Prosecution Insights
Last updated: April 19, 2026
Application No. 18/032,329

PEPTIDE-BASED TRANSDUCTION OF NON-ANIONIC POLYNUCLEOTIDE ANALOGS FOR GENE EXPRESSION MODULATION

Non-Final OA §103§112§DP
Filed
Apr 17, 2023
Examiner
VANHORN, ABIGAIL LOUISE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Feldan Bio Inc.
OA Round
1 (Non-Final)
47%
Grant Probability
Moderate
1-2
OA Rounds
3y 7m
To Grant
69%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allow Rate
557 granted / 1191 resolved
-13.2% vs TC avg
Strong +22% interview lift
Without
With
+21.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
78 currently pending
Career history
1269
Total Applications
across all art units

Statute-Specific Performance

§101
1.1%
-38.9% vs TC avg
§103
42.6%
+2.6% vs TC avg
§102
9.9%
-30.1% vs TC avg
§112
23.1%
-16.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1191 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION Election/Restrictions Applicant's election with traverse of Group I, SEQ ID No: 35 and phosphorodiamidate morpholino oligomers in the reply filed on December 30 2025 is acknowledged. The traversal is on the ground(s) that unity of invention exists. Del’ Guidice is directed to the delivery of polypeptide cargos. It is argued that Del’ Guidice does not teach delivery of cargos other than polypeptide cargos. None of the experimental results provided relate to the delivery of non-anionic polynucleotide analog cargoes. It was unexpected that synthetic peptide shuttle agents could be used of transducing non-anionic polynucleotide analog cargoes. Del’ Guidice teaches away from the delivery of polynucleotides (that are not precomplexed to polypeptide cargoes). Example 7 of Del’ Guidice explicitly teaches away from the delivery of polynucleotides. This is not found persuasive because Applicants are arguing many features that not required in the instant claims. The composition only requires a non-anionic polynucleotide analog and a synthetic peptide shuttle agent. Nothing in the claim requires the cargo to be 1) encapsulated or part of the shuttle agent, in fact, the claim expressly states that the shuttle agent is independent from the cargo; 2) nothing in the claim excludes the polynucleotide from being together with a polypeptide cargo which is included in a synthetic peptide shuttle agent. Regarding the unexpected results, the examiner cannot agree. Firstly instant claim 35 recites “sufficient to increase transduction efficiency and cytosolic delivery of the non-anionic polynucleotide analog cargo as compared to the absence of the shuttle agent”. Example 7 of Del’ Guidice expressly states that CM18-TAT-CYS enables intracellular plasmid DNA delivery but poor plasmid expression. It states that: FIG. 20 show that CM18-TAT-Cys was able to increase the intracellular delivery the plasmid DNA when used at 0.05, 0.5 and 5 μM concentrations, as compared to cell incubated with DNA alone (aka without shuttle agent). Therefore, this meets the requirements of the claims that there is an increase in transduction efficiency and cytosolic delivery compared to absence of the shuttle agent. While the increase might be less than with polypeptide cargo, this does not equate to the peptide shuffle agent not being beneficial to increase delivery. Furthermore, as set forth above additional polypeptide cargos are not excluded by the instant claims The requirement is still deemed proper and is therefore made FINAL. Claims 35-52 and 54 are pending in the application. Based on discovered prior art the species of peptide shuttle agent has been expanded to include HA2-Penetratin and EB1 as well as the sequences set forth in WO 2018/058135. Claims 51-52 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on December 30 2025. Accordingly, claims 35-50 and 54 are being examined on the merits herein. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority This application is a 371 of PCT/CA2021/051458 (10/18/2021) which claims benefit of 63/104,263 (10/22/2020) and claims benefit of 63/093,295 (10/18/2020). Information Disclosure Statement The information disclosure statements (IDS) submitted on October 11 2024 and December 30 2025 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Drawings The drawings are objected to for the following reasons: 37 CFR 1.84 (u)(1) states “Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.” In the current case, the view numbers for the partial views for Figure 5 that appear on several sheets are followed by "Cont." instead of a capital letter such as FIG. 1A, FIG. 1B, etc. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code, specifically pages 12-14 and 48. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Claim Objections Claim 48 is objected to because of the following informalities: the claim recites various abbreviations such as GALA; PEA; INF-7: LAH4: HGP: H5WYG; HA2; EB1; BSVG; KALA; JST-1; C(LLKK)3C; G(LLKK)3G; TAT; PTD4; Pvec M918; Pep-1; Pep-2, SynB1; SynB3. The acronyms are not defined in the claims. When an acronym is used in a claim set, it should be defined the first time it appears in the claims. This is especially important to distinguish amino acid sequences from other compounds which happen to include a name which would correspond to an amino acid sequence Appropriate correction is required. Claim 45 is objected to because of the following informalities: in part (i) it appears a word is missing between “sequence” and “any”. Currently the claim is ungrammatical. Appropriate correction is required. Claim Rejections - 35 USC § 112-Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 35-50 and 54 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 35 as currently written is vague and indefinite. The claim recites “any combination of the amino acids” in parts (8), (9), (10), (11), (12), (13) and (15). The instant specification provides no limiting definition of “any combination of”. The plain meaning of the claim would appear to suggest at least two of the amino acids recited are required. However, (11), (12) and (13) only recite two amino acids. But still include any combination of the amino acids. This creates confusion as to the scope as “any combination of the amino acids: A and L”, for example, can only have one combination with is A and L but it is still preceded by the recitation any combination of. Therefore, it isn’t clear the minimum number of amino acids which need to be present. The same language appears in claims 41. Claim 35 as currently written is vague and indefinite. The claim recites “wherein at least six of the following parameters (5) to (15) are respected”. Parameter (8) recites the peptide is composed of 35% to 65% of any combination of the amino acids: A, C, G,I, L, M, F, P, W, Y, and V; parameter (10) recites the peptide is composed of 35% to 85% of any combination of the amino acids: A, L, K, or R; parameter (11) recites the peptide is composed of 15% to 45% of any combination of the amino acids: A and L, provided there being at least 5% of L in the peptide; parameter (12) recites the peptide is composed of 20% to 45% of any combination of the amino acids: K and R; and parameter (15) recites the peptide is composed of 10% to 45% of any combination of the amino acids: Q, Y, W,P, I, S, G, V, F, E, D, C, M, N, T and H. When taken together the lower limit of all of these parameter is greater than 100 (i.e. corresponds to 115%). This creates uncertainty as to 1) how many parameters can actually be chosen from 5 to 15 and which ones can be selected. Since these parameters dictate the structure of the peptide, they are critical to understanding the scope of what can and cannot be included in the peptide. Claim 40 is also indefinite for the same reasons as option (a) recites “all of parameters (5) to (15)” are present. Claim 40 as currently written is vague and indefinite. Claim 40 depends from claim 35. Claim 35 recites: an amphipathic alpha-helical motif having (3) a positively-charged hydrophilic outer face comprising: (a) at least two adjacent positively- charged K and/or R residues upon helical wheel projection; and/or (b) a segment of six adjacent residues comprising three to five K and/or R residues upon helical wheel projection, based on an alpha helix having angle of rotation between consecutive amino acids of 100 degrees and/or an alpha-helix having 3.6 residues per turn. Claim 40 appears to broaden the scope of the amphipathic alpha-helical motif as it recites: e) said amphipathic alpha-helical motif comprises a hydrophobic outer face comprising: (i) at least two adjacent L residues upon helical wheel projection; and/or (ii) a segment often adjacent residues comprising at least five hydrophobic residues selected from: L, I, F, V, W,and M, upon helical wheel projection, based on an alpha helix having angle of rotation between consecutive amino acids of 100 degrees and/or an alpha-helix having 3.6 residues per turn. The scope of the resides recited in (a) and (b) of claim 35 are different than (i) and (ii) of claim 40. Nothing in claim 40 indicates these are additional residues to what is recited in claim 35. Claim 40 recites “the amphipathic alpha-helical motif” referring back to the amphipathic alpha-helical motif of claim 35. Therefore, the scope of the structure of the motif is not clear. Claim 40 as currently written is vague and indefinite. The claim recites in (j) “any combination of (a) to (i). The recitation in (h) of a shuttle agent has a predicted net charge of between +3 is broader in scope than parameter (6) of claim 35 which recites the peptide has a predicted net charge of at least +4. Since the scope of “any combination” would include both parameters, the scope of the “predicted net charge” is unclear. The examiner notes while parameter (6) refers to the peptide and (h) refers to a shuttle agent, these are both referring to the same “synthetic peptide shuttle agent”. Claim 40 as currently written is vague and indefinite. The claims recite any combination of (a) to (i). The recitation (a) is referring to the parameters in claim 35. But parameters (b) to (i) appear to be limitations which further limit the parameters in claim 35. But a combination of them would require two different limitations of the same parameter. For example, parameter (5) in claim 35 states the peptide (aka the synthetic peptide shuttle agent) has a hydrophobic moment of 3.5 to 11 but parameter (g) in claim 40 sates the shuttle agent has a hydrophobic moment between a lower limit of 4.0 and an upper limit of 10.5. Therefore, it makes it unclear what is the structure of the claimed composition as the scope of the hydrophobic moment, for example, would be unclear. Claim 41 as currently written is vague and indefinite. As claimed the shuttle agent respect at least one, at least two….or all of the following parameters. Firstly, this claim depends from claim 35 which already recites parameters the shuttle agent must respect. It isn’t clear if these are additional parameters or limiting those parameters. Additionally (8), (9), (10), (11), (12), (13) and (15) all recite the shuttle agent is composed of a particular concentration of combination of amino acids. When added, the lower limit of all the claims is greater than 100%. Therefore, it isn’t clear how there can be at least seven or all of the following parameters can be met. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 44 recites the broad recitation Leu, Phe, Trp, IIe, Met, Tyr or Val, and the claim also recites preferably Leu, Phe, Trip or lle, which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. The recitation “or other intracellular delivery moiety” in claims 39 and 54 are indefinite. The claims already refer to cell-penetrating peptides and octa-guanidine dendrimer, which while broad, are not indefinite. However, the claim goes on to recite “other intracellular delivery moiety” but not indicate the structure of these moieties. The instant specification fails to indicate any species which would fall within the scope of “other”. Claim 43 as currently written is vague and indefinite. The claim recites the shuttle agent comprises a flexible linker domain rich in serine and/or glycine residues. The term “rich in” in claim 43 is a relative term which renders the claim indefinite. The term “rich in” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Claim 44 indicate that the linker can be -Gn- or -Sn- wherein n can be 1. It isn’t clear if a linker “rich in serine and/glycine” means that there only needs to be one glycine or one serine present or if they can be the ONLY amino acids present. Claim 44 as currently written is vague and indefinite. The claim recites formulas such as [X1]-[X2] (formula 15) or [X2]-[X1] (formula 16). As recited in the claim [X1] can be, for example, 2[Φ]-1[+]-2[Φ]-1[ζ]-1[+]-. The examiner interprets the 2 before the symbol, for example, as meaning that there are two of those amino acids which are then connected to one amino acid which corresponds to the +. As shown below: the arrow is pointing to the point of attachment to the next portion of the molecule: PNG media_image1.png 86 327 media_image1.png Greyscale . This point of attachment makes sense when [X1] is the first group in the formula like in formula 15. But it isn’t clear how X1, for example, is connected when it is connected second (like formula 1) or in the middle (like formula 13). Can be attached at either end? Is it still attached at the end pointed to by the arrow above such as the sequence is in reverse? Since how the groups are connect has a direct correlation to the sequence of the shuttle agent, the scope of how they are attached must be clear. This issue occurs with all of X1, X2, X3 and X4. The linker is indefinite because all of the option include the “-“ at both ends of the sequence. However, formulas such as (i) start with the linker. Thus it would be connected to nothing at one of the ends. Therefore, it isn’t clear what sequence is required. Claim 45 as currently written is vague and indefinite. While individually (i), (ii), (iii) and (iv) are not indefinite. The recitation (v) indicates “any combination” of (i) to (iv). This makes the claim indefinite. It is unclear what is mean when the (i) to (iv) are combined. Does that mean there are more than one shuttle agents present (i.e. one of SEQ ID No: 35 (i) and another one of an amino acid sequence that differs from SEQ ID NO: 35 by no more of 1 amino acid? Are they both part of the same shuttle agent? Either of those options would lead to very different structures of the composition. The recitation combination renders the claim indefinite. The same issue is present in claim 54. The recitation “comprise or consists” of in claims 44, 45 and 54 renders the claims indefinite. The recitation comprise has a very different scope than consists of such that ingredients which are allowed with comprising language are excluded by the consisting of language. Thus, the metes and bounds of the claim(s) are unclear. Claims 36-39, 42 and 46-50 are included in the rejection as they depend on a rejected base claim and they do not clarify the issues. Claim Rejections - 35 USC § 112-Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 35-50 and 54 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. The specification and prior art discloses chemicals, such as SEQ ID NO: 35, HA2-penetratin, EB1 and other specific sequences as set forth, for example, in (i) of claim 45 which meet the written description and enablement provisions of 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph. However, claim(s) 35-50 and 54 is(are) directed to encompass either (A) any synthetic peptide shuttle agent that the features of (1)-(4) and also has at least six of the parameters of (5) to (15) or (B) any peptide that comprises an endosome leakage domain operably linked to a cell penetrating domain which only correspond in some undefined way to specifically instantly disclosed chemicals. None of these peptide shuttle agents meet the written description provision of 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, due to lacking chemical structural information for what they are and chemical structures are highly variant and encompass a myriad of possibilities. The specification provides insufficient written description to support the genus encompassed by the claim. Note: MPEP 2163. Vas-Cath Inc. v. Mahurkar, 19 USPQ2d 1111, (Fed. Cir. 1991), makes clear that "applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the 'written description' inquiry, whatever is now claimed." (See page 1117.) The specification does not "clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed." (See Vas-Cath at page 1116.) Univ. of Rochester v. G.D. Searle, 69 USPQ2d 1886, 1892 (CAFC 2004), further supports this by stating that: The appearance of mere indistinct words in a specification or a claim, even an original claim, does not necessarily satisfy that requirement. A description of an anti-inflammatory steroid, i.e., a steroid (a generic structural term) described even in terms of its functioning of lessening inflammation of tissues fails to distinguish any steroid from others having the same activity or function. A description of what a material does, rather than of what it is, usually does not suffice…. The disclosure must allow one skilled in the art to visualize or recognize the identity of the subject matter purportedly described. (Emphasis added). With the exception of the above specifically disclosed chemical structures, the skilled artisan cannot envision the detailed chemical structure of the encompassed peptide shuttle agents, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method for isolating it. The chemical structure itself is required. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Circ. 1993) and Amgen Inc. V. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016, (Fed. Cir. 1991). In Fiddes v. Baird, 30 USPQ2d 1481, 1483, (Bd. Pat. App. & Int. 1993), claims directed to mammalian FGF's were found unpatentable due to lack of written description for the broad class. The specification provided only the bovine sequence. Finally, University of California v. Eli Lilly and Co., 43 USPQ2d 1398, 1404, 1405 (Fed. Cir. 1997) held that: ...To fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that "the inventor invented the claimed invention." Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997); In re Gosteli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) (" [T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed."). Thus, an applicant complies with the written description requirement "by describing the invention, with all its claimed limitations, not that which makes it obvious," and by using "such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention." Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966. Furthermore, to the extent that a functional description can meet the requirement for an adequate written description, it can do so only in accordance with PTO guidelines stating that the requirement can be met by disclosing “sufficiently detailed, relevant identifying characteristics,” including “functional characteristics when coupled with a known or disclosed correlation between function and structure.” Univ. of Rochester v. G.D. Searle, 68 USPQ2d 1424, 1432 (DC WNY 2003). Looking to the instant specification, example 1 just generically mentions “synthetic peptide shuttle agent” but it does not appear where the specific peptide shuttle agent is recited. But looking to Figure 1/5 there are several peptides disclosed which correspond to the sequences set forth in claim 45 (i). But the claims are much broader than that. Even claim 45 allows for changes to the amino acids in the sequences set forth in (i) as well as at least 50% identity to those sequences. While conservative amino acid substitution typically do not alter the function of the polypeptide, there are exceptions. Nothing in the specification makes it clear what residues are required to be maintained for the peptide to serve as a shuttle agent. The specification fails to describe the common attributes or characteristics that identify all the members of the genus or even a substantial portion thereof. Therefore, only the above chemically structurally defined chemicals, but not the full breadth of the claim(s) meet the written description provision of 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph. The species specifically disclosed are not representative of the genus because the genus is highly variant. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 USC § 112 is severable from its enablement provision. (See page 1115.) Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 35-41, 46 and 48-49 are rejected under 35 U.S.C. 103 as being unpatentable over Jarver et al. (Nucleic Acid Ther. 2015, cited on PTO Form 1449) in view of Lundberg et al. ( FASEB Journal, 2007). Applicant Claims A composition comprising a non-anionic polynucleotide analog cargo for intracellular delivery and a synthetic peptide shuttle agent that is independent from, or is not covalently linked to, said non-anionic polynucleotide analog cargo, wherein: (B) the synthetic peptide shuttle agent comprises an endosome leakage domain (ELD) operably linked to a cell penetrating domain (CPD), and wherein the concentration of the shuttle agent in said composition is at least 2.5 M and is sufficient to increase transduction efficiency and cytosolic delivery of the non-anionic polynucleotide analog cargo, as compared to in the absence of the shuttle agent, upon contact of the composition with target eukaryotic cells. Determination of the Scope and Content of the Prior Art (MPEP §2141.01) Jarver et al. is directed to peptide nanoparticle delivery of charge-neutral splice-switching morpholino oligonucleotides. Cellular entry and bioavailability is low for most therapeutic oligonucleotides (ON) and their ability to reach a desired organ or tissue is often very limited. Commonly used ON analogs include phosphorodiamidate morpholino (PMO). In order to carry out their functions, the ability to cross biological membranes is essential to all therapeutic ONs that have intracellular targets. However, all ONs suffer from inefficient delivery into cells and tissues. Most common methods to increase cellular uptake of therapeutic Ons are based on cationic polymers. One such system involves cationic peptide delivery vehicles, often referred to as cell-penetrating peptides or peptide transduction domains (page 65). ON analogs such as PMO have a hydrophobic nature and are charge-neutral. These ON types have not been thought to be compatible with commonly used cationic nanoparticle delivery systems (page 66, left column, first paragraph). The PMO backbone, on the other hand, is based upon morpholine rings instead of deoxyribose and is linked through phosphorodiamidate groups instead of phosphates. PMO ONs are very promising for therapeutic purposes (page 66, left column, second paragraph). Tested whether the addition of a hydrophobic moiety, such as a lipid, might also help the lipid-CPP hybrid to interact and form complexes with other more hydrophobic structures such as PMO ONs (page 66, right column, last paragraph). Table 1 shows the sequences of selected lipopeptides and phosphorodiamidate morpholino oligonucleotides included in the study (Table 1). KL sequences are designed as secondary amphipathic peptides that might be expected to fold into an alpha helical structure. The STR peptides have histidine residues incorporated into the sequence, which are mainly uncharged at physiological pH. However, the histidines are protonated at lower pH (e.g. in maturing endosomes) and hence increase the net positive charge of the CPP (pointing to Lundberg et al.) (page 67, right column, first paragraph). Tested whether the addition of a hydrophobic moiety, such as a lipid, might also help the lipid-CPP hybrid to interact and form complexes with other more hydrophobic structures such as PMO ONs. It was shown well-established lipopeptides and novel lipopeptides can form nanoparticles readily with PMOs. Such nanoparticles are efficiently taken up by cultured patient fibroblasts and mouse muscle cells, and the PMO is delivered into the cell nucleus with retained biological activity (page 75, left column, first paragraph). Low and high doses of nanoparticles (1 and 10 µM) are taught (Fig. 1). Working concentrations of 5 µM is taught (page 73; Fig. 8). Ascertainment of the Difference Between Scope the Prior Art and the Claims (MPEP §2141.02) While Jarver et al. teaches the use of cationic peptides which are between 15 and 150 amino acids in length to deliver charge neutral (aka non-anionic) oligonucleotides, Jarver et al. does not expressly an endosome leakage domain operably linked to a cell penetrating domain. However, this deficiency is cured by Lundberg et al. Lundberg et al. is directed to the delivery of short interfering RNA using endosomolytic cell-penetrating peptides. Specifically taught is an endosomolytic peptide, EB1, where certain amino acids in the penetratin sequence were replaced with histidine to yield an alpha helix upon protonation in the acidic early-late endosomes. This peptide had superior ability to form complexes and deliver siRNA at low molar ratios. Another peptide HA2-penetratin is taught (page 2664). Both HA2-penetratin and EB1 were tested. While EB1 improves gene silencing to a greater extent than HA2-penetratin, the siRNA uptake is essentially the same, leading to the conclusion that EB is more efficient in promoting endosomal escape (Fig. 4). Finding of Prima Facie Obviousness Rationale and Motivation (MPEP §2142-2143) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Jarver et al. and Lundberg et al. and utilize the endosomolytic cell-penetrating peptides of Lundberg et al. to deliver the charge-neutral phosphorodiamidate morpholino (PMO) of Jarver et al. One skilled in the art would have been motivated to utilize this combination as Jarver et al. point to Lundberg et al. and Lundberg et al. teaches peptides similar to Jarver et al. to delivery oligonucleotides. Since the use of cationic peptides was shown in Jarver et al. to enable delivery of phosphorodiamidate morpholino (PMO) and the endosomolytic cell-penetrating peptides of Lundberg et al. are cationic there is a reasonable expectation of success. Regarding claims 35-37 and 39, Jarver et al. teaches a charge-neutral (aka non-anionic) polynucleotide (aka phosphorodiamidate morpholino (PMO)), the endosomolytic cell-penetrating peptides reading part (B) of the instant claim. Regarding the claimed concentration, Jarver et al. suggest concentrations overlapping the instant claims. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. Both Jarver et al. and Lundberg et al. teach the peptides enable enhanced uptake of the oligonucleotides. The polynucleotide is not linked to any other molecule in either Jarver et al. or Lundberg et al. Regarding claim 38, as shown in table 1 of Jarver et al. the oligonucleotides have lengths of 18-mer to 25-mer. Regarding claims 40-41, these limitations are directed to parameters associated with option (A). Since the claims do not actually require the shuttle agent to be (A), Jarver et al. and Lundgren et al. read on these claims. Regarding claim 46, Lundgren et al. teaches (page 2665, materials and methods). This reads on at least one synthetic amino acid. Regarding claim 48, Lundgren et al. teaches a peptide comprising HA2 (reading on i) and penetratin (reading on ii); Lundgren et al. also teaches EB1 (which reads on i) and since only one of (i) or (ii) is required as represented by (iii) which says it can be both, both peptides read on the instant claims. Regarding claim 49, as set forth above Jarver et al. teaches an overlapping range. Claims 35-49 and 54 are rejected under 35 U.S.C. 103 as being unpatentable over Jarver et al. (Nucleic Acid Ther. 2015, cited on PTO Form 1449) in view of Del’ Guidice et al. (WO 2018068135, cited on PTO Form 1449). Applicant Claims A composition comprising a non-anionic polynucleotide analog cargo for intracellular delivery and a synthetic peptide shuttle agent that is independent from, or is not covalently linked to, said non-anionic polynucleotide analog cargo, wherein: as elected the peptide shuttle agent is SEQ ID No: 35. Determination of the Scope and Content of the Prior Art (MPEP §2141.01) The teachings of Jarver et al. are set forth above. It is taught that cellular entry and bioavailability is low for most therapeutic oligonucleotides (ON) and their ability to reach a desired organ or tissue is often very limited. Amphipathic peptides that might be expected to fold into an alpha helical structure. The STR peptides have histidine residues incorporated into the sequence, which are mainly uncharged at physiological pH. However, the histidines are protonated at lower pH (e.g. in maturing endosomes) and hence increase the net positive charge of the CPP. It was shown well-established lipopeptides and novel lipopeptides can form nanoparticles readily with PMOs. Such nanoparticles are efficiently taken up by cultured patient fibroblasts and mouse muscle cells, and the PMO is delivered into the cell nucleus with retained biological activity Ascertainment of the Difference Between Scope the Prior Art and the Claims (MPEP §2141.02) While Jarver et al. teaches cationic peptides to deliver the PMO, Jarver et al. does not expressly teach the instantly claimed synthetic peptide shuttle agent. However, this deficiency is cured by Del ‘Guidice et al. Del ‘Guidice et al. is directed to rationally-designed synthetic peptide shuttle agents for delivering polypeptide cargos from an extracellular space to the cytosol and/or nucleus of a target eukaryotic cell, uses thereof, methods and kits relating to same. Cell delivery technologies to transport large molecules inside eukaryotic cells have a wide range of applications, particularly in the biopharmaceutical industry. While some soluble chemical substances (e.g., small molecule drugs) may passively diffuse through the eukaryotic cell membrane, larger cargos (e.g., biologies, polynucleotides, and polypeptides) require the help of shuttle agents to reach their intracellular targets (page 1).The shuttle agents are taught as “improved” specifically capable of increasing the transduction efficiency of polypeptide carbos and delivery the cargos to the cytosol and/or nuclease of target eukaryotic cells. Claimed is a synthetic peptide shuttle agent (claim 17) which 1) a peptide at least 20 amino acids in length comprising (2) an amphipathic alpha-helical motif having a positively-charged hydrophilic outer face, and (3) a hydrophobic outer face, wherein at least five of the following parameters (4) to (15) are respected:(4) the hydrophobic outer face comprises a highly hydrophobic core consisting of spatially adjacent L, I, F, V, W, and/or M amino acids representing 12 to 50% of the amino acids of the peptide, based on an open cylindrical representation of the alpha-helix having 3.6 residues per turn; (5) the peptide has a hydrophobic moment (μ) of 3.5 to 11 ; (6) the peptide has a predicted net charge of at least +4 at physiological pH;(7) the peptide has an isoelectric point (pi) of 8 to 13;(8) the peptide is composed of 35% to 65% of any combination of the amino acids: A, C, G, I, L, M, F, P, W, Y, and V;(9) the peptide is composed of 0% to 30% of any combination of the amino acids: N, Q, S, and T; (10) the peptide is composed of 35% to 85% of any combination of the amino acids: A, L, K, or R; (11) the peptide is composed of 15% to 45% of any combination of the amino acids: A and L, provided there being at least 5% of L in the peptide; (12) the peptide is composed of 20% to 45% of any combination of the amino acids: K and R;(13) the peptide is composed of 0% to 10% of any combination of the amino acids: D and E; (14) the difference between the percentage of A and L residues in the peptide (% A+ L), and the percentage of K and R residues in the peptide (K + R), is less than or equal to 10%; and (15) the peptide is composed of 10% to 45% of any combination of the amino acids: Q, Y, W, P, I, S, G, V, F, E, D, C, M, N. T and H. Finding of Prima Facie Obviousness Rationale and Motivation (MPEP §2142-2143) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Jarver et al. and Del ‘Guidice et al. and utilize the peptide shuttle agents of Del ‘Guidice to deliver the PMO of Jarver et al. One skilled in the art would have been motivated to utilize the peptide shuttle agents of Del ‘Guidice as Jarver et al. expressly teaches the use of cationic peptides to enhancer delivery and Del ‘Guidice teaches that the “improved” peptide shuttle agents can effectively deliver large cargo which as recognized by Del ‘Guidice includes polynucleotides and polypeptides as these require the help of shuttle agents to reach their intracellular targets. Regarding claims 35-37, 39 and 49, the PMO of Jarver et al. is taught as a charge-neutral PMO reading on non-anionic polynucleotide analog. The synthetic peptide shuttle agent claimed by Jarver et al. (claim 1; 17) has the same/similar requirements and parameters. Regarding the claimed concentration, Jarver et al. suggest concentrations overlapping the instant claims. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. The PMO of Jarver et al. is not linked to anything other molecule. Regarding claim 38, as shown in table 1 of Jarver et al. the oligonucleotides have lengths of 18-mer to 25-mer. Regarding claims 40-44, 46-47, Del ‘Guidice et al. teaches the same limitations of the shuttle peptide agent (claims 1-8). Regarding claim 48, Del ‘Guidice et al. teaches the peptide comprises an ELD and/or CPD which overlap in scope with the instant claims (claims 10-11). Regarding claims 45 and 54, firstly, the examiner notes that no prior art expressly teaches a sequence with 100% identity to instantly claimed SEQ ID NO: 35. However, the claims are not limited to such a sequence. Seq ID No: 113 of Del ‘Guidice et al. has 51.2% identity to instantly claimed SEQ ID No: 35 which falls within the scope instantly claimed. Claims 45 and 50 allow for an amino acid sequence that different from, for example SEQ ID NO: 358, by no more than 10 amino acids. Since SEQ ID No: 358 is 12 amino acids long, this means there needs to only be a 2 amino acid match. SEQ ID No: 121 of Del ‘Guidice et al. has 53.8% identity. Both sequence alignments are shown below. PNG media_image2.png 315 699 media_image2.png Greyscale PNG media_image3.png 314 682 media_image3.png Greyscale Regarding claim 49, as set forth above Jarver et al. teaches an overlapping range. Claim 50 is rejected under 35 U.S.C. 103 as being unpatentable over Jarver et al. in view of Lundgren et al. OR Del ‘Guidice et al. and in further view of Pattanayak et al. (RSC Adv, 2014). Applicant Claims The instant application claims wherein the non-anionic polynucleotide analog cargo is: (a) a non-anionic antisense oligonucleotide targeting a gene of the Hedgehog pathway; (b) a non-anionic antisense oligonucleotide that targets Gli 1 for knockdown; or (c) a non-anionic antisense oligonucleotide hybridizes to the polynucleotide sequence of any one of SEQ ID NOs: 365 to 368. Determination of the Scope and Content of the Prior Art (MPEP §2141.01) The teachings of Jarver et al. are set forth above. Ascertainment of the Difference Between Scope the Prior Art and the Claims (MPEP §2141.02) While Jarver et al. teaches a PMO, Jarver et al. does not expressly teach a PMO which targets a gene of the Hedgehog pathway. However, this deficiency is cured by Pattanayak et al. Pattanayak et al. is directed to a cationic morpholino antisense oligomer conjugate: synthesis, cellular uptake and inhibition of Fli1 in the hedgehog signaling pathway. Phosphorodiamidate morpholino oligonucleotides (PMOs) are chemically altered DNA derivatives, having morpholino-modified nucleosides and a phosphorodiamidate backbone (Fig. 1a and b). PMOs can efficiently inhibit gene expression by blocking translation or by hampering pre-mRNA splicing. The neutrality of the backbone, extraordinary stability against cellular nucleases and predictive antisense activity has made PMOs worth considering as potent therapeutics against cancer and other genetic diseases (page 1951, first paragraph). Taught is a commercially available mouse Gli1-targeted PMO 7 having base-sequence 5’ GTCATTGGATTGAACATGGCGTCTC-3’ (page 1952, right column, last paragraph). It was found that attachment of a cationic GMO (guanidinium-linked morpholino oligomer) can effectively enter cells and impart antisense effects (page 1953). Finding of Prima Facie Obviousness Rationale and Motivation (MPEP §2142-2143) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Jarver et al., Lundgren et al. and Pattanayak et al. and utilize the PMO of Pattanayak et al. as the PMO with the endosomolytic cell-penetrating peptides. One skilled in the art would have been motivated with a reasonable expectation of success to utilize this PMO as Jarver et al. teaches a PMO and Pattanayak et al. teaches the 25-mer sequences of GTCATTGGATTGAACATGGCGTCTC-can be used to target Gli1 and inhibit expression in order to treat diseases indicated with aberrant activation of the hedgehog pathway. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Jarver et al., Del ‘Guidice et al. and Pattanayak et al. and utilize the PMO of Pattanayak et al. as the PMO with the peptide shuttle agent. One skilled in the art would have been motivated with a reasonable expectation of success to utilize this PMO as Jarver et al. teaches a PMO and Pattanayak et al. teaches the 25-mer sequences of GTCATTGGATTGAACATGGCGTCTC-can be used to target Gli1 and inhibit expression in order to treat diseases indicated with aberrant activation of the hedgehog pathway. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 35-41, 43-45, 47, 49-50 and 54 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 of U.S. Patent No. 12428447 (cited on PTO Form 1449) in view of Jarver et al. and Pattanayak et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. A composition comprising a non-anionic polynucleotide analog cargo for intracellular delivery and a synthetic peptide shuttle agent that is independent from, or is not covalently linked to, said non-anionic polynucleotide analog cargo, wherein: as elected the peptide shuttle agent is SEQ ID No: 35. Patent ‘447 claims a synthetic peptide shuttle agent having transduction activity for both proteinaceous and non-proteinaceous cargoes in target eukaryotic cells, the synthetic peptide shuttle agent comprising: an amino acid sequence at least 70% identical to SEQ ID NO: 35, calculated excluding the linker domain set forth in SEQ ID NO: 354; or an amino acid sequence that differs from SEQ ID NO: 35 by no more than 6 amino acids excluding the linker domain set forth in SEQ ID NO: 354, wherein the synthetic peptide shuttle agent is a peptide at least 17 amino acids in length comprising an amphipathic alpha-helical motif comprising a positively-charged hydrophilic outer face and a hydrophobic outer face, and the synthetic peptide shuttle agent comprises at least five of the following parameters: (a) the hydrophobic outer face comprises a highly hydrophobic core consisting of spatially adjacent L, I, F, V, W, and/or M amino acids representing 12 to 50% of the amino acids of the peptide, based on an open cylindrical representation of the alpha-helix having 3.6 residues per turn; (b) the peptide has a hydrophobic moment (μ) of 3.5 to 11; (c) the peptide has a predicted net charge of at least +4 at physiological pH; (d) the peptide has an isoelectric point (pI) of 8 to 13; (e) the peptide is composed of 35% to 65% of any combination of the amino acids: A, C, G, I, L, M, F, P, W, Y, and/or V; (f) the peptide is composed of 0% to 30% of any combination of the amino acids: N, Q, S, and/or T; (g) the peptide is composed of 35% to 85% of any combination of the amino acids: A, L, K, and/or R; (h) the peptide is composed of 15% to 45% of any combination of the amino acids: A and/or L, provided there being at least 5% of L in the peptide; (i) the peptide is composed of 20% to 45% of any combination of the amino acids: K and/or R; (i) the peptide is composed of 0% to 10% of any combination of the amino acids: D and/or E; (k) the difference between the percentage of A and L residues in the peptide (% A+L), and the percentage of K and R residues in the peptide (% K+R), is less than or equal to 10%; and/or (l) the peptide is composed of 10% to 45% of any combination of the amino acids: Q, Y, W, P, I, S, G, V, F, E, D, C, M, N, T and/or H, wherein the synthetic peptide shuttle agent increases the transduction efficiency of propidium iodide or other membrane-impermeable fluorescent DNA intercalating agents by at least 3-fold over a corresponding negative control lacking said synthetic peptide shuttle agent, and/or enables a transduction efficiency of at least 10% of propidium iodide or other membrane-impermeable fluorescent DNA intercalating agents, in a eukaryotic cell line model suitable for assessing cargo transduction in said target eukaryotic cells; wherein the synthetic peptide shuttle agent increases the transduction efficiency of GFP-NLS by at least 3-fold over a corresponding negative control lacking said synthetic peptide shuttle agent, and/or enables a transduction efficiency of at least 7% of GFP-NLS, in a eukaryotic cell line model suitable for assessing cargo transduction in said target eukaryotic cells (claim 1). Linker domains include GSGGGS (claim 6-9). The difference between the instant claims and Patent ‘447 is that Patent ‘447 does not claim a non-proteinaceous cargo which is a non-anionic polynucleotide analog cargo. However, this deficiency is cured by Jarver et al. and Pattanayak et al. Jarver et al. is directed to peptide nanoparticle delivery of charge-neutral splice-switching morpholino oligonucleotides. Cellular entry and bioavailability is low for most therapeutic oligonucleotides (ON) and their ability to reach a desired organ or tissue is often very limited. Commonly used ON analogs include phosphorodiamidate morpholino (PMO). In order to carry out their functions, the ability to cross biological membranes is essential to all therapeutic ONs that have intracellular targets. However, all ONs suffer from inefficient delivery into cells and tissues. Most common methods to increase cellular uptake of therapeutic Ons are based on cationic polymers. One such system involves cationic peptide delivery vehicles, often referred to as cell-penetrating peptides or peptide transduction domains (page 65). ON analogs such as PMO have a hydrophobic nature and are charge-neutral. These ON types have not been thought to be compatible with commonly used cationic nanoparticle delivery systems (page 66, left column, first paragraph). The PMO backbone, on the other hand, is based upon morpholine rings instead of deoxyribose and is linked through phosphorodiamidate groups instead of phosphates. PMO ONs are very promising for therapeutic purposes (page 66, left column, second paragraph). Tested whether the addition of a hydrophobic moiety, such as a lipid, might also help the lipid-CPP hybrid to interact and form complexes with other more hydrophobic structures such as PMO ONs (page 66, right column, last paragraph). Table 1 shows the sequences of selected lipopeptides and phosphorodiamidate morpholino oligonucleotides included in the study (Table 1). KL sequences are designed as secondary amphipathic peptides that might be expected to fold into an alpha helical structure. The STR peptides have histidine residues incorporated into the sequence, which are mainly uncharged at physiological pH. However, the histidines are protonated at lower pH (e.g. in maturing endosomes) and hence increase the net positive charge of the CPP (pointing to Lundberg et al.) (page 67, right column, first paragraph). Tested whether the addition of a hydrophobic moiety, such as a lipid, might also help the lipid-CPP hybrid to interact and form complexes with other more hydrophobic structures such as PMO ONs. It was shown well-established lipopeptides and novel lipopeptides can form nanoparticles readily with PMOs. Such nanoparticles are efficiently taken up by cultured patient fibroblasts and mouse muscle cells, and the PMO is delivered into the cell nucleus with retained biological activity (page 75, left column, first paragraph). Low and high doses of nanoparticles (1 and 10 µM) are taught (Fig. 1). Working concentrations of 5 µM is taught (page 73; Fig. 8). Pattanayak et al. is directed to a cationic morpholino antisense oligomer conjugate: synthesis, cellular uptake and inhibition of Fli1 in the hedgehog signaling pathway. Phosphorodiamidate morpholino oligonucleotides (PMOs) are chemically altered DNA derivatives, having morpholino-modified nucleosides and a phosphorodiamidate backbone (Fig. 1a and b). PMOs can efficiently inhibit gene expression by blocking translation or by hampering pre-mRNA splicing. The neutrality of the backbone, extraordinary stability against cellular nucleases and predictive antisense activity has made PMOs worth considering as potent therapeutics against cancer and other genetic diseases (page 1951, first paragraph). Taught is a commercially available mouse Gli1-targeted PMO 7 having base-sequence 5’ GTCATTGGATTGAACATGGCGTCTC-3’ (page 1952, right column, last paragraph). It was found that attachment of a cationic GMO (guanidinium-linked morpholino oligomer) can effectively enter cells and impart antisense effects (page 1953). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘477, Jarver et al. and Pattanayak et al. and utilize a PMO which inhibits gene expression of Gli1. One skilled in the art would have been motivated to utilize these as the non-proteinaceous cargoes in Patent ‘477 as Jarver et al. teaches that cationic peptides can be utilized to delivery PMO. Regarding the claimed peptide shuttle agent, Patent ‘477 specifically claims SEQ ID NO: 35 which has 100% identity to instantly claimed SEQ ID NO: 35 PNG media_image4.png 301 679 media_image4.png Greyscale Regarding claim 38 and 50, Pattanayak et al. teaches the 25-mer sequences of GTCATTGGATTGAACATGGCGTCTC can be used to target Gli1 and inhibit expression in order to treat diseases indicated with aberrant activation of the hedgehog pathway. Regarding claims 35-37, 39 and 49, the PMO of Jarver et al. is taught as a charge-neutral PMO reading on non-anionic polynucleotide analog. The synthetic peptide shuttle agent claimed by Jarver et al. (claim 1; 17) has the same/similar requirements and parameters. Regarding the claimed concentration, Jarver et al. suggest concentrations overlapping the instant claims. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. The PMO of Jarver et al. is not linked to anything other molecule. Claims 35-44 and 46-50 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 12286632 (cited on PTO Form 1449) in view of Jarver et al. and Pattanayak et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. The instant claims are set forth above. Patent ‘632 claims a method for synthesizing a peptide having protein transduction activity, the method comprising: (a) designing a peptide which is: (1) a peptide soluble in aqueous solution having an overall length of between 20 and 150 amino acids comprising (2) an amphipathic alpha-helical motif having (3) a positively-charged hydrophilic outer face comprising: (a) at least two adjacent positively-charged K and/or R residues upon helical wheel projection; and/or (b) a segment of six adjacent residues comprising three to five K and/or R residues upon helical wheel projection, based on an alpha helix having angle of rotation between consecutive amino acids of 100 degrees and/or an alpha-helix having 3.6 residues per turn; and (4) a hydrophobic outer face comprising a highly hydrophobic core consisting of spatially adjacent L, I, F, V, W, and/or M amino acids representing 12 to 50% of the amino acids of the peptide, based on an open cylindrical representation of the alpha-helix having 3.6 residues per turn; wherein at least five of the following parameters (5) to (15) are respected: (5) the peptide has a hydrophobic moment (μ) of 3.5 to 11; (6) the peptide has a predicted net charge of at least+4 at physiological pH, calculated from amino acid residues having charged side chains; (7) the peptide has an isoelectric point (pI) of 8 to 13; (8) the peptide is composed of 35% to 65% of any combination of the amino acids: A, C, G, I, L, M, F, P, W, Y, and V; (9) the peptide is composed of 0% to 30% of any combination of the amino acids: N, Q, S, and T; (10) the peptide is composed of 35% to 85% of any combination of the amino acids: A, L, K, or R; (11) the peptide is composed of 15% to 45% of any combination of the amino acids: A and L, provided there being at least 5% of L in the peptide; (12) the peptide is composed of 20% to 45% of any combination of the amino acids: K and R; (13) the peptide is composed of 0% to 10% of any combination of the amino acids: D and E; (14) the difference between the percentage of A and L residues in the peptide (% A+L), and the percentage of K and R residues in the peptide (% K+R), is less than or equal to 10%; and (15) the peptide is composed of 10% to 45% of any combination of the amino acids: Q, Y, W, P, I, S, G, V, F, E, D, C, M, N, T and H, (b) chemically synthesizing the peptide in (a), wherein said peptide is deemed to have protein transduction activity when target eukaryotic cells contacted for five minutes with an independent polypeptide cargo in the presence of at least 2.5 μM of the peptide results in an increase transduction efficiency and cytosolic delivery of the independent polypeptide cargo, as compared to in the absence of the peptide, wherein the peptide and the independent polypeptide cargo comprise independent polypeptide backbones or are not covalently bound, and wherein the peptide lacks a cell penetrating domain (claim 1). The difference between Patent ‘632 and the instant claims is that Patent ‘532 does not claim a non-anionic oligonucleotide cargo with the peptide. However, this deficiency is cured by Jarver et al. and Pattanayak et al. The teachings of Jarver et al. and Pattanayak et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘632, Jarver et al. and Pattanayak et al. and utilize a PMO which inhibits gene expression of Gli1. One skilled in the art would have been motivated to utilize the peptide of Patent ‘632 as Jarver et al. teaches that cationic peptides can be utilized to delivery PMO. Regarding claims 35-37, 39 and 49, the PMO of Jarver et al. is taught as a charge-neutral PMO reading on non-anionic polynucleotide analog. The synthetic peptide shuttle agent claimed by Jarver et al. (claim 1; 17) has the same/similar requirements and parameters. Regarding the claimed concentration, Jarver et al. suggest concentrations overlapping the instant claims. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. The PMO of Jarver et al. is not linked to anything other molecule. Regarding claims 40-44, 46-48, Patent ‘632 claims the same limitations of the shuttle peptide agent (claims 1-20). Regarding claim 38 and 50, the PMO of Pattanayak et al. is a 25-mer which is a non-anionic antisense oligonucleotide targeting a gene of the Hedgehog pathway. Claims 35-41, 43-45, 47, 49-50 and 54 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 59-78 of copending Application No. 19312632 in view of Jarver et al. and Pattanayak et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection. The instant claims are set forth above. Copending ‘632 claims a synthetic peptide shuttle agent having transduction activity for both proteinaceous and non-proteinaceous cargoes in target eukaryotic cells, the synthetic peptide shuttle agent comprising:- an amino acid sequence at least 70% identical to the full length of SEQ ID NO: 285;or - an amino acid sequence that differs from SEQ ID NO: 285 by no more than 8 amino acids, wherein the synthetic peptide shuttle agent is a peptide at least 17 amino acids in length comprising an amphipathic alpha-helical motif comprising a positively-charged hydrophilic outer face and a hydrophobic outer face, and the synthetic peptide shuttle agent comprises at least five of the following parameters: (a) the hydrophobic outer face comprises a highly hydrophobic core consisting of spatially adjacent L, I, F, V, W, and/or M amino acids representing 12% to 50% of the amino acids of the peptide, based on an open cylindrical representation of the alpha-helix having 3.6 residues per turn; (b) the peptide has a hydrophobic moment ( ) of 3.5 to 11; (c) the peptide has a predicted net charge of at least +4 at physiological pH; (d) the peptide has an isoelectric point (pI) of 8 to 13; (e) the peptide is composed of 35% to 65% of any combination of the amino acids: A, C, G, I, L, M, F, P, W, Y, and/or V;(f) the peptide is composed of 0% to 30% of any combination of the amino acids: N, Q, S, and/or T;(g) the peptide is composed of 35% to 85% of any combination of the amino acids: A, L, K, and/or R;(h) the peptide is composed of 15% to 45% of any combination of the amino acids: A and/or L, provided there being at least 5% of L in the peptide;(i) the peptide is composed of 20% to 45% of any combination of the amino acids: K and/or R;(j) the peptide is composed of 0% to 10% of any combination of the amino acids: D and/or E;(k) the difference between the percentage of A and L residues in the peptide (% A+ L), and the percentage of K and R residues in the peptide (% K + R), is less than or equal to 10%; and/or (1) the peptide is composed of 10% to 45% of any combination of the amino acids: Q, Y, W, P, I, S, G, V, F, E, D, C, M, N, T and/or H, wherein the synthetic peptide shuttle agent increases the transduction efficiency of propidium iodide or other membrane-impermeable fluorescent DNA intercalating agents by at least 3-fold over a corresponding negative control lacking said synthetic peptide shuttle agent, and/or enables a transduction efficiency of at least 10% of propidium iodide or other membrane- impermeable fluorescent DNA intercalating agents, in a eukaryotic cell line model suitable for assessing cargo transduction in said target eukaryotic cells; wherein the synthetic peptide shuttle agent increases the transduction efficiency of GFP- NLS by at least 3-fold over a corresponding negative control lacking said synthetic peptide shuttle agent, and/or enables a transduction efficiency of at least 7% of GFP-NLS, in a eukaryotic cell line model suitable for assessing cargo transduction in said target eukaryotic cells. The difference between the instant claims and copending ‘632 is that copending ‘632 does not claim a non-proteinaceous cargo which is a non-anionic polynucleotide analog cargo. However, this deficiency is cured by Jarver et al. and Pattanayak et al. The teachings of Jarver et al. and Pattanayak et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘632, Jarver et al. and Pattanayak et al. and utilize a PMO which inhibits gene expression of Gli1. One skilled in the art would have been motivated to utilize these as the non-proteinaceous cargoes in copending ‘632 as Jarver et al. teaches that cationic peptides can be utilized to delivery PMO. Regarding the claimed peptide shuttle agent, copending ‘632 specifically claims SEQ ID NO: 285 which has 100% identity to instantly claimed SEQ ID NO: 285: PNG media_image5.png 255 680 media_image5.png Greyscale Regarding claim 38 and 50, Pattanayak et al. teaches the 25-mer sequences of GTCATTGGATTGAACATGGCGTCTC can be used to target Gli1 and inhibit expression in order to treat diseases indicated with aberrant activation of the hedgehog pathway. Regarding claims 35-37, 39 and 49, the PMO of Jarver et al. is taught as a charge-neutral PMO reading on non-anionic polynucleotide analog. The synthetic peptide shuttle agent claimed by Jarver et al. (claim 1; 17) has the same/similar requirements and parameters. Regarding the claimed concentration, Jarver et al. suggest concentrations overlapping the instant claims. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. The PMO of Jarver et al. is not linked to anything other molecule. Claims 35-44 and 46-50 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 92-111 of copending Application No. 18033280 (USPGPUB No. 20230399661, cited on PTO Form 1449) in view of Jarver et al. and Pattanayak et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection. The instant claims are set forth above. Copending ‘280 claims a method for delivering a non-anionic cargo across a mucus- producing membrane, the method comprising contacting cells of the mucus-producing membrane with the non-anionic cargo and a synthetic peptide shuttle agent at a concentration sufficient to increase a transduction efficiency and/or cytosolic/nuclear delivery of the non-anionic cargo, as compared to in an absence of the synthetic peptide shuttle agent, wherein the synthetic peptide shuttle agent and the non-anionic cargo are not covalently bound at the time of transduction, and wherein the synthetic peptide shuttle agent comprises or consists essentially of a central core amphipathic alpha helical region having shuttle agent activity, flanked N- and C-terminally by flexible linker domains, wherein one or both of the flexible linker domains comprises or consists essentially of a sufficient number of non-cationic hydrophilic residues such that cargo transduction activity of the synthetic peptide shuttle agent across the mucus-producing membrane, or in the presence of DNA and/or RNA, is increased relative to that of the central core amphipathic alpha helical region lacking the flexible linker domains, wherein the central core amphipathic alpha helical region is an endosomolytic peptide at least 8 amino acids in length having both a positively- charged hydrophilic outer face and a hydrophobic outer face (claim 92). An overlapping length is claimed (claim 93). The difference between the instant claims and copending ’280 is that copending ‘280 does not claim a non-anionic cargo which is a non-anionic polynucleotide analog cargo. However, this deficiency is cured by Jarver et al. and Pattanayak et al. The teachings of Jarver et al. and Pattanayak et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘280, Jarver et al. and Pattanayak et al. and utilize a PMO which inhibits gene expression of Gli1. One skilled in the art would have been motivated to utilize these as the non-anionic cargo in copending ‘280 as Jarver et al. teaches that cationic peptides can be utilized to delivery PMO. Regarding claims 35-37, 39 and 49, the PMO of Jarver et al. is taught as a charge-neutral PMO reading on non-anionic polynucleotide analog. The synthetic peptide shuttle agent claimed by Jarver et al. (claim 1; 17) has the same/similar requirements and parameters. Regarding the claimed concentration, Jarver et al. suggest concentrations overlapping the instant claims. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. The PMO of Jarver et al. is not linked to anything other molecule. Regarding claims 40-44, 46-48, copending ‘280 claims the same limitations of the shuttle peptide agent (claims 92-94, 100-106). Regarding claim 38 and 50, the PMO of Pattanayak et al. is a 25-mer which is a non-anionic antisense oligonucleotide targeting a gene of the Hedgehog pathway. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to ABIGAIL VANHORN whose telephone number is (571)270-3502. The examiner can normally be reached M-Th 6 am-4 pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Apr 17, 2023
Application Filed
Mar 02, 2026
Non-Final Rejection — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600972
LIPOPOLYSACCHARIDE (LPS) APTAMERS AND ASSOCIATED METHODS
2y 5m to grant Granted Apr 14, 2026
Patent 12582609
CANCER VACCINES
2y 5m to grant Granted Mar 24, 2026
Patent 12577271
MODIFIED NUCLEOTIDES AND USES THEREOF
2y 5m to grant Granted Mar 17, 2026
Patent 12553081
METHODS AND CONTROL COMPOSITIONS FOR A QUANTITATIVE POLYMERASE CHAIN REACTION
2y 5m to grant Granted Feb 17, 2026
Patent 12540323
NUCLEIC ACID, PHARMACEUTICAL COMPOSITION, CONJUGATE, PREPARATION METHOD, AND USE
2y 5m to grant Granted Feb 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
47%
Grant Probability
69%
With Interview (+21.9%)
3y 7m
Median Time to Grant
Low
PTA Risk
Based on 1191 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month