Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of Group I, and SEQ ID NO: 3 and SEQ ID NO: 7 in the reply filed on 3/16/26 is acknowledged. The traversal is on the ground(s) that there is unity of invention among the groups. This is not found persuasive because no technical feature is a special technical feature, as evidenced by the prior art rejections herein, which evidence lack of inventive step.
The requirement is still deemed proper and is therefore made FINAL.
Duplicate Claim Warning
Applicant is advised that should claims 5 and 9 be found allowable, claims (8 and 17) and claim 19 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).
Claim Objections
Claims 1, 2, 8, 16, 17, and 19 are objected to because of the following informalities:
C. suis is an abbreviation that can have multiple meanings. The full genus should be written out, Cytoisospora suis in each independent claim where the name is recited.
Further, claim 1 has a typographical error in “1 6S”- there is an extra space.
Claim 2 recites “compnsmg” in the second line, which is clearly a typographical error.
Appropriate correction is required.
Claim Interpretation
The following is a quotation of 35 U.S.C. 112(f):
(f) Element in Claim for a Combination. – An element in a claim for a combination may be expressed as a means or step for performing a specified function without the recital of structure, material, or acts in support thereof, and such claim shall be construed to cover the corresponding structure, material, or acts described in the specification and equivalents thereof.
The following is a quotation of pre-AIA 35 U.S.C. 112, sixth paragraph:
An element in a claim for a combination may be expressed as a means or step for performing a specified function without the recital of structure, material, or acts in support thereof, and such claim shall be construed to cover the corresponding structure, material, or acts described in the specification and equivalents thereof.
The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art. The broadest reasonable interpretation of a claim element (also commonly referred to as a claim limitation) is limited by the description in the specification when 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, is invoked.
As explained in MPEP § 2181, subsection I, claim limitations that meet the following three-prong test will be interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph:
(A) the claim limitation uses the term “means” or “step” or a term used as a substitute for “means” that is a generic placeholder (also called a nonce term or a non-structural term having no specific structural meaning) for performing the claimed function;
(B) the term “means” or “step” or the generic placeholder is modified by functional language, typically, but not always linked by the transition word “for” (e.g., “means for”) or another linking word or phrase, such as “configured to” or “so that”; and
(C) the term “means” or “step” or the generic placeholder is not modified by sufficient structure, material, or acts for performing the claimed function.
Use of the word “means” (or “step”) in a claim with functional language creates a rebuttable presumption that the claim limitation is to be treated in accordance with 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph. The presumption that the claim limitation is interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, is rebutted when the claim limitation recites sufficient structure, material, or acts to entirely perform the recited function.
Absence of the word “means” (or “step”) in a claim creates a rebuttable presumption that the claim limitation is not to be treated in accordance with 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph. The presumption that the claim limitation is not interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, is rebutted when the claim limitation recites function without reciting sufficient structure, material or acts to entirely perform the recited function.
Claim limitations in this application that use the word “means” (or “step”) are being interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, except as otherwise indicated in an Office action. Conversely, claim limitations in this application that do not use the word “means” (or “step”) are not being interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, except as otherwise indicated in an Office action.
Claim 1 is being interpreted under 112(f) since the claim sets forth the word “step” and then a function without setting forth any structure, material, or acts for performing the claimed function (i.e. amplification). The specification teaches amplification is performed with a pair of primers, wherein the reverse primer hybridizes specifically to all or a portion of SEQ ID NO: 1.
The specification teaches amplification can be performed using PCR, LCR, TMA, SDA, NASBA.
Therefore, the claim is interpreted as requiring amplifying nucleic acid using a reverse primer that hybridizes to all or a portion of SEQ ID NO: 1, wherein the method is PCR (RT-PCR, qPCR or ligation PCR) LCR, TMA, SDA, or NASBA, or equivalents of this method. See specification p. 3 and p. 5-6.
Claims which depend from claim 1 and do not add any structure material or act are also interpreted under 112(f).
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-7 and 10-15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
It is unclear what is being referred to when the claims recite “within the 16S-23S rRNA ITS region of the mitochondrial genome of C. suis.” The oligonucleotides exemplified in the specification and recited in dependent claims hybridize to sequences known in the prior art as the “ITS1” region, which is identified as genomic sequence between the genes encoding 5.8S rRNA and 18S rRNA, and so it is unclear what the claim means when it refers to these sequences as being within the 16S-23S ITS region of the mitochondrial genome. There is no known sequence of the 16S-23S ITS region of the mitochondrial genome that is identified on the record or that was identified by sequence searching. GenBank KR139985 teaches a genomic sequence that comprises the complement of SEQ ID NO: 3 and comprises instant SEQ ID NO: 7. SEQ ID NO: 3is the complement of nucleotides 522-533 of the GenBank sequence, while instant SEQ ID NO: 7 is the complement of nucleotides 406-426 of the sequence. Nucleotides 406-522 are disclosed in the reference as being in the ITS1 region between 18S ribosomal RNA and 5.8S ribosomal RNA genes, not the 16S-23S ITS region.
In claim 3 it is not clear if the information in parentheses is meant to be a claim limitation.
Claims 4, 5, 6, 7, 9, 10, 11, 12, 14, and 15 recite “preferably” and/or “even more preferably” and/or “such as” limitations. These phrases render the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim 7 is further indefinite when it recites that the forward primer is selected from SEQ ID NO: 7-12, but then recites that “preferably the reverser primer” is SEQ ID NO: 7, since the claim previously identified SEQ ID NO: 7 as a forward primer. Furthermore, SEQ ID NO: 7 does not appear to hybridize to SEQ ID NO: 1 as is required for the reverse primer in claim 2 form which claim 7 depends.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-2, 4, 6, and 10-14 is/are rejected under 35 U.S.C. 103 as being unpatentable over Samarasinghe et al. (Experimental Parasitology 118 (2008) 592–595; cited in IDS) in view of Wang et al. (Letters in Applied Microbiology 2003, 37, 127–132).
Samarasinghe teaches amplifying the ITS-1 rDNA locus of Cystoisospora, including C. suis using a primer that is fully complementary to a portion of SEQ ID NO: 1 and is identical to instant SEQ ID NO: 7. ITSGF primer taught in the reference is identical to instant SEQ ID NO: 7. The primers used by Samarasinghe were single stranded nucleic acids with a length between 5 and 50 bases.
Regarding the limitation of claim 2 that requires the primer to be hybridize to “a portion of” SEQ ID NO: 1. This language is quite broad, and the primer GATCATTCACACGTGGCCCTTG is complementary a “portion” of SEQ ID NO: 1. For example, the primer taught in the reference comprise GGC which would hybridize to CCG within SEQ ID NO: 1.
Samarasinghe teaches extraction and amplification from DNA from pigs (Section 2.1).
Samarasinghe teaches 45 cycles of amplification (Section 2.2).
Samarasinghe teaches restriction fragment analysis of the amplicon and identifies polymorphisms within different species tested (Figure 1). The reference teaches that sequences generated were submitted to GenBank (p. 594). Samarasinghe teaches that C. suis is clearly differentiated from other Cystoisospora based on RFLP (p. 594).
Samarasinghe does not teach amplifying a fragment of the ITS-1 rDNA locus that is less than 400 nucleotides in length.
Wang teaches that ITS regions are useful targets for species specific oligonucleotides because they can vary sufficiently among several plant pathogenic species to allow the construction of unique primer sequences. The reference teaches that the ITS region had previously been used to differentiate the pathogen by RFLP. The reference demonstrates selection of species-specific primers by aligning sequence data using commercial software and selecting primers from within the ITS. The reference teaches selecting a species-specific primer from within ITS1 for each species and then pairing it with a universal primer for species-specific amplification (p. 129, Col 2; Table 1). The reference teaches advantages that because of its rapidness and ease, PCR amplification could be used for species specific detection (p. 131, 2nd col).
Therefore, it would have been obvious to have modified the method taught by Samarasinghe so as to have selected species-specific primer or primers from within the C. suis amplicon for the specific amplicon of the pathogenic C. suis. One would have been motivated to do so to allow for the species-specific detection of the pathogen with rapidness and ease using PCR, as exemplified by Wang. Furthermore, following the teachings of Wang, it would have been obvious to have paired one species specific primer with a universal primer, such as universal Cystoisospora primers taught by Samarasinghe. Since Samarasinghe teaches polymorphic fragments within the 450bp amplicon, selection of primers to align with these polymorphic regions would have necessarily resulted in a method to produce an amplicon of less than 400bp.
Claim(s) 15 is/are rejected under 35 U.S.C. 103 as being unpatentable over Samarasinghe in view of Wang as applied to claims 1-2, 4, 6, and 10-14 above, and further in view of Garibyan et al. (J Invest Dermatol. Author manuscript; available in PMC 2014 July 17; 8 pages).
The teachings of Samarasinghe in view of Wang are given previously in this Office action and are fully incorporated here.
The combined references do not teach detecting the amplicon with a probe, here interpreted in light of the specification as being detection by hybridization to a probe.
Garibyan teaches that real time PCR can be used to detect PCR amplicons by including sequence-specific DNA probes consisting of fluorescent labeled reports in an amplification reaction (page 3).
It would have been obvious to have modified the method taught by Samarasinghe in view of Wang so as to have used probe to detect species specific amplicons as the application of a known technique to achieve a predictable result. One would have been motivated to use the probe to detect the PCR products in order to determine and quantify S. suis in a sample.
Claim(s) 1-14, 16-17, and 19 is/are rejected under 35 U.S.C. 103 as being unpatentable over Samarasinghe in view of Wang as applied to claims 1-2, 4, 6, and 10-14 above, and further in view of GenBank Records having Accessions: EU124685.1, EU124686.1, EU124687.1, EU124688.1, and EU124689.1.
The teachings of Samarasinghe in view of Wang are given previously in this Office action and are fully incorporated here.
While this method teaches amplification using a primer identical to SEQ ID NO: 7, it does not teach amplification using a primer comprising instant SEQ ID NO: 3 (consonant with the election).
Samarasinghe teaches that the sequences of all of the ITS amplicons were deposited in GenBank, and Wang teaches aligning ITS sequences to select species specific primers. Instant SEQ ID NO: 3 is the complement of nucleotides 106-125 of GenBank EU124685.1, which is a portion that has many polymorphisms among the different species. A multiple alignment of all of the disclosed species is given at the end of this Office action.
It would have been obvious to have selected a primer comprising instant SEQ ID NO: 3 from within the C. suis ITS taught by Samarasinghe and disclosed in EU124685.1, since this primer is within a region that is polymorphic among species. An ordinary artisan would have been motivated to do so with a reasonable expectation of success, since: (i) Samarasinghe expressly taught that the ITS was polymorphic among Cystoisospora species, (ii) the complete ITS sequences were disclosed by Samarasinghe and provided in the GenBank Records, and (iii) Wang demonstrated aligning ITS sequences for the express purpose of designing species specific primers, and using a species specific primer with a known universal primer as the other member of the primer pair. The combined teachings of the cited references would have suggested a finite number of possible PCR primer pairs that could be designed from the known Cystoisospora ITS sequence to the ordinary artisan, and, based on the teachings of Wang, the ordinary artisan would have expected predictable results in obtaining and using these oligonucleotides to amplify a fragment of C. suis that was less than 400 nucleotides. Thus, the claimed methods, including those using a primer pair consisting of instant SEQ ID NO: 3 and SEQ ID NO: 7 are free of the prior art.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Juliet Switzer whose telephone number is (571)272-0753. The examiner can normally be reached Monday to Thursday, 8:00 AM-3:30 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at (571)-272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Juliet Switzer
Primary Examiner
Art Unit 1682
/JULIET C SWITZER/Primary Examiner, Art Unit 1682
Alignment of five cited GenBank sequences:
PNG
media_image1.png
625
528
media_image1.png
Greyscale
Prosecution Insights