DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims Status
Applicant’s election with traverse of Group I (claims 1-13) and the species of (a) a CAR comprising SEQ ID NO: 7. (b) the immune cell is a T cell, and (c) the synthetic antigen is genetically encoded by SEQ ID NO: 11, in the reply filed on 27Jan2026 is acknowledged.
Claim(s) 3, and 14-24 is/are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on27Jan2026.
Claim(s) 1-2, and 4-13 is/are currently pending and presented for examination on the merits.
Specification
The use of trade name(s) or mark(s) used in commerce (e.g., Jackson Laboratory, Life Technologies, Addgene, Thermo Fisher, Genscript, Takara, Biolegend, Hiscribe, nanobody), has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claims 4 and 8 are objected to because of the following informalities: “anti-respiratory syncytial virus (RSV) F glycoprotein (RSV-F)” should be “anti-respiratory syncytial virus . Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claim(s) 2, 4-13 is/are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim(s) 2, 4-13 recites the limitation "the chimeric antigen receptor system”. There is insufficient antecedent basis for this limitation in the claim (as claim 1 recites a “synthetic antigen-chimeric antigen receptor system”). For the purposes of compact prosecution claim(s) 2, 4-13 is/are considered to recite “the synthetic antigen-chimeric antigen receptor system”. This rejection may be overcome by amending claim(s) 2, 4-13 to provide proper antecedent basis.
Claim(s) 4, 8 contain the trademark/trade name “nanobody”. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify and/or describe a VHH single domain antibody and, accordingly, the identification/description is indefinite. This rejection can be overcome by amending claim(s) 4, 8 to replace the phrase “nanobody (VHH)” with the generic phrase “VHH single domain antibody” or “VHH antibody”.
Regarding claim(s) 11, the phrase " [the synthetic antigen-chimeric antigen receptor system (see rejection above)] of claim 1, further comprising an immune cell" renders the claim indefinite. Specifically, instant claim 1 recites that the system comprises “a synthetic antigen and a chimeric antigen receptor (CAR) that targets said antigen”, and the specification does not explicitly define the system but does provide “Disclosed are…compositions related to synthetic antigens and chimeric antigen receptors targeting said antigens” [e.g., pg. 1, lines 25-26]. Given the above, the BRI is considered to be that the system comprises (i) a CAR construct and (ii) a synthetic antigen, neither of which have the ability to “further comprise an immune cell”. For the purposes of compact prosecution, claim 11 is considered to read “An immune cell, further comprising the CAR of claim 1”. This rejection may be overcome by amending claim 11 (1) as recited above, or (2) to otherwise clearly recite the invention.
Claim(s) 12-13 recites the limitation "the immune cell" in line 2 (both claims 12-13). There is insufficient antecedent basis for this limitation in the claim. For the purposes of compact prosecution claims 12-13 are considered to depend from claim 11 to provide proper antecedent basis. This rejection may be overcome by amending claim(s) 12-13 to provide proper antecedent basis.
Claim Rejections - 35 USC § 112(a)
Claim(s) 4 and 8 is/are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claimed Invention
Claim(s) 4, is/are drawn to a nanobody (VHH antibody) that binds RSV-F antigen.
Claim(s) 8, is/are drawn to a chimeric antigen receptor (CAR) that binds to an anti-RSV-F VHH antibody (hereinafter “aVHH” antigen).
Breadth of Claims
The invention as disclosed in claim(s) 4 recites “…wherein the synthetic antigen comprises…anti-respiratory syncytial virus(RSV) F glycoprotein (RSV-F) nanobody (VHH)…”. One of ordinary skill in the art would understand that the 3 CDRs of a VHH antibody antigen binding domain are responsible for antigen binding characteristics, including antigen specificity and recognition. The claim does not disclose the structure associated with the claimed function. The instant disclosure does not provide a structure-function correlation that would allow for a person of ordinary skill in the art to envision all of the possible VHH antibody sequences, particularly in the CDR regions, such that the obtained structure would result in the claimed functions.
The invention as disclosed in claim(s)8 recite(s) “…[the CAR] (scFv) that specifically binds…anti-respiratory syncytial virus (RSV) F glycoprotein (RSV-F) nanobody (VHH)…”. One of ordinary skill in the art would understand that the 6 CDRs of an antibody or CAR antigen binding domain are responsible for antigen binding characteristics, including antigen specificity and recognition. The claim does not disclose the structure associated with the claimed function. The instant disclosure does not provide a structure-function correlation that would allow for a person of ordinary skill in the art to envision all of the possible light and heavy chain sequences, particularly in the CDR regions, such that the obtained structure would result in the claimed functions.
Scope of Disclosed Species
The anti-RSV-F VHH antibody of SEQ ID NO: 11 in the Applicant disclosure with 100% sequence identity in the CDR regions thereof represents the anti-RSV-F VHH antibody that the Applicant was in possession of at the time of filing.
The aVHH-directed CAR(s) of SEQ ID NO: 7 in the Applicant disclosure with 100% sequence identity in the CDR regions of the heavy and light chain variable regions represents the aVHH-directed CAR(s) that the Applicant was in possession of at the time of filing.
State of the Prior Art
VHH antibodies
At the time of filing, VHH antibody antigen binding domain functionality was known to depend on the entire structure, particularly a full complement of three CDRs. It is understood by one of ordinary skill in the art that that mutation to CDRs is unpredictable and that each construct requires function testing.
Bever et al. (Anal Bioanal Chem (2016) 408:5985–6002; hereinafter “Bever”) teaches VHH antibodies, and the production and screening thereof [e.g., title, abstract]. Bever teaches Nanobodies® are VHH domain antibodies that are heavy chain only (e.g. HcAb) that are naturally produced by camelids and sharks [e.g., pg. 5985, “Introduction”]. Bever teaches the overview of process of making VHH antibodies wherein (1) an alpaca is the camelid species, (2) mRNA is collected from the alpaca and a cDNA library is constructed therefrom, (3) VHH genes are isolated, (4) a phage-display VHH library is generated, (5) solid phase panning conducted to select the desired VHH, and (6) desired VHH is obtained [e.g., fig. 2].
Hacisuleyman and Erman (Journal of Biological Physics (2020) 46:189–208; hereinafter “Hacisuleyman”) teaches VHH optimization [e.g., title, abstract]. Hacisuleyman teaches VHH antibodies comprise 3 CDRs which determine target specificity, with CDR3 being the “dominating contributor in antigen recognition” [e.g., pg. 191; fig. 2]. Hacisuleyman further teaches residue numbers for the VHH CDRs may vary, and that in nature CDRs are mutated naturally to increase the binding affinity and specificity towards a target antigen [e.g., pg. 191]. Hacisuleyman teaches that computational screening methods for optimization are a first step that is then followed by experimental strategies [e.g., pg. 191]. Hacisuleyman does not support de novo generation of VHH CDRs to bind a selected antibody, but rather requires the researcher start with a VHH antibody known to bind the target antigen [e.g., 191].
At the time of filing, Detalle et al. (American Society for Micro, Jan 2016, Vol. 60, Issue 1; hereinafter “Detalle”) taught one species of anti-RSV-F nanobodies were known in the art and the generation of a novel anti-RSV-F nanbody [e.g., title, abstract; Discussion]. Therefore, the prior art demonstrates that the binding of RSV-F is possible by various VHH antibodies. The prior art does not teach a known structure activity relationship for CDR1-3 in anti-RSV-F VHH antibodies that would allow prediction of all of the possible combinations of CDR residues that specifically bind to RSV-F antigen.
Classical Antibodies (e.g., scFv domain of instant claimed CAR)
At the time of filing, antibody and/or CAR(s) antigen binding domain functionality was/were known to depend on the entire structure, particularly a full complement of six CDRs. It is understood by one of ordinary skill in the art that that mutation to CDRs is unpredictable and that each construct requires function testing.
Sela-Culang, Kunik, and Ofran (Fron. Immuno., Vol. 4, Article 302, Oct. 2013), hereinafter “Sela-Culang”, reviews the structural basis of antibody-antigen recognition in the state of the art. Naturally occurring antibodies have six hypervariable loops are commonly termed complementary determining regions (CDRs) and are widely assumed to be responsible for antigen recognition [e.g., pg. 1, abstract; pg. 3, “The Role of CDRs and their Definition”]. A person of ordinary skill in the art would understand that although the above basics of antibody-antigen binding are known, that the specifics of antibody structure (e.g., within the CDRs) that underlie the antigen recognition are not well characterized [e.g., pg. 1, “The Motivations for…”].
Further, Herold et al. (Nature Scientific Reports, 7:12276, 25 Sep 2017), hereinafter “Herold”, teaches that it should be emphasized that there is no correlation between experimentally determined change in antibody binding affinity and a given mutation and additionally that no such correlation is expected because antigen binding is “affected by each CDR loop differently” and changes thereto “can in principle affect antigen binding affinity in an unpredictable way” [e.g., pg. 14, ¶ 2]. Further, Herold asserts that multiple determinants regulate antigen affinity and the interactions with CDRs are complex [e.g., pg. 14, ¶ 3].
At the time of filing, SynAbs (Innovative anti-VHH antibodies: SynAbs enters the nano-World, 10Jun2019; hereinafter “SynAbs”) taught that more than one species of anti-VHH antibodies were known in the art, and further that novel species of anti-VHH antibodies can be developed by SynAbs to meet customer needs [e.g., pgs. 1-4]. Therefore, the prior art demonstrates that the binding of VHH antibodies is possible by various antibodies. The prior art does not teach a known structure activity relationship for HCDR1-3 and LCDR1-3 in anti-VHH antibodies that would allow prediction of CDR residues that specifically bind to VHH antibodies/antigen.
Summary
Thus, making changes to the CDR sequence of (1) a VHH antigen binding domain sequence, or (2) a classical antibody antigen binding domain of a CAR sequence is a highly unpredictable process and one skilled in the art could not a priori make any predications regarding such mutations with any reasonable expectation of success nor envisage the breadth of structurally unrelated CDR combinations that would still possess the required function(s).
Conclusion
As indicated by the art, a full complement (1) 3 CDRs of a VHH antibody, or (2) 6 CDRs of a classical CAR antigen binding are required and one cannot predict which CDR residues may be changed and still result in (1) a VHH antibody that binds RSV-F antigen, or (2) a classical antibody binding domain of a CAR that binds aVHH antigen. Written description can be met if the claims recite the minimal structure that is needed to perform the function recited in the claims. Above, the art indicates that the (1) 3 CDRS of a VHH antigen-binding domain, or (2) 6 CDRs in a CAR antigen-binding domain are the minimal structure that binds to a target antigen. Specifically, (1) claim(s) 4 would minimally need to recite the 3 CDRs of the VHH (or could recite the entire VHH sequence) that bind RSV-F, without variability in the CDR sequences thereof; and (2) claim(s) 8 would minimally need to recite the 6 CDRs in the CAR(s) that bind to the aVHH antigen, without variability in the sequences thereof.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claim(s) 1, 10-13 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by US 2013/0287752 A1 (hereinafter “US752”).
Regarding instant claim(s) 1, 11, 13, US752 teaches a universal synthetic antigen-chimeric antigen receptor system comprising CAR T cells and a synthetic antigen (e.g., “AT”), and uses thereof in cancer therapy [e.g., title, abstract; ¶ 0006-0022, 0029, 0063].
Regarding instant claim(s) 10, 12, US752 teaches the immune cells are transfected or transduced with the universal CAR construct [e.g., ¶ 0043-0044, 0074-0075]. US752 further teaches retroviral transduction of T cells with a CAR construct [e.g., ¶ 0074-0075].
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 2, 6-7 is/are rejected under 35 U.S.C. 103 as being unpatentable over US 2013/0287752 A1 (hereinafter “US752”) as applied to claim(s) 1 above, and further in view of WO 2021/234694A1 (hereinafter “WO694”).
The teachings of US752 as recited above are applied for claim 1.
US752 does not expressly teach (1) fusogenic liposome delivery of synthetic antigen encoding mRNA.
Regarding instant claim(s) 2, 6-7, WO694 teaches lipid particles for Nucleic Acid Delivery comprising cationic lipid (e.g., Fusogenic lipids) encapsulating a nucleic acid sequence [e.g., title, abstract; ¶ ; fig. 1A]. WO694 further teaches the nucleic acid sequence is mRNA [e.g., pg. 29, lines 6-11]. WO694 further teaches that the invention may be used to engineer cancer cells to produce exogenous protein that is beneficial for treatment (e.g., synthetic target antigens) [e.g., pgs. 4, 37-38, 63; examples 2, 4].
It would have been prima facie obvious to a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to combine the synthetic antigen-CAR system as taught by US752, with the fusogenic liposome delivery of mRNA taught by WO694, in the context of designing and developing a synthetic antigen-CAR system for cancer therapy. A PHOSITA would have been motivated to combine the synthetic antigen-CAR system as taught by US752, with the fusogenic liposome delivery of mRNA taught by WO694, because both US752 and WO694 teach applicability in cancer therapy, US752 teaches the base system for cancer therapy comprising a synthetic antigen target and WO694 teaches engineering cancer cells to express exogenous constructs that are beneficial for cancer therapy (e.g., synthetic target antigens). There would have been a reasonable expectation of success for a PHOSITA to combine the synthetic antigen of the synthetic antigen-CAR system as taught by US752, with the fusogenic liposome delivery of mRNA as taught by WO694 because US752 teaches the base structure comprising CAR T cells and synthetic antigen targets, and WO6994 teaches methods of engineering cancer cells to express exogenous mRNA. This rationale aligns with the principle of applying a known technique to a known method to yield predictable results, supporting a conclusion of obviousness (see MPEP § 2143).
Thus, the invention as a whole is prima facie obvious over the references, especially in the absence of evidence to the contrary.
Free From the Prior Art
During the course of examination, the anti-RSV-F nanobody synthetic antigen comprising SEQ ID NO: 11 was found to nonobvious over the prior art. Briefly, a sequence search of the prior art returned no 100% matches to the instant claimed anti-RSV-F nanobody sequence, and no rationale was found in the prior art to arrive at the instant invention of SEQ ID NO: 11 (see closest prior art alignment below).
Alignment of synthetic antigen (SEQ ID NO: 11) with WO2016203052-A1 (Anti-CD22 CAR construct, SEQ 15399):
Query Match 28.5%; Score 203.2; Length 396;
Best Local Similarity 72.0%;
Matches 265; Conservative 0; Mismatches 103; Indels 0; Gaps 0;
Qy 100 CAGGTACAGTTGCAGGAGTCCGGAGGTGGTCTGGTACAACCAGGTGGATCCCTCAGATTG 159
||||| ||| |||||||||| || || || |||| || || || || || || ||| |
Db 1 CAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCTCTGAGACTC 60
Qy 160 TCTTGTGCAGCTAGTGGCTTTACGCTCGACTACTATTATATCGGGTGGTTTCGGCAAGCA 219
|| |||||||| ||| || || | || || ||||| || || ||||| || || ||
Db 61 TCCTGTGCAGCCTCTGGATTCACTTTGGATTATTATTACATAGGCTGGTTCCGCCAGGCC 120
Qy 220 CCGGGTAAAGAGAGGGAGGCTGTTAGCTGTATCAGCGGCTCTTCAGGGTCCACGTATTAC 279
|| || || ||| | ||||| || ||||| || || | || ||| || ||
Db 121 CCAGGGAAGGAGCGCGAGGCAGTCTCATGTATTAGTGGTAGTAGTGGTAGCACATACTAT 180
Qy 280 CCTGACAGTGTTAAAGGGAGATTTACCATATCCCGCGATAACGCAAAGAACACTGTGTAC 339
|| ||| || || || |||| ||||| ||| | || || || |||||||| |||||
Db 181 CCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACGGTGTAT 240
Qy 340 TTGCAGATGAATAGCCTGAAGCCCGAGGACACAGCCGTTTACTACTGTGCCACGATTCGC 399
|||| ||||| |||||||| || |||||||| |||||||| |||||||| || |||||
Db 241 CTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGTGCGACAATTCGT 300
Qy 400 TCCTCTTCATGGGGAGGATGCGTTCATTACGGGATGGATTACTGGGGCAAAGGCACTCAG 459
| ||||| || ||||| || ||||| ||||| |||||||||||||| || |||
Db 301 AGTAGTAGCTGGGGGGGTTGCGTGCACTACGGCATGGACTACTGGGGCAAAGGGACCCAG 360
Qy 460 GTGACGGT 467
|| || ||
Db 361 GTCACCGT 368
Conclusion
No claims are currently allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMY M CHATTIN whose telephone number is (571)270-0646. The examiner can normally be reached T-F 0600-1600 PST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Julie Wu can be reached at (571) 272-5205. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY M. CHATTIN/Examiner, Art Unit 1643
/JULIE WU/Supervisory Patent Examiner, Art Unit 1643