DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Claims 1, 2, 4-7, 11-23 and 28 in the reply filed on 02/12/2026 is acknowledged.
Claims 3, 8-10, 24, 25, and 27 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention and species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 2/12/2026. Claims 1, 2, 4-7, 11-23 and 28 are examined on the merits.
Priority
Acknowledgment is made of applicant’s claim for foreign priority under 35 U.S.C. 119 (a)-(d). The certified copy has been filed in parent Application No. EP20306200.5, filed on 10/13/2020. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Summary
Claims 1, 2, 4-7, 11-23, and 28 are considered.
Claims 3, 8-10, 24, 25, and 27 are withdrawn.
Claim 26 is cancelled.
Claims 1, 2, 4-7, 11-23, and 28 are rejected.
Claims 12 and 21 are objected.
No claims are allowable.
Claims 18 has allowable subject matter in its dependency.
Claim Objections
Claims 12, and 21 are objected to because of the following informalities:
Regarding Claim 12: Claim 12 currently reads: “The TAP of claim 1 that comprises at 2, 3, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid sequences encoding guide RNA molecule.” This examiner assumes the applicant intends to claim multiple nucleic acid sequences encoding guide RNAs. Furthermore, the applicant recites the value “3” twice. This examiner assumes the applicant intends Claim 12 to read, “The TAP of claim 1 that comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid sequences encoding guide RNA molecules."
Regarding Claim 21: Claim 21 currently reads: “The donor bacterial cell of claim 20 that comprises a copy number of F factors and a copy number of TAPs that comprise an origin transfer of F plasmid.” This examiner assumes the applicant intends Claim 12 to read, “The donor bacterial cell of claim 20 that comprises a copy number of F factors and a copy number of TAPs that comprise an origin of transfer of F plasmid."
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 15 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention: “the spacer sequence is encoded by a nucleic acid sequence selected from Table A.” This office action will detail the rejection in relation to the elected species SEQ ID NO 12, however, the reasons and rejection applies to all of the “spacer sequences” listed in Table A (SEQ ID Nos: 10-24).
The claim recites that SEQ ID No 12 is a spacer but the specification fails to show it performs as a spacer and therefore fails to show possession of the spacer sequence for the following reasons:
1. SEQ ID No 12 fails to align with the OXA48 gene in accordance with known spacer structure and function.
2. Table A contradictorily refers to SEQ ID No 12 as both a primer and a spacer.
3. The application does not show SEQ ID No 12 used as a spacer.
4. The potential PAM site for SEQ ID No 12 is located in a position known in the arts to be problematic.
The specification does not sufficiently address these problems.
Regarding issue 1: CRISPR spacer sequences should not have an overhang on 5’ end.
SEQ ID No 12 is 25 nt long, however only its bases 5-24 align complimentarily to the sense strand of the 5’ end of the OXA48 gene (sense strand bases 17- 36).
SEQ ID No 12 5’ TAGTCACCAAAAACACAGCCGATAG 3’
5' end OXA48 coding region (sense) 5' GCCTTATCGGCTGTGTTTTTGGTGGCAT 3'
Antisense to 5’ end OXA48 coding region 3’ CGGAATAGCCGACACAAAAACCACCGTA 5’
In particular, mismatches in the 5’ region are known to be highly disruptive, “overhangs at 5'-end of gRNA decrease the cleavage activity of SpCas9” and “gRNAs with a precise 5'-end increase the editing efficacy” (Oh. 2022. Biotechnol J. 2022 Jul;17(7)).
Regarding issue 2: Table A identifies SEQ ID No 12 as primer OL715. Despite the wording from page 23, line 31 that alleges “the spacer sequence is encoded by a nucleic acid sequence selected from Table A,” the structure, notably the overhang, of SEQ ID No 12 has hallmarks of a primer. Furthermore, the text immediately below Table A confirms, SEQ ID No 12’s structural design is such that it functions as a primer, “…the nucleic acid sequence encoding for the space[r] sequence is flanked at each end by restriction sites so as to allow the quick cloning...”
Regarding issue 3: The spacer biochemistry and microbiology cited in the instant application is prone to unpredictability and therefore requires evidence of reduction to practice as stated by Khakimzhan, “…a complex dependence of CRISPR-Cas9 binding as a function of the spacer length and complementarity” (Khakimzhan. 2021. Phys Biol. 2021 Jul 2;18(5)). The application does not provide any evidence that SEQ ID No 12 performs as a spacer such that the applicant was in possession of the invention. The applicant alludes to “Using an OXA48 spacer that targets the 5'-end of the blaoxA-48 gene” to construct a TAP (TAP-Cas9-OXA48) and subsequently performs experiments with said construct (Figures 4a-d). While this examiner accepts that the data shown is sufficiently convincing, the applicant fails to precisely point out and describe the construct. More pointedly, the applicant does not identify the spacer used in the construct was SEQ ID No 12 (or any other spacer listed in Table A).
Regarding issue 4: The assumptive PAM site for SEQ ID No 12 is immediately adjacent the terminal matching base and not 3-4 bases downstream as is known in the arts as stated by Doudna, “[Cas9] snips dsDNA 3 bp upstream of the PAM” (Doudna. 2017. Biophysics. 46:505-529.). The presumptive PAM location is so problematic, gRNA vendors warn against such proximity, “…when researchers design a gRNA sequence for their CRISPR experiments, they generally exclude the PAM from the guide RNA. This is especially important for plasmid-based systems (Synthego 2026. https://www.synthego.com).” The applicant’s use of CSTB algorithm’s “NGG-anchored sequences” is not convincing. Furthermore, the applicant does not demonstrate CSTB algorithm specifically identified SEQ ID No 12 nor any other sequence listed in Table A.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 15 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding Claim 15: Claim 15 recites "Table A" in reference to SEQ ID Nos. 10-24. Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted). It would be practical and definite to enumerate each of the 15 SEQ ID Nos listed in Table A.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 17 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Regarding Claim 17: Claim 17 reads, “The TAP of claim 1 that optionally comprises one or more selection marker(s).” Claim 17 is not further limiting due to the inclusion of the clause “optionally.” This phrasing allows the limitation “comprises one or more selection marker(s)” to be non-mandatory and therefore non-limiting. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
The U.S. Court of Appeals for the Federal Circuit indicated that although the requirements of pre-AIA 35 U.S.C. 112, 4 th paragraph, are related to matters of form, non-compliance with pre-AIA 35 U.S.C. 112, 4 th paragraph, renders the claim unpatentable just as non-compliance with other paragraphs of 35 U.S.C. 112 would. See Pfizer, Inc. v. Ranbaxy Labs., Ltd., 457 F.3d 1284, 1291-92, 79 USPQ2d 1583, 1589-90 (Fed. Cir. 2006) (holding a dependent claim in a patent invalid for failure to comply with pre-AIA 35 U.S.C. 112, 4 th paragraph) . Therefore, if a dependent claim does not comply with the requirements of 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4 th paragraph, the dependent claim should be rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4 th paragraph, as unpatentable rather than objecting to the claim.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim Interpretation
Regarding "Targeted-Antibacterial-plasmid (TAP)." This examiner gives patentable weight to the term "Targeted-Antibacterial-plasmid (TAP)" in the preamble (see MPEP 2111.02) and interprets TAP as given the "special definition" in the Detailed Description section of the specifications of the instant application (see MPEP 2111.01). According to the specifications, the TAP targets a cell "so as to modify its phenotype and/or kill it." In particular, the clause "modify its phenotype" will be considered in its broadest reasonable interpretation in accordance to MPEP 2111.
Therefore, all claims referencing TAPs shall be interpreted accordingly. This includes Claims 1, 2, 4-7, 11-23, and 28.
Claims 1, 2, 5, 12, 13, 14, 17, 19, 20, 22, 23, and 28 are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Rodrigue (Rodrigue, Sebastian. 2020 January 16 (published). 2018 July 11 (effectively filed date). WO 2020/010452 A1). The rejection of claim 19 is evidenced by Wang (Wang. 2025. NPJ Antimicrob Resist. 2025 Aug 18;3(1):72.).
Claim 1 is anticipated by Rodrigue et al (Rodrigue, Sebastian. 2020 January 16. WO 2020/010452 A1). Rodrigue teaches a “plasmid, which… harbours… genetic cargo hereby forming the conjugative delivery system” (page 16, line 27) and further teaches the plasmid comprises:
“… an origin of vegetative replication (oriV). ” (page 30, line 26). Therefore, Rodrigue teaches “i) an origin of replication;”
In the same plasmid, Rodrigue continues to teach “… an origin of transfer (oriT).” (page 29, line 28). Therefore, Rodrigue teaches “ii) an origin of transfer;”
Rodrigue further describes their plasmid (genetic cargo) in vivo “...bacteria (such as probiotics) could be engineered to use bacterial conjugation in order to transfer a genetic cargo containing the CRISPR-cas9 RNA-guided nuclease system into a target bacterium” (Page 1, line 26). The engineered “genetic cargo” containing the CRISPR-Cas9 system is synonymous with a nucleic acid sequence encoding a nuclease and a guide RNA. Therefore, Rodrigue teaches “iii) a genetically-engineered nucleic acid sequences encoding fora nuclease and” also therefore teaches “iv) one or more genetically-engineered nucleic acid sequence(s) encoding a guide RNA molecule.”
Finally, Rodrigue teaches the plasmid could be “…used to… delete antibiotic resistance genes or to eliminate pathogenic bacteria” (page 1, line 33). Therefore, Rodrigue teaches “A Targeted-Antibacterial-plasmid (TAP) comprising…” elements i, ii, iii, and iv.
Claim 2 is anticipated by Rodrigue et al. Rodrigue further teaches in Example III, while describing one embodiment of their vectors, using oriVpBBR1, “The 368 bp predicted oriTTP114 was cloned into a broad-host-range plasmid backbone containing a vegetative replication module (oriVpBBR1)” (page 99, line 21). The referenced backbone being pBBR1 plasmid. Therefore, Rodrigue teaches “the origin of replication is an origin of replication of pBBR1 plasmid.”
Claim 5 is anticipated by Rodrigue et al. In further teaching conjugative probiotic (COP), Rodrigue teaches “...bacteria (such as probiotics) could be engineered to use bacterial conjugation in order to transfer a genetic cargo containing the CRISPR-cas9 RNA-guided nuclease system into a target bacterium” (Page 1, line 26). Therefore, Rodrigue teaches “the nuclease is a CRISPR-associated endonuclease.”
Claim 12 is anticipated by Rodrigue et al. Rodrigue further teaches a plasmid with multiple gRNAs, “The complete nucleotide sequence of the cat gene (SEQ ID NO: 87) shows the location of gRNA 1 (SEQ ID NO: 88, light gray), gRNA 2 (SEQ ID NO: 89, gray) and gRNA 3 (SEQ ID NO: 90, dark gray) protospacers and their protospacer-associated motif (PAM) (framed with a solid line) (Figure 21.G)” (page 13, Figure 21 G). Therefore, Rodrigue teaches a TAP of claim 1 that comprises at 2, 3, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid sequences encoding guide RNA molecule .
Claim 13 is anticipated by Rodrigue et al. Rodrigue teaches spacers (crRNA) and trans-activating RNAs via gRNAs, “The gRNA includes, on the same gene transcript, both a CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA).” (page 36, line 6). Therefore, Rodrigue teaches “the guide RNA molecule comprises a spacer sequence and a trans-activating RNA sequence.”
Claim 14 is anticipated by Rodrigue et al. Rodrigue teaches “The COP can be used to deliver a payload that eliminates… the resistance to antibiotics” (Page 103, section 4.2.1). Rodrigue further teaches “When a target sequence is detected, Cas9 catalyzes a double-stranded break into the cell's DNA (Figure 34.C)” (Page 103, section 4.2, line 20). Therefore, Rodrigue teaches “wherein the spacer sequence targets an antibiotic resistance gene or is designed to generate a double-strand break (DSB) in a target sequence.”
Claim 17 is anticipated by Rodrigue et al. Rodrigue explicitly teaches the use of selection markers in the section “Introduction of selection markers in Escherichia coli Nissie 1917 (EcN) strains for conjugation quantification.” (Page 60, line 27). Therefore, Rodrigue teaches “optionally comprises one or more selection marker(s).”
Claim 19 is anticipated by Rodrigue et al. as evidenced by Wang. Rodrigue teaches “The COP system is based on a probiotic cellular chassis delivering a genetic cargo by conjugative transfer.” (Page 16 line 29). Rodrigue further teaches the plasmid pGRG36, “This system used a plasmid, pGRG36, as a vector for the expression of the Tn7 machinery, but also as a backbone for the insertion of a DNA sequence of interest” (page 64, line 3). It is known in the art that low copy plasmids in copy number ranges of 1- 5 as highlighted by Wang, “LCP [low copy plasmid] often present at 1–5 copies per cell…” (Wang 2025). Therefore, Rodrigue teaches “A donor bacterial cell comprising a copy number of the TAP of claim 1 .”
Claim 20 is anticipated by Rodrigue et al. in light of Wang. In further teaching Rodrigue’s conjugative probiotic (COP), Rodrigue teaches “Conjugation is mediated by the transfer machinery encoded by a highly efficient conjugative plasmid…” (page 16, line 32, and Figure 34A). It is known in the art that low copy plasmids exist in copy number ranges of 1- 5 as highlighted by Wang, “LCP often present at 1–5 copies per cell…” (Wang 2025.). Therefore, Rodrigue teaches “a copy number of conjugative plasmids.”
Claim 22 is anticipated by Rodrigue et al. in light of Wang. Rodrigue Further teaches the use of the RP4 plasmid in their example 1 as listed in Table 4 titled “Table 4. Conjugative plasmid selected for this example” (page 66, Table 4) (Rodrigue). Rodriguez additionally teaches embodiments of plasmids comprising the origin of transfer of the RP4 plasmid highlighted by Example 1 and Table 1 listing oriTRP4, “Table 1. List of strains and plasmids used in the Examples” (page 50, Table 1), also see Figure 1C (page 120) (Rodrigue). Therefore, Rodrigue teaches “a copy number of RP4 plasmids and a copy number of TAPs that comprise an origin transfer of RP4 plasmid.”
Claim 23 is anticipated by Rodrigue et al. In further teaching Rodrigue’s conjugative probiotic (COP), Rodrigue teaches “Alternatively, the conjugative bacterial cell of the present disclosure is considered to be a probiotic bacterium since these are, at the very least, not harmful (e.g., not pathogenic) to the subject” (Page 44, line 4). Therefore, Rodrigue teaches “The donor bacterial cell of claim 19 that is non-pathogenic.”
Claim 28 is anticipated by Rodrigue et al. In further teaching Rodrigue’s conjugative probiotic (COP), Rodrigue envisions “the recombinant bacterium can be formulated as a composition (which can be a probiotic composition).” (Page 45, line 9). Therefore, Rodrigue teaches “A composition comprising an amount of the donor bacterial cells of claim 19.”
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Rodrigue as applied to claim 1 above in light of Maneewannakul (Maneewannakul.1996. Molecular Microbiology, 22: 197-205.), and further in view of Fernandez-Lopez (Fernandez-Lopez. 2016. Mol Biosci. 2016 Nov 10;3:71.).
Rodrigue teaches all of the elements of the TAP of Claim 1.
Rodrigue does not teach a COP embodiment where the origin of transfer is the origin of transfer of the F plasmid (oriTF).
However, in the process of developing their COP, Rodrigue does teach the use of origin of transfer of the RP4 plasmid (oriTRP4) in five different plasmids (page 51, Table 1. List of strains and plasmids used in the Examples, Example II & III).
F plasmid’s alternate name is recognized by Rodrigue, “In yet another embodiment, the genes encoding the T4SS can be derived from the bacterial vector F (or pOX38).” (page 25, line 21) and the pOX38 plasmid is simply a derivative of F plasmid as indicated by Maneewannakul, “A derivative of the F plasmid, pOX38–tra715…” (summary) (Maneewannakul 1996).
Additionally, Fernandez-Lopez teaches the benefits of using oriTF, “The F plasmid is the foremost representative of a large group of conjugative plasmids, prevalent in Escherichia coli, and widely distributed among the Enterobacteriaceae. These plasmids are of clinical relevance, given their frequent association with virulence determinants, colicins, and antibiotic resistance genes. Originally defined by their sensitivity to certain male-specific phages, IncF plasmids share a conserved conjugative system and regulatory circuits (Abstract)” (Fernandez-Lopez).
It would have been obvious to a person having ordinary skill in the art (PHOSITA) to have modified the COP of Rodrigue with the “foremost… plasmid” as taught by Fernandez-Lopez to arrive at a TAP wherein the origin of transfer is an oriTF of F plasmid because the modification of Rodrigue by Fernandez-Lopez amounts to the simple substitution of one known element (Rodrigue’s origin of transfer) for another (Fernandez-Lopez’s oriTF) to obtain predictable results. Both Rodrigue and Fernandez-Lopez teach the exploitation of oriTs within conjugative plasmids. Similarly, both Rodrigue and Fernandez-Lopez were familiar with the components of F plasmid, particularly oriTF. Furthermore, a PHOSITA would have been familiar with the value and predictability of substitution of various plasmid components based on their individual needs (expression profile, copy number, etcetera), including oriTs. Therefore, a PHOSITA would have had a reasonable expectation of success replacing the oriTRP4 of Rodrigue with the oriTF of Fernandez-Lopez to arrive at the TAP of claim 1 wherein the origin of transfer is an oriTF of F plasmid.
Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Rodrigue as applied to Claim 5 above, and further in view of Liu (Liu US 2015/0071906 A1).
Rodrigue teaches all of the elements of the TAP of Claim 5.
Rodrigue does not teach a COP embodiment where the CRISPR-associated endonuclease is a Cas9 nuclease comprising the amino acid sequence as set forth in SEQ ID NO: 4.
However, Rodrigue does envision embodiments of different Cas nucleases, “In still a further embodiment, the payload module encodes a nuclease. In yet another embodiment, the nuclease is a clustered regularly interspaced short palindromic repeat (CRISPR) associated DNA-binding (Cas) protein or a Cas protein analog” (page 4, line 28).
Liu teaches the Cas9 nuclease comprising the amino acid sequence as set forth in SEQ ID NO: 4 “Cas9 orthologs have been described in various species, including, but not limited to, S. pyogenes and S. thermos philus. Additional suitable Cas9 nucleases and sequences will be apparent to those of skill in the art based on this disclosure…” and further goes on to cite amino acid SEQ ID 44, which a 100% match to SEQ ID No 4 of the instant application, “…wild type Cas9 corresponds to Cas9 from Streptococcus pyogenes … SEQ ID NO:44 (amino acid)” ([0142]) (Liu US 2015/0071906 A1).
It would have been obvious to PHOSITA to have mimicked Rodrigue’s COP embodiment of a “Cas protein analog” and substituted Liu’s Cas9 nuclease (SEQ ID No 44) to arrive at a the CRISPR-associated endonuclease Cas9 nuclease comprising the amino acid sequence as set forth in SEQ ID NO: 4 because this amounts to a simple substitution of one known element for another to obtain predictable results. Both Rodrigue and Liu teach the exploitative use of the CRISPR associated nuclease (Cas) genes and Rodrigue envisions the substitution of Cas nuclease variants in their COP. Liu’s Cas9 variant, SEQ ID No 44 was known at the time of filing. A PHOSITA would have predicted that replacing Rodrigue’s CRISPR-associated endonuclease SEQ ID No 4 with the Cas9 that has 100% identity match (Liu’s Cas9, SEQ ID 44) would arrive at the TAP of claim 5 wherein the CRISPR-associated endonuclease is a Cas9 nuclease comprising the amino acid sequence as set forth in SEQ ID NO: 4
Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over Rodrigue as applied to Claim 1 above, and further in view of Baltimore (Baltimore US 20170114368), and Minshull (Minshull WO2020231943).
Rodrigue teaches all of the elements of the TAP of Claim 1.
Rodrigue does not teach a TAP wherein the nucleic acid sequence that encodes the nuclease is operatively linked to a weak constitutive promoter.
However, Rodrigue does teach the use of constitutive promoters, “a promoter can be constitutive or inducible. The terms "constitutive" and "inducible" refer to the dynamic state of expression. A constitutive expression is stable overtime whereas an inducible expression allows a significant change in the level of expression of a gene” (page 24, line 22) and Rodrigue even takes advantage of constitutive promoters in their examples, “The promoter of the Bxb1 integrase allows constitutive expression of the Bxb1 integrase.” (page 90, line 21).
Baltimore teaches operatively linking nucleases to promoters, “Optionally, the chimeric nuclease is operably linked to a transcriptional regulatory element such as a promoter” ([0105] (Baltimore US 20170114368).
Minshull teaches linking gene sequences to weak constitutive promoters, “A gene to be expressed from the gene transfer polynucleotide may be included on the same gene transfer polynucleotide as the selectable marker, with the two genes operably linked to different promoters. In this case low expression levels of the selectable marker may be achieved by using a weakly active constitutive promoter…” ([00128]) (Minshull WO2020231943).
It would have been obvious to PHOSITA to have modified the COP of Rodrigue with the operatively linked nuclease promoter as taught by Baltimore and the gene sequence operatively linked to a weakly active constitutive promoter as taught by Minshull to arrive at the nuclease operatively linked to a weak constitutive promoter because the combination of Rodrigue, Baltimore, and Minshull simply amounts to combining prior art elements according to known methods to yield predictable results. Rodrigue, Baltimore, and Minshull are each familiar with methods of plasmid manipulation, specifically, the interchangeable nature of gene expression elements. Each teach the exploitation of independent elements within plasmids, in this case, promoters, expression levels of genes of interest, and how to manipulate expression levels via linkage to various promoters. Furthermore, a PHOSITA would have been familiar with the value and predictability of substitution of aforementioned gene expression elements based on their individual needs (special and temporal control of gene expression), in this instance, nuclease genes operatively linked to constitutive promoters. Therefore, a PHOSITA would have predicted by following the teachings of Rodrigue’s COPs and replacing Rodrigues constitutive promoters with a combination of Baltimore’s operatively linked nuclease promoters, and Minshull’s weakly active constitutive promoter that one would arrive at the TAP of claim 1 wherein a nucleic acid sequence that encodes the nuclease is operatively linked to a weak constitutive promoter
Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over Rodrigue as applied to Claim 1 above, and further in view of Baker (Baker WO 2020185850 A1), and in light of Minshull.
Rodrigue teaches all of the elements of the TAP of Claim 1.
Rodrigue does not teach wherein the RNA molecule is “operatively linked to a strong constitutive promoter.”
However, Rodrigue does teach the use of constitutive promoters, “a promoter can be constitutive or inducible. The terms "constitutive" and "inducible" refer to the dynamic state of expression. A constitutive expression is stable overtime whereas an inducible expression allows a significant change in the level of expression of a gene” (page 24, line 22) and Rodrigue even takes advantage of constitutive promoters in their examples, “The promoter of the Bxb1 integrase allows constitutive expression of the Bxb1 integrase.” (page 90, line 21).
Baker teaches operatively linking gRNA to constitutive promoters, “The composition further comprises a nucleic acid encoding the one or more guide RNAs operatively linked to a suitable control sequence,” (page 3, line 12), and further clarifies control sequences is synonymous with promoter and teaches the CMV constitutive promoter, “The control sequence used to drive expression of the disclosed nucleic acid sequences in a mammalian system may be constitutive ( driven by any of a variety of promoters, including but not limited to, CMV, SV 40, RSV, actin, EF)…” (page 26, line 1) (Baker WO 2020185850 A1).
Minshull teaches linking gene sequences to strong constitutive promoters and CMV is a strong promoter, “Table 5 shows that when the strong CMV or EEF2 promoters are operably linked to the glutamine synthetase gene… Because these promoters are strong…” ([00360] (Minshull).
It would have been obvious to PHOSITA to have modified the gRNA containing COP of Rodrigue with the nucleic acid encoding a gRNA operatively linked to a constitutive CMV promoter as taught by Baker and the teachings of Minshull that CMV is a strong promoter to arrive at the TAP wherein the one or more genetically-engineered nucleic acid sequence(s) that encode a guide RNA molecule are operatively linked to a strong constitutive promoter because the combination of Rodrigue, Baker, and Minshull simply amounts to combining prior art elements according to known methods to yield predictable results. Rodrigue, Baker, and Minshull are each familiar with methods of plasmid manipulation, specifically, the interchangeable nature of gene expression elements. Each teach the exploitation of independent elements within plasmids, in this case, promoters, expression levels of genes of interest, and how to manipulate expression levels via linkage to various promoters. Furthermore, a PHOSITA would have been familiar with the value and predictability of substitution of aforementioned gene expression elements based on their individual needs (special and temporal control of gene expression), in this instance, gRNA genes operatively linked to constitutive promoters. Therefore, a PHOSITA would have a reasonable expectation of success with the gene arrangement of Rodrigue’s gRNA containing COP, Baker’s operatively linked gRNA to constitutive promoters (particularly CMV promoters), and Minshull’s guidance that gene sequences can be linked to strong CMV constitutive promoters to arrive at the TAP of claim 1 wherein the one or more genetically-engineered nucleic acid sequence(s) that encode a guide RNA molecule are operatively linked to a strong constitutive promoter.
Claim 21 is rejected under 35 U.S.C. 103 as being unpatentable over Rodrigue as applied to Claim 20 above, in light of Maneewannakul, and further in view of Fernandez-Lopez,.
Rodrigue further teaches the use of origin of transfer of the RP4 plasmid (oriTRP4) in five different plasmids (page 51, Table 1. List of strains and plasmids used in the Examples, Example II & III). F plasmid’s alternate name is recognized by Rodrigue, “In yet another embodiment, the genes encoding the T4SS can be derived from the bacterial vector F (or pOX38).” (page 25, line 21) and the pOX38 plasmid is simply a derivative of F plasmid as indicated by Maneewannakul, “A derivative of the F plasmid, pOX38–tra715…” (summary) (Maneewannakul 1996).
Also previously discussed, Fernandez-Lopez teaches the benefits of using oriTF, “The F plasmid is the foremost representative of a large group of conjugative plasmids… (Abstract)” (Fernandez-Lopez 2016). Therefore, Fernando-Lopez teaches the copy number of F factors that comprise an origin transfer of F plasmid.
It would have been obvious to a PHOSITA to have followed the teaching of Rodrigue’s F plasmid COP probiotic (in essence, the TAP of the instant application) in light of Maneewannakul, with the added F factors and origin of transfer of the “foremost… plasmid” teachings of Fernandez-Lopez to arrive at the donor bacterial cell that comprises a copy number of F factors and a copy number of TAPs that comprise an origin transfer of F plasmid because the combination of Rodrigue, and Fernandez-Lopez, amounts to the simple substitution of one known element (Rodrigue’s copy number of F plasmid containing COPs) for another (Fernandez-Lopez’s oriTF and F factors) to obtain predictable results. Both Rodrigue and Fernandez-Lopez teach the exploitation of oriTs within conjugative plasmids. Similarly, both Rodrigue and Fernandez-Lopez were familiar with the components of F plasmid, particularly oriTF. Furthermore, a PHOSITA would have been familiar with the value and predictability of substitution and combination of various plasmid components based on their individual needs (special and temporal expression profile, copy number, conjugative ability, etcetera), including oriTs and F factors. Therefore, a PHOSITA would have had a reasonable expectation of success replacing the oriTRP4 of Rodrigue with the oriTF of Fernandez-Lopez to arrive at the donor bacterial cell of claim 20 comprising a copy number of F factors and a copy number of TAPs wherein the origin of transfer is an oriTF of F plasmid. Therefore, a PHOSITA would have a reasonable expectation of success modifying the bacterial cell of Rodrigue, and their F plasmid, with the known copy numbers of F factors and origin of transfer of F plasmid of Fernandez-Lopez.
Allowable Subject Matter
Claim 18 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Regarding Claims 18: Rodrigue teaches all of the elements of the TAP of Claim 1. Rodrigue teaches cloning plasmid construction in their Example 1, “Details on strain growth conditions, DNA manipulation, plasmid construction, recombineering and routine transformation can be found in the Material and Method section of the Example I.” (page 90, line 7, Example I, page 50).
SEQ ID Nos 27 and 28 are cloning plasmids encoding a Cas9 and defective Cas9 (dCas9) respectively.
Hoge teaches a cloning plasmid (SEQ ID No 110) that matches 55.3% and 55.4% identity respectively over SEQ ID Nos 27 and 28 with both over 99% identity match within the regions of nucleotides 2093- 6319, and 7380-7481 (Hoge US 2016/0367702 A1). The overlapping matching regions are portions of Cloning vector CRISPRi pRG_dCas9, complete sequence (blast.ncbi.nlm.nih.gov/Blast.cgi). Additionally, the region of nucleotides 1-2092 of SEQ ID Nos 27 and 28 map 99% to Escherichia coli strain Esc9 genome assembly, plasmid: 5 (blast.ncbi.nlm.nih.gov/Blast.cgi).
The prior art failed to teach the SEQ ID Nos 27 and 28, nor did the prior art show any obvious reasons to combine Hoge with other art to arrive at the referenced sequences. Therefore, Claim 18 as written in its dependency to include the limitations of Claim 1 has allowable subject matter.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AARON DUREL WARD whose telephone number is (571)272-8495. The examiner can normally be reached Monday to Thursday 8:00AM 6:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 15712705919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AARON DUREL WARD/ Examiner, Art Unit 1636
/NEIL P HAMMELL/ Supervisory Patent Examiner, Art Unit 1636