence comprising 0- 7 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:02; and/or (ii) the intracellular immunostimulatory domain comprises an amino acid sequence comprising 0-14 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 04 (claim 90). With respect to claims 70, 77-80, 82, Jensen teaches a chimeric polynucleotide encoding a chimeric polypeptide comprising a PD-1 transmembrane - intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) fusion encoded by a polynucleotide (para 120 and Appendix B) in a pharmaceutically acceptable excipient (para 0015) to mediate a T-cell response including, but not limited to, activation, proliferation, differentiation, cytokine secretion and the like (para 0060). The MYD88 taught by Jensen has 100% sequence identity to the instant application SEQ ID NO: 4 (appendix B). Additionally, said construct is within an inducible viral vector (lentivirus) within host cells (para 0013). Said host cells are selected from CD4+ T-cells, CD8+ T-cells (para 0014). With respect to claim 75, Jensen teaches a nucleic acid encoding a truncated Her2 sequence (para 0203). With respect to claim 81, Jensen teaches human T lymphocytes can be engineered by gene transfer to express chimeric antigen receptors (CARs) encoded by nucleic acid (para 0013). With respect to claim 90, the recitation of ‘(i) the extracellular PD1 domain comprises an amino acid sequence comprising 0- 7 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:02; and/or 3 (ii) the intracellular immunostimulatory domain comprises an amino acid sequence comprising 0-14 conservative amino acid substitutions of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 04’ reads on any amino acid sequence with an extracellular PD1 domain and an intracellular immunostimulatory domain with 0 of the conservation amino acid substitutions within SEQ ID NOs: 2, 3, 4 as Applicant has not defined the conservation amino acid substitutions. As such, it is the Examiner’s position that the instant application SEQ ID NO: 4 (MyD88), taught by Jensen (appendix B) meets the limitations of claim 90 as said instant application SEQ ID NO: 4 comprises an amino acid sequence comprising 0-14 conservative amino acid substitutions (appendix B). Before the effective filing date of the claimed invention, it would have been obvious to one of ordinary skill in the art to apply the teachings of Molnar et al of a extracellular mutant human PD-1 with increased binding affinity (abstract) with a mutation of A132L (abstract, page 31, column 2, para 3) or combine the teachings of Jensen because Jensen teaches a chimeric polynucleotide encoding a chimeric polypeptide comprising a transmembrane PD1 domain and an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) encoded by a polynucleotide (para 120 and Appendix B) in a pharmaceutically acceptable excipient (para 0015). One of ordinary skill in the art would be motivated to either use the teachings of Molnar by itself or combine the teachings of Jensen because Jensen provides Molnar the motivation to combine an extracellular PD1 domain comprising an A132L substitution (appendix A) with an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) (appendix B) as Jensen teaches constructs comprising MYD88 provide enhanced tumor potency, survival and proliferation of transduced cells (para 0110, para 0060) of which is the goal of Molnar with the teaching of the generation of more enhanced tumor immunotherapy (Molnar: abstract). As such, one of ordinary skill in the art would have a reasonable expectation of success that combining the enhanced PD-1 binding capability of the mutant PD-1 taught by Molnar with enhanced T-cell activation via MYD88 (stimulatory) taught by Jensen would result in a more robust and sustained activation of T-cells for tumor immunotherapy and immune modulatory properties. One of skill in the art would have a reasonable expectation of success to make and use the claimed polynucleotide encoding a chimeric polypeptide comprising: an extracellular PD1 domain comprising an A132L substitution and a an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) because Molnar teaches a mutant human PD-1 with increased binding affinity (abstract). Said mutant has a mutation of A132L (abstract, page 31, column 2, para 3). Whereas Jensen teaches a chimeric polynucleotide encoding a chimeric polypeptide comprising an intracellular immunostimulatory domain from myeloid differentiation primary response 88 protein (MYD88) encoded by a polynucleotide (para 120 and Appendix B) in a pharmaceutically acceptable excipient (para 0015). Therefore there would be a reasonable expectation of success to arrive at the above invention. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. RESPONSE TO REMARKS: Beginning on p. 5 of Applicant’s remarks, Applicants in summary contends that no combination of Jensen, Molnar, or Noessner teaches or reasonably discloses all elements of the claims as amended. Applicant contends that Jensen does not teach or suggest the extracellular PD1 domain. The argument is not persuasive. Examiner contends that Molnar in view of Jensen teaches and provides the motivation for one of ordinary skill in the art to combine a chimeric protein comprising an extracellular PD1 domain comprising A132L and MYD88 as the MY88 would provide enhanced tumor potency, survival and proliferation (Jensen: para 0060, 0110) while the extracellular PD-1 taught by Molnar PD-1 (A132L) would provide sustained binding affinity (Molnar: abstract, page 31, column 2, para 3) thereby allowing for more robust and sustained immune modulatory properties. Applicant contends that Molnar teaches the A132L substitution only in the setting of a soluble PD-1 immunoglobulin fusion protein that binds PD-L1 and PD-L2 and blocks the inhibitory PD-1 pathway as an antagonist. See the abstract of Molnar. The argument is not persuasive. Examiner contends that Molnar explicitly teaches Human PD-1 Extracellular Domain (page 31, para 2.1). Examiner welcomes Applicant to provide the page and paragraph number of the teaching of the A132L substitution only in the setting of a soluble PD-1 immunoglobulin fusion protein. Conclusion Status of claims Claims 70-71, 74-82, 90 are pending and examined on the merits. Claims 83-89 stand withdrawn pursuant to 37 CFR 1.142(b). Claims 1-69, 72-73 are canceled. Claims 70-71, 74-82, 90 are rejected. No claims are in condition for allowance. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ERICA NICOLE JONES-FOSTER whose telephone number is (571)270-0360. The examiner can normally be reached mf 7:30a - 4:30p. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath Rao can be reached at 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ERICA NICOLE JONES-FOSTER/Examiner, Art Unit 1656 /MANJUNATH N RAO/Supervisory Patent Examiner, Art Unit 1656 Appendix A Instant Application SEQ ID NO: 1 vs Noessner et al SEQ ID NO: 23 Query Match 97.6%; Score 559.2; Length 702; Best Local Similarity 98.6%; Matches 564; Conservative 0; Mismatches 8; Indels 0; Gaps 0; Query Match 97.6%; Score 559.2; Length 702; Best Local Similarity 98.6%; Matches 564; Conservative 0; Mismatches 8; Indels 0; Gaps 0; Qy 1 ATGCAGATCCCTCAGGCCCCTTGGCCTGTCGTGTGGGCTGTGCTGCAGCTGGGATGGCGG 60 |||||||| |||||||| |||||||||||||||||||| ||||| ||||||||||||||| Db 1 ATGCAGATTCCTCAGGCTCCTTGGCCTGTCGTGTGGGCCGTGCTCCAGCTGGGATGGCGG 60 Qy 61 CCTGGCTGGTTTCTGGACAGCCCCGACAGACCCTGGAACCCCCCTACATTTTCCCCTGCC 120 ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCTGGATGGTTCCTGGACAGCCCCGACAGACCCTGGAACCCCCCTACATTTTCCCCTGCC 120 Qy 121 CTGCTGGTCGTGACCGAGGGCGACAATGCCACCTTCACCTGTAGCTTCAGCAACACCAGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTGCTGGTCGTGACCGAGGGCGACAATGCCACCTTCACCTGTAGCTTCAGCAACACCAGC 180 Qy 181 GAGAGCTTCGTGCTGAACTGGTACAGAATGAGCCCCAGCAACCAGACCGACAAGCTGGCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GAGAGCTTCGTGCTGAACTGGTACAGAATGAGCCCCAGCAACCAGACCGACAAGCTGGCC 240 Qy 241 GCCTTCCCCGAGGATAGATCTCAGCCCGGCCAGGACTGCCGGTTCAGAGTGACCCAGCTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCCTTCCCCGAGGATAGATCTCAGCCCGGCCAGGACTGCCGGTTCAGAGTGACCCAGCTG 300 Qy 301 CCCAACGGCCGGGACTTCCACATGTCTGTCGTGCGGGCCAGACGGAACGACAGCGGCACA 360 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Db 301 CCCAACGGCCGGGACTTCCACATGTCTGTCGTGCGCGCCAGACGGAACGACAGCGGCACA 360 Qy 361 TATCTGTGCGGCGCCATCAGCCTGGCCCCCAAGGCCCAGATCAAAGAGAGCCTGAGAGCC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TATCTGTGCGGCGCCATCAGCCTGGCCCCCAAGGCCCAGATCAAAGAGAGCCTGAGAGCC 420 Qy 421 GAGCTGAGAGTGACCGAGAGAAGGGCCGAAGTGCCTACCGCCCACCCTAGCCCATCTCCA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GAGCTGAGAGTGACCGAGAGAAGGGCCGAAGTGCCTACCGCCCACCCTAGCCCATCTCCA 480 Qy 481 AGACCTGCCGGCCAGTTCCAGACACTGGTCGTGGGAGTCGTGGGCGGACTGCTGGGATCT 540 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 481 AGACCTGCCGGCCAGTTCCAGACACTGGTCGTGGGAGTCGTGGGCGGCCTGCTGGGATCT 540 Qy 541 CTGGTGCTGCTCGTGTGGGTGCTGGCCGTGAT 572 |||||||||||||||||||||||||||||||| Db 541 CTGGTGCTGCTCGTGTGGGTGCTGGCCGTGAT 572 Appendix B Instant Application SEQ ID NO: 4 vs Jensen et al SEQ ID NO: 100 (PDI TM-MyD88) (Jensen: para 120) Query Match 100.0%; Score 888; Length 1035; Best Local Similarity 100.0%; Matches 888; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCTGCTGGCGGACCTGGCGCTGGATCTGCTGCTCCTGTGTCTAGCACCAGCAGCCTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 148 ATGGCTGCTGGCGGACCTGGCGCTGGATCTGCTGCTCCTGTGTCTAGCACCAGCAGCCTG 207 Qy 61 CCTCTGGCCGCCCTGAATATGAGAGTGCGGCGGAGACTGAGCCTGTTCCTGAACGTGCGG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 208 CCTCTGGCCGCCCTGAATATGAGAGTGCGGCGGAGACTGAGCCTGTTCCTGAACGTGCGG 267 Qy 121 ACACAGGTGGCCGCCGATTGGACAGCTCTGGCCGAGGAAATGGACTTCGAGTACCTGGAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 268 ACACAGGTGGCCGCCGATTGGACAGCTCTGGCCGAGGAAATGGACTTCGAGTACCTGGAA 327 Qy 181 ATCCGGCAGCTGGAAACCCAGGCCGACCCTACAGGACGCCTGCTGGATGCTTGGCAGGGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 328 ATCCGGCAGCTGGAAACCCAGGCCGACCCTACAGGACGCCTGCTGGATGCTTGGCAGGGC 387 Qy 241 AGACCAGGCGCTTCTGTGGGGAGACTGCTGGAACTGCTGACCAAGCTGGGCCGGGACGAC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 388 AGACCAGGCGCTTCTGTGGGGAGACTGCTGGAACTGCTGACCAAGCTGGGCCGGGACGAC 447 Qy 301 GTGCTGCTGGAACTGGGCCCTAGCATCGAAGAGGACTGCCAGAAGTACATCCTGAAGCAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 448 GTGCTGCTGGAACTGGGCCCTAGCATCGAAGAGGACTGCCAGAAGTACATCCTGAAGCAG 507 Qy 361 CAGCAGGAAGAGGCCGAGAAGCCTCTGCAGGTGGCAGCCGTGGATAGCAGCGTGCCAAGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 508 CAGCAGGAAGAGGCCGAGAAGCCTCTGCAGGTGGCAGCCGTGGATAGCAGCGTGCCAAGA 567 Qy 421 ACAGCTGAGCTGGCCGGAATCACCACCCTGGACGATCCTCTGGGCCACATGCCCGAGAGA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 568 ACAGCTGAGCTGGCCGGAATCACCACCCTGGACGATCCTCTGGGCCACATGCCCGAGAGA 627 Qy 481 TTCGACGCCTTCATCTGCTACTGCCCCAGCGACATCCAGTTCGTGCAGGAAATGATCAGA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 628 TTCGACGCCTTCATCTGCTACTGCCCCAGCGACATCCAGTTCGTGCAGGAAATGATCAGA 687 Qy 541 CAGCTGGAACAGACCAACTACCGGCTGAAGCTGTGCGTGTCCGACCGGGATGTGCTGCCT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 688 CAGCTGGAACAGACCAACTACCGGCTGAAGCTGTGCGTGTCCGACCGGGATGTGCTGCCT 747 Qy 601 GGCACCTGTGTGTGGTCTATCGCCAGCGAGCTGATCGAGAAGCGGTGCAGACGGATGGTC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 748 GGCACCTGTGTGTGGTCTATCGCCAGCGAGCTGATCGAGAAGCGGTGCAGACGGATGGTC 807 Qy 661 GTGGTGGTGTCCGACGACTACCTGCAGTCCAAAGAGTGCGACTTCCAGACCAAGTTCGCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 808 GTGGTGGTGTCCGACGACTACCTGCAGTCCAAAGAGTGCGACTTCCAGACCAAGTTCGCC 867 Qy 721 CTGAGCCTGAGCCCTGGCGCCCACCAGAAGAGACTGATCCCCATCAAGTACAAGGCCATG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 868 CTGAGCCTGAGCCCTGGCGCCCACCAGAAGAGACTGATCCCCATCAAGTACAAGGCCATG 927 Qy 781 AAGAAAGAGTTCCCCAGCATCCTGCGGTTCATCACCGTGTGCGACTACACCAACCCCTGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 928 AAGAAAGAGTTCCCCAGCATCCTGCGGTTCATCACCGTGTGCGACTACACCAACCCCTGC 987 Qy 841 ACCAAGTCCTGGTTCTGGACCAGACTGGCCAAGGCCCTGTCTCTGCCT 888 |||||||||||||||||||||||||||||||||||||||||||||||| Db 988 ACCAAGTCCTGGTTCTGGACCAGACTGGCCAAGGCCCTGTCTCTGCCT 1035 Appendix C Instant Application SEQ ID NO: 1 vs Instant Application SEQ ID NO: 10 PNG media_image1.png 964 816 media_image1.png Greyscale
Read full office action

Prosecution Timeline

Apr 05, 2023
Application Filed
Dec 23, 2025
Non-Final Rejection mailed — §103
Mar 23, 2026
Response Filed
May 05, 2026
Final Rejection mailed — §103
Jul 28, 2026
Request for Continued Examination
Jul 29, 2026
Response after Non-Final Action
Sep 17, 2026
Non-Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12643927
ENGINEERED SPIDER SILK PROTEINS AND USES THEREOF
3y 9m to grant Granted Jun 02, 2026
Patent 12600761
METHODS AND COMPOSITIONS FOR PURIFICATION OF TRIMERIC FUSION PROTEINS
3y 1m to grant Granted Apr 14, 2026
Patent 12594308
METHODS OF PREPARING A POSTBIOTIC COMPOSITION
1y 6m to grant Granted Apr 07, 2026
Patent 12590291
METHOD OF INDUCING EXPRESSION OF CALCIUM CHANNEL AND/OR CALCIUM PUMP, AND APPARATUS THEREFOR
3y 11m to grant Granted Mar 31, 2026
Patent 12583886
SLIDING CLAMP-BASED AFFINITY PURIFICATION SYSTEMS, METHODS OF MAKING AND USE THEREOF
4y 9m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
48%
Grant Probability
93%
With Interview (+44.7%)
3y 5m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 79 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month