Prosecution Insights
Last updated: October 02, 2026
Application No. 18/033,049

DUAL AAV VECTOR-MEDIATED DELETION OF LARGE MUTATIONAL HOTSPOT FOR TREATMENT OF DUCHENNE MUSCULAR DYSTROPHY

Non-Final OA §101§102§103§112§DP
Filed
Apr 20, 2023
Priority
Oct 21, 2020 — provisional 63/094,742 +2 more
Examiner
ARIETI, RUTH SOPHIA
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Duke University
OA Round
1 (Non-Final)
47%
Grant Probability
Moderate
1-2
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allowance Rate
42 granted / 90 resolved
-13.3% vs TC avg
Strong +71% interview lift
Without
With
+71.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
23 currently pending
Career history
130
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
12.9%
-27.1% vs TC avg
§112
28.5%
-11.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 90 resolved cases

Office Action

§101 §102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 3, 6, 9-10, 15, 18, 23-24, 29-31, 34-37, 39, 41, 46, 51, and 79 are pending. Election/Restrictions Applicant’s election without traverse of Invention Group I, drawn to a CRISPR-Cas dual vector system for targeting DMD (Claims 3, 6, 9-10, 15, 18, 23-24, 29-31, 34-37, 46, 51, and 79) and the following species: SEQ ID NO 61, SEQ ID NO 138 (≈RNA SEQ ID NO 139) SEQ ID NO 57 (≈DNA SEQ ID NO 55) and SEQ ID NO 137 (≈DNA SEQ ID NO 135) SEQ ID NO 58 (≈DNA SEQ ID NO 56) and SEQ ID NO 136 (≈DNA SEQ ID NO 134) SEQ ID NOs 92 and 131 in the reply filed on 26 May 2026 is acknowledged. Claims 39 and 41 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 26 May 2026. Elected SEQ ID NOs 92 and 131 were searched and found free of the prior art of record (see below §Sequence[s] Free of the Prior Art of Record), so SEQ ID NO 91 was also searched. SEQ ID NO 91 was found to be free of the prior art of record so the requirement for restriction of that species is withdrawn. Since Applicant indicates SEQ ID NOs 55, 57, 135, and 137 and SEQ ID NOs 56, 58, 136, and 138 are DNA/RNA equivalents, those species are examined together. All other requirements for election of species are maintained. Claims 3, 6, 9-10, 15, 18, 23-24, 29-31, 34-37, 46, 51, and 79 are examined. Information Disclosure Statement The Spec. cites references. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. The IDS(es) has been considered. Drawings The drawings are objected to because of the following informalities: Figs. 1-2 are blurry. Figs. 2, 24D: the text is hard to read. A high contrast figure would be better. Figs. 5, 10, 12, 18, 20D, 21A, 22G, 23C, 24C, 26B, 26C: the images are blurry and detail is not discernable. Fig. 9C: detail of the blot is not discernable. Fig. 19B: the grayscale used for the bars doesn’t clarify which bar corresponds with which “approach”. Are the bars (L[Wingdings font/0xE0]R) in the same order as the legend (top to bottom)? Fig. 21C: It is not possible to tell the lines apart due to low figure quality. Figs. 25C, 26D: the blot appears to contain artifacts—are these images one single blot or two pieced together?—and should be replaced with a better quality image. Right now it looks like some information is cut out. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The use of the following term(s), which is a trade name or a mark used in commerce, has been noted in this application: ¶205: DNEasy®, Quiagen®; ¶206: Addgene®, ¶208: Invitrogen®, ¶210: Ampure®, Beckman Coulter®, Illumina®, MiSeq®, CRISPResso®; ¶212: SuperScript®, VILO®, Perfect Fastmix®, Quantabio®, SYBR®, Bio-Rad®; ¶213: QX200®, QIAquick®; ¶214: Roceh®, NuPAGE®, Millipore®; ¶219: Lipofectamine®, PromoCell®, GlutaMAX®; ¶222: RNALater®, ¶224: EvaGreen®, Taqman®. The term(s) should be accompanied by the generic terminology; furthermore the term(s) should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term(s). Applicant is responsible for marking each instance of the term(s) and for finding any others not noted above. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections Claims 6, 9, 29-31, 51, and 79 are objected to because of the following informalities: Claims 6, 9, 30-31, and 79 should change or to and in the lists that recite …selected from so they recite …selected from [X…] and [Z]. Claim 10 recites that the vector genome replicated from the first vector is self-complementary and forms a ds RNA hairpin but it should recite a ds DNA hairpin because McCarty (2008. Self-complementary AAV Vectors; Advances and Applications. Mol. Ther. 16[10]:1648, “McCarty 2008”) teaches (§THE PROBLEM WITH A SINGLE-STRANDED GENOME ¶2, Fig. 1) the vector comprises a ds DNA hairpin at each end. Claim 29 should spell out Staphylococcus aureus or S. aureus instead of reciting SaCas9. Claim 35 should recite: or exon of the dystrophin gene in item (f). Claim 36: the list of items should appear in alphabetical order. Right now it goes f-h-i-g-k-l-m Claim 51 should recite …comprises the nucleotide sequence SEQ ID NO [#] or [##] or, simply, …comprises sequence SEQ ID NO [#] or [##] instead of …a nucleotide sequence of…. Appropriate correction is required. Claim Interpretation The claims recite first and second gRNA or intron. The terms first and second are interpreted as merely distinguishing the gRNA or intron from one another. Any optional limitations are interpreted as completely optional and not required. Claim 6 recites that the mutant ITR directs vector genome replication to generate a self-complementary transcript that forms a double-stranded (ds) polynt. The recitation that the mutant ITR directs… is interpreted as meaning that the mutant ITR prevents the dimer genome from being processed back to the monomer form by the AAV Rep protein. That interpretation is based on McCarty (et al. 2003. Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. 10:2112, “McCarty”)’s teaching (§Results-Mutant vectors for efficient production of scAAV vectors ¶1) that the mutant ITR prevents the dimer genome from being processed back to the monomer form by the AAV Rep protein. Claim 15 recites the second vector comprises a third promoter. Since the second vector doesn’t comprise any other promoters, the third promoter is interpreted as referring to a third promoter in the system overall. Claim 46 and claims depending therefrom recite guide sequence[s]. Guide sequence is interpreted to mean the same thing as gRNA. Claim 51 recites guide sequence… comprises a nt sequence of SEQ ID NO [#]. That is interpreted as requiring any nt sequence that is comprised by the recited SEQ ID NOs, even something as short as 2-mer. See §112a Written Description for more information. In contrast, Claim 79 recites the plasmid comprises a sequence selected from SEQ ID NOs…. That claim is interpreted as requiring the entirety of a sequence selected from that list (i.e., all of SEQ ID NO 92, 131, etc.). Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 3, 6, 9-10, 15, 18, 23-24, 29-31, 34-37, 46, 51, and 79 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection. There is a written description problem with the claims because they encompass molecules whose structure cannot be envisioned because the claims are directed to generic classes of molecules defined solely by their functions. Claim 3 (and claims depending therefrom) recites guide RNAs (gRNA) for targeting any intron or exon of dystrophin and ITRs operably linked to the gRNAs. Claim 46 recites guide sequence[s]. As discussed in §Claim interpretation, guide sequence is interpreted to mean a gRNA. Those broad claims encompass the large genus of gRNA or guide sequences that target any intron or exon of dystrophin. A dystrophin gene is huge and it can comprise any number of mutations. Broad Claim 3 also encompasses the large genus of ITRs that are operably linked to the gRNA and broad Claim 6 recites wildtype and mutant ITRs. The broad claims encompass any ITRs, including any mutant ITR which are operably linked to gRNA but the Spec. doesn’t disclose any structure requisite for an ITR, and it doesn’t disclose any structure that makes an ITR wildtype or any structural anomaly that makes an ITR mutant. Similarly, Claim 46 recites first and second AAV ITR sequence[s]. The broad claims encompass any AAV ITRs, but the Spec. doesn’t disclose any requisite structure that characterizes an AAV ITR. Claims 9 and 15 recite a ubiquitous promoter or a tissue-specific promoter. Those are broad genera of molecules defined solely by their function but the Spec. doesn’t disclose any structure responsible for the functions of being a ubiquitous promoter or a tissue-specific promoter. Claims 35-36 and 46 recite a Cas9 gRNA scaffold sequence or the Cas9 gRNA scaffold sequence. That is a broad genus of molecules defined solely by their function but the Spec. doesn’t disclose any structure responsible for the function of being a Cas9 gRNA scaffold sequence. Claim 51 recites the guide sequences targeting a first or second intron of DMD comprise a nt sequence of SEQ ID NO 134 or 56 or SEQ ID NO 135 or 55. The claim is worded in such a way it requires any nt sequence that is within SEQ ID NO 134 or 56 or SEQ ID NO 135 or 55, which encompasses very short sequences, including those as short as only 2-mer. However, the Spec. doesn’t demonstrate possession of gRNA sequences that are shorter than ≈20-mer. An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163. Regarding the gRNA for targeting any intron or exon of dystrophin, the Spec. discusses (¶132-137) characteristics of the gRNA: it can target any desired DNA via complementary base pairing and has to be sufficiently complementary to the target region to be able to hybridizes, for example about 10 to about 20 nt of the target region, it must be followed by a PAM sequence that differs depending on the system, in some embodiments it comprise 10 nt that can be 80% complementary to the target or can have mismatches to the target, it targets a region of the dystrophin gene and is chosen immediately upstream of possible out-of-frame stop codons or at splice acceptor sites or splice donor sites… such that insertions or deletions during the repair process restore the dystrophin reading frame by frame conversion or by splice site disruption and exon exclusion. That indicates the gRNA can target any part of a mutated DMD gene. The § goes on to describe that the gRNA can be as many as 15 nt shorter than SEQ ID NO 57 (22-mer) or 58 (24-mer), which would leave a 7-mer or 9-mer gRNA. Regarding the guide sequences targeting a first or second intron of DMD that comprise a nt sequence of SEQ ID NO 134 or 56 or SEQ ID NO 135 or 55, including the very short sequences encompassed by the claim, the Spec. discloses only those SEQ ID NOs, not versions of them that that comprise a nt sequence of SEQ ID NO 134 or 56 or SEQ ID NO 135 or 55 or are as short as 2-mer. Regarding the ITRs operably linked to the gRNAs, the wildtype (WT) ITRs, and the mutant ITRs, the Spec. discloses (¶17, ¶156-157) some ITR sequences for AAV ITRs. Those ¶ teach the self-complementary vector comprises a mutant ITR that directs vector genome replication to generate a self-complementary vector genome. But the Spec. doesn’t disclose what sequence or sequence anomaly produce what they are calling a mutant ITR direct or that this genome replication to generate a self-complementary vector genome. A person of ordinary skill would understand that a mutant ITR encompasses a ginormous number of alternations vs. a WT ITR but the Spec. never discloses what has to be different to direc[t] vector genome replication to generate a self-complementary vector genome or what has to stay the same to be a WT ITR. Furthermore, nothing in the Spec. discusses or provides examples or sequences of any ITRs besides for AAV ITRs and the specific SEQ ID NOs disclosed. Regarding the ubiquitous promoter and the tissue-specific promoter, the Spec. mentions those promoters including at ¶10 and ¶150. Those passages disclose various species of ubiquitous and tissue-specific promoters but they do not disclose the structure that renders a promoter ubiquitous or tissue-specific. Regarding the Cas9 gRNA scaffold sequence, the Spec. discloses (¶10, ¶132) characteristics of the gRNA scaffold and some SEQ ID NOs for a Cas9 gRNA scaffold. That teaches (¶132) a gRNA scaffold facilitates Cas9 binding to the gRNA and may facilitate endonuclease activity. However, those passages do not disclose the structure that facilitates Cas9 binding to the gRNA or which may facilitate endonuclease activity. The Spec. describes examples of the claimed dual vector system (¶182-185, Claim 3). Those examples show using the dual vector system to remove exons 45-55. Example 10 (starts at ¶231, Figs. 20, 25) uses a different from what is claimed (each vector encodes a Cas9 and a gRNA rather than both gRNA being on a single vector) to excise exon 51. Example 12 (starts at ¶234, Figs. 15-19, 22) compares three approaches at excising exons 45-55: Approach #1 (same as what’s used in Example 10), Approach #2 (what is claimed in Claim 3), and Approach #3 (what is claimed in Claim 6). Example 13 (¶239, Fig. 23, 26-28) examined the effect of using Approach #3 (self-complementary gRNA; Claim 6) in comparison with unclaimed approaches and found the approach claimed in Claim 6 results in better deletion and some other potential improvements (Figs. 23EF). Other examples that don’t test the claimed dual vector invention target exon 52. Altogether, the Examples discuss excising exons 51, 52, and 45-55. Those experiments are inadequate to substantiate possession of the full breadth of the invention as claimed because they describe gRNAs targeting only some portions of DMD, not any intron or any exon. The art of Loboda (et al. 2025. Genetic strategies for therapy of Duchenne muscular dystrophy. Mol. Ther. Nuc. Ac. 36, “Loboda”) teaches (§Introduction ¶1-2, Fig. 1) the DMD gene is over 2.4 million bp and comprises 79 exons and 78 introns. Furthermore, an artisan would understand that a patient suffering from muscular dystrophy can have a mutation in any portion of the DMD gene, including (§Introduction ¶1) de novo mutations which can be unique to an individual. An artisan understands that for a gRNA to function, it must base pair to its target. Yet, Loboda teaches the target is huge (in the best case scenario wherein the sequence is known) and that the target sequence can differ due to mutations including de novo mutations. That indicates that the number of gRNAs that can target any intron or exon of DMD is a ginormous number. The Spec. doesn’t demonstrate possession of a representative number of gRNAs commensurate to the breadth of the claims. Regarding what structure is encompassed by the gRNA targeting any intron or exon of dystrophin, the ITRs (including the WT and mutant ITRs and AAV ITRs), the ubiquitous and tissue-specific promoters, the Cas9 gRNA scaffold sequence, and the guide sequences that comprise a nt sequence of SEQ ID NO 134 or 56 or SEQ ID NO 135 or 55, the Spec. does not provide information describing its features. The Spec. does not disclose what physical structure responsible for the claimed function. Applicant’s examples show gRNAs that target regions for excising exons 51, 52, and 45-55. However, those examples are not sufficient to provide written description support for the broad genera of gRNAs targeting any intron or exon of dystrophin, the ITRs (including the WT and mutant ITRs and AAV ITRs), the ubiquitous and tissue-specific promoters, the Cas9 gRNA scaffold sequence, and the guide sequences that comprise a nt sequence of SEQ ID NO 134 or 56 or SEQ ID NO 135 or 55. Although the claims claim the functional characteristics (i.e., targeting any intron or exon of dystrophin, functioning as an ITR or mutant ITR, promoting a gene ubiquitously or in a tissue-specific manner, holding a gRNA sequence in the Cas9 enzyme, and targeting any intron of a dystrophin gene while comprising a nt sequence of SEQ ID NO 134 or 56 or SEQ ID NO 135 or 55), the functional characteristic is not coupled with any known structure. Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s). The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for targeting any intron or exon of dystrophin, functioning as an ITR or mutant ITR, promoting a gene ubiquitously or in a tissue-specific manner, holding a gRNA sequence in the Cas9 enzyme, and targeting any intron of a dystrophin gene while comprising a nt sequence of SEQ ID NO 134 or 56 or SEQ ID NO 135 or 55 in such a way to demonstrate possession of the full invention as claimed at time of filing. The gRNAs that target any intron or any exon of any DMD (including gRNAs that comprise a nt sequence of recited SEQ ID NOs), the various WT and mutant ITRs of any virus or any AAV, the ubiquitous promoters and tissue-specific promoters for any tissue, and the Cas9 gRNA scaffold sequences do not share a core structure. The specification teaches only a limited number species within the claimed genus/genera (as discussed above) but those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims. While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 3, 6, 9-10, 15, 35-36, 46, and 51 are rejected for failing to demonstrate possession of the claimed invention. Claims 6, 9-10, 15, 18, 23-24, 29-31, 34-37, 46, 51, and 79 are rejected because they depend from Claim(s) 3, 6, 9-10, 15, 35-36, 46, and/or 51 and do not remedy the issues. Regarding Claims 30 and 79, the Spec. discloses (p. 144-147) the vector sequence comprising SEQ ID NO 92 comprises all of the elements recited in Claim 46. An alignment of SEQ ID NO 92 to SEQ ID NO 131 shows they are 100% identical. A claim directed solely to SEQ ID NOs 92 and 131 would not be subject to this rejection. However, the same § of the Spec. shows that the vector sequence comprising SEQ ID NO 91 does not comprise a second ITR so a claim reciting that SEQ ID NO is subject to this rejection. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 10, and 36 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 10 recites the limitation "…wherein the vector genome replicated from the first vector…" in L5. Claim 36 recites the limitation "…wherein vector genome replication from the at least one vector …" in L1-2. There is insufficient antecedent basis for this limitation in the claims because the claims don’t recite any vector genome replicated from the first vector (Claim 10) or vector genome replication from the at least one vector (Claim 36), and neither does either of the claims from which Claim 10 depends (i.e., Claims 3 and 9) or from which Claim 36 depends (i.e., Claims 3, 9, and 35). Claims 10 and 36 are rejected for those reasons. In the interest of compact prosecution, the second clause of Claim 10 (i.e., and/or wherein the vector genome replicated from the first vector is self-complementary and comprises 5'-[wild-type ITR]-[promoter]-[first gRNA]-[promoter]-[second gRNA]-[mutant ITR]-[second gRNA]-[promoter]-[first gRNA]-[promoter]-[wild-type ITR]-3' and forms a double-stranded RNA hairpin) is interpreted to depend from Claim 6. In the interest of compact prosecution, Claim 36 is interpreted to depend from a version of Claim 9 that depends from Claim 6. A claim may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173. In the present instance, Claim 36 recites the system of claim 35, wherein vector genome replication from the at least one vector results in a genome comprising, from the 5' to 3' direction: (a) a complementary sequence of the second ITR; (b) a complementary sequence of the second gRNA; (c) a complementary sequence of the second promoter; (d) a complementary sequence of the Cas9 gRNA scaffold; (e) a complementary sequence of the first gRNA; (f) a complementary sequence of the first promoter; (h) the first ITR; (i) the first promoter; (g) the first gRNA; (k) the Cas9 gRNA scaffold; (I) the second promoter; (m) the second gRNA; and (n) the second ITR. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. It is not clear what is meant by the recitation …wherein vector genome replication from the at least one vector results in a genome comprising, from the 5' to 3' direction: (a)… (n)…. As discussed above, the claim dependency is incorrect and besides for that, the text of the claim renders its metes and bounds indefinite. Claim 36 is rejected for those reasons. In the interest of compact prosecution, Claim 36 is interpreted to mean that when a scAAV (recited in Claim 6) comprising the ITRs, promoters, and gRNAs replicates, it will produce a complementary version of itself. For the purpose of applying art, as long as the art teaches or makes obvious all the individual elements of the claim, the vector recited in Claim 36 that results in the recited genome will be an inevitable outcome that flows from a scAAV vector comprising those elements. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 36 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 35 requires (d) and (g) two Cas9 gRNA scaffolds but Claim 36 requires only (k) one Cas9 gRNA scaffold. Therefore Claim 36 fails to include all the limitations of Claim 35. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claim 37 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). Claim 37 recites a cell comprising the system and that could be interpreted to read on a human. Amending the claim to recite an isolated cell comprising the system…, as appropriate, would obviate this rejection. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 3, 9, 15, 18, 23-24, 29, 31, and 37 are rejected under 35 U.S.C. 102(a)(1) as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over US Patent Application Publication No. 2019/0048337 (published 14 February 2019, “App337”, of record on IDS) as evidenced by Naso (et al. 2017. Adeno-Associated Virus (AAV) as a Vector for Gene Therapy. BioDrugs 31:317, “Naso”) and as evidenced by Addgene (“CRISPR Guide”. Page archived on 20 February 2020. Accessed via Wayback Machine, “Addgene”, of record). App337 teaches (¶36-37) (a) a first nucleotide sequence that encodes a first gRNA molecule that targets a DMD gene, (b) a second nucleotide sequence that encodes a Cas9 molecule, and (c) a third nucleotide sequence that encodes a second gRNA that targets a DMD gene. App337 teaches (¶81) the Cas9 can be present on a first AAV vector while the two gRNAs can be present on a second AAV vector. App337 teaches (¶29) the gRNA can target an exon or an intron. Regarding Claims 3 and 31: App337 teaches (¶1050 and ¶1144) the AAV vector can comprise ITR sequences that promote packaging into a capsid. App337 teaches (¶1144) the AAV vector comprises an expression cassette encoding components to be expressed. App337 teaches (¶76-81) the AAV vectors can be AAV2. Regarding the flanking ITRs, Naso provides evidence that (§2 Adeno-Associated Virus (AAV) Vector Designs, Fig. 1) an AAV vector used for gene therapy, including AAV2, places components to be expressed between an upstream ITR and a downstream ITR. Therefore the teachings of App337 inherently encompass all the limitations of Claims 3 and 31. Alternatively, it would have been obvious to a person of ordinary skill in the art to use the flanking ITRs of App337 and Naso around the gRNA sequences of App337 for the benefit of producing a productive AAV vector. One would have been motivated to do so with a reasonable expectation of success because App337 and Naso indicate it was routine and conventional in the art of gene therapy to place genes within a pair of ITRs and because Naso teaches (§1 Introduction ¶3) the ITRs are required for genome replication and packaging. Therefore the limitations of Claims 3 and 31 would have been obvious in view of App337 and Naso. Regarding Claims 9 and 15: App337 teaches (¶86-87) (1) the nt sequences encoding the first and second gRNAs and (2) the Cas9 molecule can each be operably linked to their own promoters and (¶1124) the promoters (which effect expression) can be a tissue-specific promoter including H1 or U6. Therefore App337 teaches all the limitations of Claims 9 and 15. Regarding Claim 18: App337 teaches (¶524, ¶554, Fig. 7) including tracrRNA sequences. App337 describes (¶525-531, ¶1253-1257, Fig. 1) gRNA scaffold sequences that allow the Cas enzyme to hold the gRNA. A person of ordinary skill in the art understands that (see Addgene §CRISPR Overview, ¶2; §Glossary, entry “gRNA”) a tracrRNA sequence is a Cas9 scaffold sequence. Furthermore, Addgene teaches (§Glossary) a gRNA is a synthetic fusion of the endogenous bacterial crRNA and tracrRNA that provides both targeting specificity and scaffolding/binding ability for Cas9 nuclease and a gRNA scaffold sequence is the sequence within the gRNA that is responsible for Cas9 binding, it does not include the 20 bp spacer/targeting sequence that is used to guide Cas9 to target DNA. App337 teaches (Fig. 1I, ¶199) an exemplary structure of a gRNA molecule that comprises SEQ ID NO 38. A modified version of that figure is shown here: PNG media_image1.png 349 657 media_image1.png Greyscale The NNN… represent the target-specific gRNA. The following alignment shows that App337 SEQ ID NO 38 comprises a region of 100% identity to claimed SEQ ID NO 138: US-15-732-190-38 Filing date in PALM: 2017-09-29 Sequence 38, US/15732190 Publication No. US20190048337A1 GENERAL INFORMATION APPLICANT: EDITAS MEDICINE APPLICANT: HSU, Patrick David APPLICANT: MAEDER, Morgan Lee APPLICANT: ODONNELL, Penrose APPLICANT: TYCKO, Joshua C. APPLICANT: HUSTON, Nicholas C. TITLE OF INVENTION: CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING DUCHENNE TITLE OF INVENTION: MUSCULAR DYSTROPHY AND BECKER MUSCULAR DYSTROPHY FILE REFERENCE: 084177.0121 CURRENT APPLICATION NUMBER: US/15/732,190 CURRENT FILING DATE: 2017-09-29 PRIOR APPLICATION NUMBER: US 62/141,833 PRIOR FILING DATE: 2015-04-01 PRIOR APPLICATION NUMBER: US 62/310,479 PRIOR FILING DATE: 2016-03-18 NUMBER OF SEQ ID NOS: 826649 SEQ ID NO 38 LENGTH: 102 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Unimolecular gRNA derived from S. aureus FEATURE: NAME/KEY: misc_feature LOCATION: (1)..(20) OTHER INFORMATION: n is a, c, g, or u FEATURE: NAME/KEY: misc_feature LOCATION: (1)..(20) OTHER INFORMATION: Targeting domain Query Match 100.0%; Score 81; Length 102; Best Local Similarity 66.7%; Matches 54; Conservative 27; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGT 60 SEQ ID NO 138 |::::||:||:|:||||||||||:|:||:||||||||||||||:||||:|:::|:|:||: Db 21 GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGU 80 App337 SEQ #38 Qy 61 CAACTTGTTGGCGAGATTTTT 81 ||||::|::|||||||::::: Db 81 CAACUUGUUGGCGAGAUUUUU 101 That alignment indicates that App337 teaches a Cas9 gRNA scaffold comprising the polynt of claimed SEQ ID NO 138. Therefore App337 anticipates Claim 18. Regarding Claim 23: App337 teaches (¶27): two or more gRNAs are used to position breaks, e.g., two single stranded breaks or two double stranded breaks, or a combination of single strand and double strand breaks, e.g., to create one or more indels or deletions, in the DMD gene sequence, wherein the targeting domains of each gRNAs can comprise nucleotide sequences set forth in SEQ ID NOs: 206-826366. App337 discloses SEQ ID NO 68759 which is a 22-mer that is 100% complementary to claimed SEQ ID NO 57 and SEQ ID NO 41113 which is a 24-mer 100% identical to claimed SEQ ID NO 55, as shown by the following alignments: RESULT 2 US-15-732-190-68579/c (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) Sequence 68579, US/15732190 Publication No. US20190048337A1 GENERAL INFORMATION APPLICANT: EDITAS MEDICINE APPLICANT: HSU, Patrick David APPLICANT: MAEDER, Morgan Lee APPLICANT: ODONNELL, Penrose APPLICANT: TYCKO, Joshua C. APPLICANT: HUSTON, Nicholas C. TITLE OF INVENTION: CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING DUCHENNE TITLE OF INVENTION: MUSCULAR DYSTROPHY AND BECKER MUSCULAR DYSTROPHY FILE REFERENCE: 084177.0121 CURRENT APPLICATION NUMBER: US/15/732,190 CURRENT FILING DATE: 2017-09-29 PRIOR APPLICATION NUMBER: US 62/141,833 PRIOR FILING DATE: 2015-04-01 PRIOR APPLICATION NUMBER: US 62/310,479 PRIOR FILING DATE: 2016-03-18 NUMBER OF SEQ ID NOS: 826649 SEQ ID NO 68579 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Query Match 100.0%; Score 22; Length 22; Best Local Similarity 63.6%; Matches 14; Conservative 8; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACAUUUCCUCUCUAUACAAAUG 22 SEQ ID NO 57 |||:::||:|:|:|:|||||:| Db 22 ACATTTCCTCTCTATACAAATG 1 SEQ ID NO 68579 RESULT 1 US-15-732-190-41113 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 41113, US/15732190 Publication No. US20190048337A1 GENERAL INFORMATION APPLICANT: EDITAS MEDICINE APPLICANT: HSU, Patrick David APPLICANT: MAEDER, Morgan Lee APPLICANT: ODONNELL, Penrose APPLICANT: TYCKO, Joshua C. APPLICANT: HUSTON, Nicholas C. TITLE OF INVENTION: CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING DUCHENNE TITLE OF INVENTION: MUSCULAR DYSTROPHY AND BECKER MUSCULAR DYSTROPHY FILE REFERENCE: 084177.0121 CURRENT APPLICATION NUMBER: US/15/732,190 CURRENT FILING DATE: 2017-09-29 PRIOR APPLICATION NUMBER: US 62/141,833 PRIOR FILING DATE: 2015-04-01 PRIOR APPLICATION NUMBER: US 62/310,479 PRIOR FILING DATE: 2016-03-18 NUMBER OF SEQ ID NOS: 826649 SEQ ID NO 41113 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Query Match 100.0%; Score 24; Length 24; Best Local Similarity 100.0%; Matches 24; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AUAUAGUAAUGAAAUUAUUGGCAC 24 SEQ ID NO 58 |||||||||||||||||||||||| Db 1 AUAUAGUAAUGAAAUUAUUGGCAC 24 SEQ ID NO 41113 App337 teaches (¶545) the targeting domain can comprise a core domain that is complementary to the target and that (¶1013-1014) in some embodiments the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecules are complementary to opposite strands of the target nucleic acid molecule. Therefore the gRNAs disclosed by App337 encompass claimed SEQ ID NOs 55/135 and SEQ ID NO 57/137 and claimed SEQ ID NOs 56/134 and SEQ ID NOs 58/136. As discussed in §Claim interpretation, what is called a first or second gRNA is merely terminology to distinguish two separate gRNAs from one another. Therefore App337 anticipates Claims 23-24. Alternatively, it would have been obvious to a person of ordinary skill in the art to use the gRNA sequences of App337 to target opposite strands of the DMD gene for the benefit of inducing a double-stranded break. One would have been motivated to do so with a reasonable expectation of success because App337 teaches (¶1012-1014) inducing nicks on opposite strands to control the kind of repair machinery used by the cell. Therefore the limitations of Claims 23-24 (and some limitations of Claim 51) would have been obvious in view of App337. Regarding Claim 29: App337 teaches (¶103) their composition comprises at least one S. aureus Cas9 molecule and teaches (¶957) the exemplary codon optimized nucleic acid sequence encoding an S. aureus Cas9 molecule that is SEQ ID NO 8. The following alignment shows that App337 SEQ ID NO 8 comprises a polynt comprising 100% identity to claimed SEQ ID NO 69: US-15-732-190-8 Filing date in PALM: 2017-09-29 Sequence 8, US/15732190 Publication No. US20190048337A1 GENERAL INFORMATION APPLICANT: EDITAS MEDICINE APPLICANT: HSU, Patrick David APPLICANT: MAEDER, Morgan Lee APPLICANT: ODONNELL, Penrose APPLICANT: TYCKO, Joshua C. APPLICANT: HUSTON, Nicholas C. TITLE OF INVENTION: CRISPR/CAS-RELATED METHODS AND COMPOSITIONS FOR TREATING DUCHENNE TITLE OF INVENTION: MUSCULAR DYSTROPHY AND BECKER MUSCULAR DYSTROPHY FILE REFERENCE: 084177.0121 CURRENT APPLICATION NUMBER: US/15/732,190 CURRENT FILING DATE: 2017-09-29 PRIOR APPLICATION NUMBER: US 62/141,833 PRIOR FILING DATE: 2015-04-01 PRIOR APPLICATION NUMBER: US 62/310,479 PRIOR FILING DATE: 2016-03-18 NUMBER OF SEQ ID NOS: 826649 SEQ ID NO 8 LENGTH: 3159 TYPE: DNA ORGANISM: Staphylococcus aureus Query Match 100.0%; Score 3156; Length 3159; Best Local Similarity 100.0%; Matches 3156; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGCGGAACTACATCCTGGGCCTGGACATCGGCATCACCAGCGTGGGCTACGGCATCATC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4 AAGCGGAACTACATCCTGGGCCTGGACATCGGCATCACCAGCGTGGGCTACGGCATCATC 63 Qy 61 GACTACGAGACACGGGACGTGATCGATGCCGGCGTGCGGCTGTTCAAAGAGGCCAACGTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 64 GACTACGAGACACGGGACGTGATCGATGCCGGCGTGCGGCTGTTCAAAGAGGCCAACGTG 123 Qy 121 GAAAACAACGAGGGCAGGCGGAGCAAGAGAGGCGCCAGAAGGCTGAAGCGGCGGAGGCGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 124 GAAAACAACGAGGGCAGGCGGAGCAAGAGAGGCGCCAGAAGGCTGAAGCGGCGGAGGCGG 183 Qy 181 CATAGAATCCAGAGAGTGAAGAAGCTGCTGTTCGACTACAACCTGCTGACCGACCACAGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 184 CATAGAATCCAGAGAGTGAAGAAGCTGCTGTTCGACTACAACCTGCTGACCGACCACAGC 243 Qy 241 GAGCTGAGCGGCATCAACCCCTACGAGGCCAGAGTGAAGGGCCTGAGCCAGAAGCTGAGC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 244 GAGCTGAGCGGCATCAACCCCTACGAGGCCAGAGTGAAGGGCCTGAGCCAGAAGCTGAGC 303 Qy 301 GAGGAAGAGTTCTCTGCCGCCCTGCTGCACCTGGCCAAGAGAAGAGGCGTGCACAACGTG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 304 GAGGAAGAGTTCTCTGCCGCCCTGCTGCACCTGGCCAAGAGAAGAGGCGTGCACAACGTG 363 Qy 361 AACGAGGTGGAAGAGGACACCGGCAACGAGCTGTCCACCAAAGAGCAGATCAGCCGGAAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 364 AACGAGGTGGAAGAGGACACCGGCAACGAGCTGTCCACCAAAGAGCAGATCAGCCGGAAC 423 Qy 421 AGCAAGGCCCTGGAAGAGAAATACGTGGCCGAACTGCAGCTGGAACGGCTGAAGAAAGAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 424 AGCAAGGCCCTGGAAGAGAAATACGTGGCCGAACTGCAGCTGGAACGGCTGAAGAAAGAC 483 Qy 481 GGCGAAGTGCGGGGCAGCATCAACAGATTCAAGACCAGCGACTACGTGAAAGAAGCCAAA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 484 GGCGAAGTGCGGGGCAGCATCAACAGATTCAAGACCAGCGACTACGTGAAAGAAGCCAAA 543 Qy 541 CAGCTGCTGAAGGTGCAGAAGGCCTACCACCAGCTGGACCAGAGCTTCATCGACACCTAC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 544 CAGCTGCTGAAGGTGCAGAAGGCCTACCACCAGCTGGACCAGAGCTTCATCGACACCTAC 603 Qy 601 ATCGACCTGCTGGAAACCCGGCGGACCTACTATGAGGGACCTGGCGAGGGCAGCCCCTTC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 604 ATCGACCTGCTGGAAACCCGGCGGACCTACTATGAGGGACCTGGCGAGGGCAGCCCCTTC 663 Qy 661 GGCTGGAAGGACATCAAAGAATGGTACGAGATGCTGATGGGCCACTGCACCTACTTCCCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 664 GGCTGGAAGGACATCAAAGAATGGTACGAGATGCTGATGGGCCACTGCACCTACTTCCCC 723 Qy 721 GAGGAACTGCGGAGCGTGAAGTACGCCTACAACGCCGACCTGTACAACGCCCTGAACGAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 724 GAGGAACTGCGGAGCGTGAAGTACGCCTACAACGCCGACCTGTACAACGCCCTGAACGAC 783 Qy 781 CTGAACAATCTCGTGATCACCAGGGACGAGAACGAGAAGCTGGAATATTACGAGAAGTTC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 784 CTGAACAATCTCGTGATCACCAGGGACGAGAACGAGAAGCTGGAATATTACGAGAAGTTC 843 Qy 841 CAGATCATCGAGAACGTGTTCAAGCAGAAGAAGAAGCCCACCCTGAAGCAGATCGCCAAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 844 CAGATCATCGAGAACGTGTTCAAGCAGAAGAAGAAGCCCACCCTGAAGCAGATCGCCAAA 903 Qy 901 GAAATCCTCGTGAACGAAGAGGATATTAAGGGCTACAGAGTGACCAGCACCGGCAAGCCC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 904 GAAATCCTCGTGAACGAAGAGGATATTAAGGGCTACAGAGTGACCAGCACCGGCAAGCCC 963 Qy 961 GAGTTCACCAACCTGAAGGTGTACCACGACATCAAGGACATTACCGCCCGGAAAGAGATT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 964 GAGTTCACCAACCTGAAGGTGTACCACGACATCAAGGACATTACCGCCCGGAAAGAGATT 1023 Qy 1021 ATTGAGAACGCCGAGCTGCTGGATCAGATTGCCAAGATCCTGACCATCTACCAGAGCAGC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1024 ATTGAGAACGCCGAGCTGCTGGATCAGATTGCCAAGATCCTGACCATCTACCAGAGCAGC 1083 Qy 1081 GAGGACATCCAGGAAGAACTGACCAATCTGAACTCCGAGCTGACCCAGGAAGAGATCGAG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1084 GAGGACATCCAGGAAGAACTGACCAATCTGAACTCCGAGCTGACCCAGGAAGAGATCGAG 1143 Qy 1141 CAGATCTCTAATCTGAAGGGCTATACCGGCACCCACAACCTGAGCCTGAAGGCCATCAAC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1144 CAGATCTCTAATCTGAAGGGCTATACCGGCACCCACAACCTGAGCCTGAAGGCCATCAAC 1203 Qy 1201 CTGATCCTGGACGAGCTGTGGCACACCAACGACAACCAGATCGCTATCTTCAACCGGCTG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1204 CTGATCCTGGACGAGCTGTGGCACACCAACGACAACCAGATCGCTATCTTCAACCGGCTG 1263 Qy 1261 AAGCTGGTGCCCAAGAAGGTGGACCTGTCCCAGCAGAAAGAGATCCCCACCACCCTGGTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1264 AAGCTGGTGCCCAAGAAGGTGGACCTGTCCCAGCAGAAAGAGATCCCCACCACCCTGGTG 1323 Qy 1321 GACGACTTCATCCTGAGCCCCGTCGTGAAGAGAAGCTTCATCCAGAGCATCAAAGTGATC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1324 GACGACTTCATCCTGAGCCCCGTCGTGAAGAGAAGCTTCATCCAGAGCATCAAAGTGATC 1383 Qy 1381 AACGCCATCATCAAGAAGTACGGCCTGCCCAACGACATCATTATCGAGCTGGCCCGCGAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1384 AACGCCATCATCAAGAAGTACGGCCTGCCCAACGACATCATTATCGAGCTGGCCCGCGAG 1443 Qy 1441 AAGAACTCCAAGGACGCCCAGAAAATGATCAACGAGATGCAGAAGCGGAACCGGCAGACC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1444 AAGAACTCCAAGGACGCCCAGAAAATGATCAACGAGATGCAGAAGCGGAACCGGCAGACC 1503 Qy 1501 AACGAGCGGATCGAGGAAATCATCCGGACCACCGGCAAAGAGAACGCCAAGTACCTGATC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1504 AACGAGCGGATCGAGGAAATCATCCGGACCACCGGCAAAGAGAACGCCAAGTACCTGATC 1563 Qy 1561 GAGAAGATCAAGCTGCACGACATGCAGGAAGGCAAGTGCCTGTACAGCCTGGAAGCCATC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1564 GAGAAGATCAAGCTGCACGACATGCAGGAAGGCAAGTGCCTGTACAGCCTGGAAGCCATC 1623 Qy 1621 CCTCTGGAAGATCTGCTGAACAACCCCTTCAACTATGAGGTGGACCACATCATCCCCAGA 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1624 CCTCTGGAAGATCTGCTGAACAACCCCTTCAACTATGAGGTGGACCACATCATCCCCAGA 1683 Qy 1681 AGCGTGTCCTTCGACAACAGCTTCAACAACAAGGTGCTCGTGAAGCAGGAAGAAAACAGC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1684 AGCGTGTCCTTCGACAACAGCTTCAACAACAAGGTGCTCGTGAAGCAGGAAGAAAACAGC 1743 Qy 1741 AAGAAGGGCAACCGGACCCCATTCCAGTACCTGAGCAGCAGCGACAGCAAGATCAGCTAC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1744 AAGAAGGGCAACCGGACCCCATTCCAGTACCTGAGCAGCAGCGACAGCAAGATCAGCTAC 1803 Qy 1801 GAAACCTTCAAGAAGCACATCCTGAATCTGGCCAAGGGCAAGGGCAGAATCAGCAAGACC 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1804 GAAACCTTCAAGAAGCACATCCTGAATCTGGCCAAGGGCAAGGGCAGAATCAGCAAGACC 1863 Qy 1861 AAGAAAGAGTATCTGCTGGAAGAACGGGACATCAACAGGTTCTCCGTGCAGAAAGACTTC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1864 AAGAAAGAGTATCTGCTGGAAGAACGGGACATCAACAGGTTCTCCGTGCAGAAAGACTTC 1923 Qy 1921 ATCAACCGGAACCTGGTGGATACCAGATACGCCACCAGAGGCCTGATGAACCTGCTGCGG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1924 ATCAACCGGAACCTGGTGGATACCAGATACGCCACCAGAGGCCTGATGAACCTGCTGCGG 1983 Qy 1981 AGCTACTTCAGAGTGAACAACCTGGACGTGAAAGTGAAGTCCATCAATGGCGGCTTCACC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1984 AGCTACTTCAGAGTGAACAACCTGGACGTGAAAGTGAAGTCCATCAATGGCGGCTTCACC 2043 Qy 2041 AGCTTTCTGCGGCGGAAGTGGAAGTTTAAGAAAGAGCGGAACAAGGGGTACAAGCACCAC 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2044 AGCTTTCTGCGGCGGAAGTGGAAGTTTAAGAAAGAGCGGAACAAGGGGTACAAGCACCAC 2103 Qy 2101 GCCGAGGACGCCCTGATCATTGCCAACGCCGATTTCATCTTCAAAGAGTGGAAGAAACTG 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2104 GCCGAGGACGCCCTGATCATTGCCAACGCCGATTTCATCTTCAAAGAGTGGAAGAAACTG 2163 Qy 2161 GACAAGGCCAAAAAAGTGATGGAAAACCAGATGTTCGAGGAAAAGCAGGCCGAGAGCATG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2164 GACAAGGCCAAAAAAGTGATGGAAAACCAGATGTTCGAGGAAAAGCAGGCCGAGAGCATG 2223 Qy 2221 CCCGAGATCGAAACCGAGCAGGAGTACAAAGAGATCTTCATCACCCCCCACCAGATCAAG 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2224 CCCGAGATCGAAACCGAGCAGGAGTACAAAGAGATCTTCATCACCCCCCACCAGATCAAG 2283 Qy 2281 CACATTAAGGACTTCAAGGACTACAAGTACAGCCACCGGGTGGACAAGAAGCCTAATAGA 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2284 CACATTAAGGACTTCAAGGACTACAAGTACAGCCACCGGGTGGACAAGAAGCCTAATAGA 2343 Qy 2341 GAGCTGATTAACGACACCCTGTACTCCACCCGGAAGGACGACAAGGGCAACACCCTGATC 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2344 GAGCTGATTAACGACACCCTGTACTCCACCCGGAAGGACGACAAGGGCAACACCCTGATC 2403 Qy 2401 GTGAACAATCTGAACGGCCTGTACGACAAGGACAATGACAAGCTGAAAAAGCTGATCAAC 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2404 GTGAACAATCTGAACGGCCTGTACGACAAGGACAATGACAAGCTGAAAAAGCTGATCAAC 2463 Qy 2461 AAGAGCCCCGAAAAGCTGCTGATGTACCACCACGACCCCCAGACCTACCAGAAACTGAAG 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2464 AAGAGCCCCGAAAAGCTGCTGATGTACCACCACGACCCCCAGACCTACCAGAAACTGAAG 2523 Qy 2521 CTGATTATGGAACAGTACGGCGACGAGAAGAATCCCCTGTACAAGTACTACGAGGAAACC 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2524 CTGATTATGGAACAGTACGGCGACGAGAAGAATCCCCTGTACAAGTACTACGAGGAAACC 2583 Qy 2581 GGGAACTACCTGACCAAGTACTCCAAAAAGGACAACGGCCCCGTGATCAAGAAGATTAAG 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2584 GGGAACTACCTGACCAAGTACTCCAAAAAGGACAACGGCCCCGTGATCAAGAAGATTAAG 2643 Qy 2641 TATTACGGCAACAAACTGAACGCCCATCTGGACATCACCGACGACTACCCCAACAGCAGA 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2644 TATTACGGCAACAAACTGAACGCCCATCTGGACATCACCGACGACTACCCCAACAGCAGA 2703 Qy 2701 AACAAGGTCGTGAAGCTGTCCCTGAAGCCCTACAGATTCGACGTGTACCTGGACAATGGC 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2704 AACAAGGTCGTGAAGCTGTCCCTGAAGCCCTACAGATTCGACGTGTACCTGGACAATGGC 2763 Qy 2761 GTGTACAAGTTCGTGACCGTGAAGAATCTGGATGTGATCAAAAAAGAAAACTACTACGAA 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2764 GTGTACAAGTTCGTGACCGTGAAGAATCTGGATGTGATCAAAAAAGAAAACTACTACGAA 2823 Qy 2821 GTGAATAGCAAGTGCTATGAGGAAGCTAAGAAGCTGAAGAAGATCAGCAACCAGGCCGAG 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2824 GTGAATAGCAAGTGCTATGAGGAAGCTAAGAAGCTGAAGAAGATCAGCAACCAGGCCGAG 2883 Qy 2881 TTTATCGCCTCCTTCTACAACAACGATCTGATCAAGATCAACGGCGAGCTGTATAGAGTG 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2884 TTTATCGCCTCCTTCTACAACAACGATCTGATCAAGATCAACGGCGAGCTGTATAGAGTG 2943 Qy 2941 ATCGGCGTGAACAACGACCTGCTGAACCGGATCGAAGTGAACATGATCGACATCACCTAC 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2944 ATCGGCGTGAACAACGACCTGCTGAACCGGATCGAAGTGAACATGATCGACATCACCTAC 3003 Qy 3001 CGCGAGTACCTGGAAAACATGAACGACAAGAGGCCCCCCAGGATCATTAAGACAATCGCC 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3004 CGCGAGTACCTGGAAAACATGAACGACAAGAGGCCCCCCAGGATCATTAAGACAATCGCC 3063 Qy 3061 TCCAAGACCCAGAGCATTAAGAAGTACAGCACAGACATTCTGGGCAACCTGTATGAAGTG 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3064 TCCAAGACCCAGAGCATTAAGAAGTACAGCACAGACATTCTGGGCAACCTGTATGAAGTG 3123 Qy 3121 AAATCTAAGAAGCACCCTCAGATCATCAAAAAGGGC 3156 Claimed SEQ ID NO 69 |||||||||||||||||||||||||||||||||||| Db 3124 AAATCTAAGAAGCACCCTCAGATCATCAAAAAGGGC 3159 App337 SEQ ID NO 8 Therefore App337 anticipates Claim 29. Regarding Claim 37: App337 teaches (¶171) a cell comprising the composition, thereby anticipating Claim 37. App337 teaches (¶1139, ¶1142) self-complementary AAV vectors. App337 teaches (¶1182) a two-vector delivery system wherein the gRNA molecules and Cas9 are packaged in separate delivery vehicles enhances tissue-specificity. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 3, 6, 9, 15, 18, 23-24, 29, 31, and 37 are rejected under 35 U.S.C. 103 as being unpatentable over US Patent Application Publication No. 2019/0048337 (published 14 February 2019, “App337”, of record on IDS) as evidenced by Naso (et al. 2017. Adeno-Associated Virus (AAV) as a Vector for Gene Therapy. BioDrugs 31:317, “Naso”) and Addgene (“CRISPR Guide”. Page archived on 20 February 2020. Accessed via Wayback Machine, “Addgene”, of record) as applied to Claim(s) 3, 9, 15, 18, 23-24, 29, 31, and 37 in the 102/103 rejection above, and further in view of the references McCarty (et al. 2003. Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. 10:2112, “McCarty”) and US Patent Application Publication No. US 2018/0110878 (published 26 April 2018, “App878). The teachings of App337 as evidenced by Naso and Addgene as applicable to Claim(s) 3, 9, 15, 18, 23-24, 29, 31, and 37 have been discussed in the 102/103 rejection above. App337 as evidenced by Naso and Addgene teaches: a CRISPR-Cas dual vector system comprising: (a) a first vector encoding a first ITR upstream of a first gRNA targeting an intron or an exon of dystrophin and a second gRNA targeting an intron or an exon of dystrophin, and a second ITR downstream of the first and second gRNAs; and (b) a second vector encoding a Cas9 protein, wherein each vector can comprise a promoter operably linked to each gRNA an to the Cas9 protein, wherein the promoters can be U6 or H1 promoters or a tissue specific promoter; wherein the gRNAs can comprise SEQ ID NOs 55/135/57/137 and SEQ ID NOs 56/134/58/136; wherein the vector can be AAV2; and to a cell comprising the system. A person of ordinary skill would readily determine that App337’s gRNA shown above in the 102/103 rejection target introns of the DMD gene. App337 (as evidenced by Naso and Addgene) also makes obvious all the limitations of Claims 3, 9, 15, 18, 23-24, 29, 31, and 37 because it teaches all the individual elements as explained in the 102/103 rejection above and it would have been obvious to an person of ordinary skill to mix and match those various known elements for the benefit of optimizing App337’s two vector system. Therefore all the limitations of Claims 3, 9, 15, 18, 23-24, 29, 31, and 37 would have been obvious to an artisan of ordinary skill in view of App337 as evidenced by Naso and Addgene. App337 as evidenced by Naso does not teach the first ITR is a wildtype (WT) ITR and the second ITR is a mutant ITR that directs vector genome replication to generate a self-complementary transcript that forms a double-stranded (ds) polynucleotide (polynt) (i.e., Claim 6). App337 doesn’t teach the WT ITR comprises a polynt having SEQ ID NO 61 (i.e., Claim 6). App337 doesn’t explicitly teach the vector genome replicated from the first vector comprises elements that form a ds-RNA hairpin (an optional limitation of Claim 10). However, McCarty teaches (§Abstract, §Discussion) self-complementary (sc) AAV vectors that comprise a mutated ITR which generate single-stranded, inverted repeat genomes, with a wt TR at each end, and a mutated TR in the middle. Ultimately, after uncoating, the viral DNA folds through intramolecular base pairing within the mutant TR, which then proceeds through the genome to form a ds molecule. McCarty teaches (same §) they found scAAV was characterized by faster onset of gene expression and higher transduction efficiency in liver, muscle and brain. McCarty shows (Fig. 1ab) their vectors comprise a WT ITR and a mutant ITR and a ds hairpin. Those teachings indicate that McCarty’s mutant ITR results in a self-complementary transcript that forms a ds-polynt (some limitations of Claim 6) and a ds hairpin (an optional limitation of Claim 10). App878 is drawn to a nucleic acid molecule comprising a nucleotide sequence encoding for a functional protein for treating a disease. App878 teaches (¶20) an AAV suitable for use as a gene therapy vector comprises a heterologous nt sequence between two viral ITRs at either end of the vector genome. App878 teaches (¶37) other features of ITRs for use in gene therapy, including that AAV ITR is preferred. App878 teaches SEQ ID NO 3 which comprises claimed SEQ ID NO 61 as shown by the following alignment: RESULT 5 US-15-573-203-3 (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) Sequence 3, US/15573203 Publication No. US20180110878A1 GENERAL INFORMATION APPLICANT: UCL Business PLC TITLE OF INVENTION: Fabry Disease Gene Therapy FILE REFERENCE: P530226PCT CURRENT APPLICATION NUMBER: US/15/573,203 CURRENT FILING DATE: 2017-11-10 PRIOR APPLICATION NUMBER: GB1508025.2 PRIOR FILING DATE: 2015-05-11 NUMBER OF SEQ ID NOS: 3 SEQ ID NO 3 LENGTH: 2330 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: nucleotide sequence of vector construct including promoter and codon optimised alpha-galactosidase A sequence Query Match 100.0%; Score 144; Length 2330; Best Local Similarity 100.0%; Matches 144; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCC 60 SEQ ID NO 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCC 60 App878 SEQ #3 Qy 61 GACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGG 120 Qy 121 CCAACTCCATCACTAGGGGTTCCT 144 |||||||||||||||||||||||| Db 121 CCAACTCCATCACTAGGGGTTCCT 144 That alignment shows App878’s SEQ ID NO 3 comprises an ITR identical to that claimed as SEQ ID NO 61. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the system of App337 with the teachings about scAAV of McCarty and the WT ITR sequence of App878 for the benefit of producing a scAAV that overcomes the rate-limiting step to transduction in vivo. One would have been motivated to do so with a reasonable expectation of success because App337 teaches using scAAV vectors and McCarty teaches their mutant ITR scAAV overcomes the rate-limiting step to transduction in vivo which an artisan would have readily understood is beneficial for any kind of gene therapy. One would have been motivated to use the WT ITR sequence of App878 with a reasonable expectation of success because they could have used any ITR sequence and choosing that of App878 would have been, merely, a design choice. Furthermore, App878 teaches that (§ starting at ¶87, Figs. 4-11) AAV vectors comprising the ITR resulted in successful gene therapy. Therefore the limitations of Claim 6 would have been obvious in view of App337, McCarty, and App878. Claim(s) 3, 9, 15, 18, 23-24, 29, 31, 34, and 37 are rejected under 35 U.S.C. 103 as being unpatentable over App337 as evidenced by Naso and Addgene as applied to 3, 9, 15, 18, 23-24, 29, 31, and 37 in the 103 rejection above, and further in view of Hakim (et al. 2018. AAV CRISPR editing rescues cardiac and muscle function for 18 months in dystrophic mice. JCI Insight 3[23]:e124297, “Hakim”). The teachings of App337 as evidenced by Naso and Addgene as applicable to Claim(s) 3, 9, 15, 18, 23-24, 29, 31, and 37 have been discussed in the 102/103 rejection and 103 rejection above. App337 as evidenced by Naso and Addgene teaches all the limitations of Claim 3. App337 as evidenced by Naso and Addgene do not teach that the vector comprising the two gRNAs is present in a concentration of at least 2-fold greater than the concentration of the vector encoding the Cas9 enzyme. However, Hakim teaches (§Abstract) gRNA vector loss is a barrier for systemic AAV CRISPR therapy that can be circumvented by vector dose optimization. Hakim teaches (§Discussion ¶4) to overcome gRNA vector loss, they increased the gRNA AAV dose by 6-fold (vs. their original study) to reach a final Cas9:gRNA vector ratio of 1:3. Hakim teaches (same §, ¶4-5) that balanced the ratio of Cas9:gRNA vector in tissue and (Figs. 1-3, Suppl. Figs. 4, 11, 17) increased the total dystrophin transcript and protein levels in the heart and body-wide. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the system of App337 with the teachings about increasing the amount of gRNA vector in a composition for gene therapy of Hakim for the benefit of producing a composition that, if administered to a patient, would improve dystrophin expression in the heart and body-wide. One would have been motivated to do so with a reasonable expectation of success because Hakim teaches gRNA vector loss is a known phenomenon in the art of gene therapy and Hakim showed improved outcomes when gRNA vector was increased by 3-fold. Therefore the limitations of Claim 34 would have been obvious in view of App337 and Hakim. Claim(s) 3, 6, 9-10, 15, 18, 23-24, 29, 31, 35-37, 46 and 51 are rejected under 35 U.S.C. 103 as being unpatentable over App337 as evidenced by Naso and Addgene and in view of McCarty, and App878 as applied to 3, 6, 9, 15, 18, 23-24, 29, 31, and 37 in the 103 rejection above, and further in view of Gearing (2020 September 10. CRISPR 101: Multiplex Expression of gRNAs. Available online at Addgene.com, “Gearing”) and Hamar (and Kultz. 2020 August 05. An Efficient Vector-based CRISPR/Cas9 System in an Oreochromis mossambicus Cell Line using Endogenous Promoters. BioRxiv, “Hamar”). The teachings of App337 as evidenced by Naso and Addgene and in view of McCarty and Appp878 as applicable to Claim(s) 3, 6, 9, 15, 18, 23-24, 29, 31, and 37 have been discussed in the 103 rejection above. App337 as evidenced by Naso and Addgene and in view of McCarty and App878 teach: a CRISPR-Cas dual vector system comprising: (a) a first vector encoding a first ITR upstream of a first gRNA targeting an intron or an exon of dystrophin and a second gRNA targeting an intron or an exon of dystrophin, and a second ITR downstream of the first and second gRNAs; and (b) a second vector encoding a Cas9 protein, wherein the first ITR is a WT ITR comprising SEQ ID NO 61 and the second ITR is a mutant ITR that generates a self-complementary transcript that forms a double-stranded polynucleotide, and wherein the gRNAs can comprise SEQ ID NOs 55/135/57/137 and SEQ ID NOs 56/134/58/136. As discussed in the preceding 102/103 rejection, App337 teaches the gRNA sequences recited in Claim 51. As discussed in the preceding 103 rejection, App337 describes (¶525-531, ¶1253-1257, Fig. 1) gRNA scaffold sequences and Addgene teaches (§Glossary) a gRNA is a synthetic fusion of the endogenous bacterial crRNA and tracrRNA that provides both targeting specificity and scaffolding/binding ability for Cas9 nuclease and a gRNA scaffold sequence is the sequence within the gRNA that is responsible for Cas9 binding, it does not include the 20 bp spacer/targeting sequence that is used to guide Cas9 to target DNA. App337, McCarty, and Appp878 do not explicitly teach the first vector comprises an expression cassette comprising 5'-[wild-type ITR]-[promoter]-[first gRNA]-[promoter]-[second gRNA]-[mutant ITR]-3' (Claim 10), wherein at least one vector comprises a sequence encoding from the 5' to 3' direction: (a) a first ITR or AAV ITR; (b) a first promoter; (c) a first gRNA targeting an intron of dystrophin; (d) a Cas9 gRNA scaffold; (e) a second promoter; (f) a second gRNA targeting an intron of dystrophin; (g) a Cas9 gRNA scaffold; and (h) a second ITR or AAV ITR, (i.e., Claims 35, 46 and 51); or the system, wherein vector genome replication from the at least one vector results in a genome comprising, from the 5' to 3' direction: (a) a complementary sequence of the second ITR; (b) a complementary sequence of the second gRNA; (c) a complementary sequence of the second promoter; (d) a complementary sequence of the Cas9 gRNA scaffold; (e) a complementary sequence of the first gRNA; (f) a complementary sequence of the first promoter; (h) the first ITR; (i) the first promoter; (g) the first gRNA; (k) the Cas9 gRNA scaffold; (I) the second promoter; (m) the second gRNA; and (n) the second ITR, (i.e., what’s recited in Claim 36). However, Gearing teaches multiplex strategies that comprise an expression cassette comprising: [first promoter]-[first gRNA (including a gRNA scaffold)]-[second promoter]-[second gRNA (including a gRNA scaffold)]. That is shown in Fig 3, reproduced here: PNG media_image2.png 529 797 media_image2.png Greyscale Furthermore, Gearing teaches (§Frew Lab Multiple Lentiviral ExpressionSystems [MuLE] Kit) a vector that accommodates up to three gRNAs and contain a U6 promoter and gRNA scaffold. Gearing teaches (§Why use multiplexed gRNAs?) their multiplex gRNAs provide benefits, including making sure that each cell that gets the plasmid contains all of the desired gRNAs which increases the chance that all the desired edits will occur, using dual nickases to generate a knockout or edit can help reduce off-target activity, and deleting a large region of the genome by removing the sequence between two target sites. Gearing teaches (§Multiplexing gRNAs: the basics) each gRNA must be expressed with its own promoter. Furthermore, Hamar, drawn to a vector for editing mammalian cells, teaches (Fig. 3) a vector that encodes the arrangement of 5’-[promoter]-[gRNA targeting sequence]-[gRNA scaffold]-3’, as shown by the following excerpt of Fig. 3: PNG media_image3.png 312 1269 media_image3.png Greyscale Then, it would have been obvious to insert this scheme (for each gRNA) between the two ITRs within the AAV of App337, McCarty, and App878. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the first scAAV vector comprising two DMD-targeting gRNAs (which target DMD introns) of App337 as evidenced by Naso and Addgene, McCarty, and App878 with the configuration of Gearing’s multiplex expression cassette and teachings of Hamar for the benefits of using an expression cassette configuration known to reduce off-target activity as discussed by App337 and Gearing. One would have been motivated to do so with a reasonable expectation of success because teachings of App337 as evidenced by Addgene indicate it is routine and conventional for a gRNA to include a scaffold sequence, and because Gearing and Hamar teach it is routine and conventional to encode within a vector the configuration, 5’[Wingdings font/0xE0]3’ of [promoter]-[gRNA targeting sequence]-[gRNA scaffold]-[promoter]-[gRNA targeting sequence]-[gRNA scaffold]. Modifying the system of App337 as evidenced by Naso and Addgene, McCarty, and App878 with the teachings of Gearing and Hamar would have produced a system wherein the first vector comprises: (a) a first WT AAV ITR; (b) a first U6 promoter; (c) a first gRNA targeting a DMD intron, the gRNA comprising SEQ ID NOs 55/135/57/137 or SEQ ID NOs 56/134/58/136; (d) a Cas9 gRNA scaffold; (e) a second U6 promoter; (f) a second gRNA targeting a DMD intron, the gRNA comprising SEQ ID NOs 55/135/57/137 or SEQ ID NOs 56/134/58/136; (g) a Cas9 gRNA scaffold; and (h) a mutant AAV ITR, which is the limitations of Claims 10, 35, 46, and 51. Regarding Claim 36, vector genome replication from the scAAV vector encoding the gRNAs (which would have been obvious in view of App337, McCarty, App878, Gearing, and Hamar) would have resulted in a genome comprising, from the 5’ to 3’ direction: a complementary sequence of the second ITR; a complementary sequence of the second gRNA; a complementary sequence of the second promoter; a complementary sequence of the Cas9 gRNA scaffold; a complementary sequence of the first gRNA; a complementary sequence of the first promoter; a first WT AAV ITR; a first U6 promoter; a first gRNA targeting a DMD intron, the gRNA comprising SEQ ID NOs 55/135/57/137 or SEQ ID NOs 56/134/58/136; a Cas9 gRNA scaffold; a second U6 promoter; a second gRNA targeting a DMD intron, the gRNA comprising SEQ ID NOs 55/135/57/137 or SEQ ID NOs 56/134/58/136; a Cas9 gRNA scaffold; and a mutant AAV ITR. Therefore all the limitations of Claim 36 would have been obvious in view of App337, McCarty, App878, Gearing, and Hamar. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. NOTE: Applicant has a huge number of patents and applications whose claims recite a gRNA that targets dystrophin. Because the instant claims are so broad, any of these is subject to a NSDP because it would have been obvious to encode any two gRNAs on a vector wherein ITRs flank the gRNAs. Because the time allowed for examination is limited, only a selection of those documents appears below. Claims 3, 6, 9-10, 15, 18, 23-24, 29, 31, 34-37, 46, 51 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-16 of U.S. Patent No. 12214054 (“US054”) in view of US Patent Application Publication No. 2019/0048337 (published 14 February 2019, “App337”, of record on IDS) as evidenced by Naso (et al. 2017. Adeno-Associated Virus (AAV) as a Vector for Gene Therapy. BioDrugs 31:317, “Naso”) and by Addgene (“CRISPR Guide”. Page archived on 20 February 2020. Accessed via Wayback Machine, “Addgene”, of record), and in view of the references McCarty (et al. 2003. Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. 10:2112, “McCarty”), US Patent Application Publication No. US 2018/0110878 (published 26 April 2018, “App878), Hakim (et al. 2018. AAV CRISPR editing rescues cardiac and muscle function for 18 months in dystrophic mice. JCI Insight 3[23]:e124297, “Hakim”), Gearing (2020 September 10. CRISPR 101: Multiplex Expression of gRNAs. Available online at Addgene.com, “Gearing”), and Hamar (and Kultz. 2020 August 05. An Efficient Vector-based CRISPR/Cas9 System in an Oreochromis mossambicus Cell Line using Endogenous Promoters. BioRxiv, “Hamar”). Although the claims at issue are not identical they are directed to overlapping subject matter because the instant claims are directed to a CRISPR-Cas dual vector system comprising a first vector encoding a first gRNA that targets a DMD gene intron or exon and a second gRNA that targets a DMD gene intron or exon, wherein ITRs flank the gRNAs, wherein one ITR can be a WT ITR and the other can be a mutant ITR, wherein the intron can be intron 44 or 55 and the gRNAs can be SEQ ID NOs 55/57/135/137 or SEQ ID NOs 56/58/136/138 and a second vector encoding a Cas9 protein (that can be encoded by SEQ ID NO 69) wherein another promoter can drive expression of the Cas9 protein; wherein the first vector can comprise a ubiquitous or tissue-specific promoter (including a U6 or H1 promoter) linked to each gRNA; wherein the vector comprises an expression cassette in the order of Claims 10, 35-56, or 46; wherein the vector can comprise a Cas9 gRNA scaffold sequence of SEQ ID NO 138; wherein the ITRs can be AAV ITRs and the vector can be any of various AAV serotypes; wherein the composition comprises the first vector in a concentration at least 2-fold greater than that of the second vector; and to a cell comprising the system. The US054 claims are directed to a composition comprising first and second gRNAs that comprise certain SEQ ID NOs for targeting DMD, a vector comprising the DNA, and methods of using them. Both claim sets are directed to a vector comprising gRNA for targeting a DMD gene. The US054 claims don’t recite every limitation recited by the instant claims, including the flanking ITRs, but those would have been obvious in view of the prior art of App337 (¶36-37, ¶81, ¶29, ¶1050 and ¶1144, ¶76-81, ¶86-87, ¶1124, ¶524, ¶554, ¶199, ¶545, ¶1012-1014, ¶103, ¶957, ¶171, ¶1139, ¶1142, ¶1182, ¶525-531, ¶1253-1257, ¶27, SEQ ID NO 8, SEQ ID NO 38, SEQ ID NO 68759, SEQ ID NO 41113; Figs. 1I and 7), McCarty (§Abstract, §Discussion, Fig. 1ab), App878 (¶20, ¶37, SEQ ID NO 3; § starting at ¶87, Figs. 4-11), Hakim (§Abstract, §Discussion ¶4-5, Figs. 1-3, Suppl. Figs. 4, 11, 17), Gearing ( Fig 3, §Frew Lab Multiple Lentiviral ExpressionSystems [MuLE] Kit, §Why use multiplexed gRNAs?; §Multiplexing gRNAs: the basics), Hamar (Fig. 3), and evidence of Naso (§2 Adeno-Associated Virus [AAV] Vector Designs, Fig. 1) and Addgene (§CRISPR Overview, ¶2; §Glossary). Therefore it would have been obvious to an artisan before the effective filing date of the claimed invention to modify the US054 claims with the teachings in the prior art for the benefits of optimizing the composition/method of the US054 claims and of producing a scAAV that overcomes the rate-limiting step to transduction in vivo, producing a composition that, if administered to a patient, would improve dystrophin expression in the heart and body-wide, and the benefits of using an expression cassette configuration known to reduce off-target activity, as described in the 103 rejections. One would have been motivated to do so with a reasonable expectation of success because the cited art indicates that making all of those changes was of benefit and was routine and conventional in the art of gene therapy. It would have been obvious to include the ITRs of App337 and Naso because those references indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. Therefore the instant claims would have been obvious in view of the US054 claims and the cited prior art. Claims 3, 6, 9-10, 15, 18, 23-24, 29, 31, 34-37, 46, 51 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-17 of U.S. Patent No. 12629428 (“US428”) in view of App337 as evidenced by Naso and by Addgene, and in view of the references McCarty, App878, Hakim, Gearing, and Hamar. Although the claims at issue are not identical they are directed to overlapping subject matter because the instant claims are directed to a CRISPR-Cas dual vector system comprising a first vector encoding a first gRNA that targets a DMD gene intron or exon and a second gRNA that targets a DMD gene intron or exon, wherein ITRs flank the gRNAs, wherein one ITR can be a WT ITR and the other can be a mutant ITR, wherein the intron can be intron 44 or 55 and the gRNAs can be SEQ ID NOs 55/57/135/137 or SEQ ID NOs 56/58/136/138 and a second vector encoding a Cas9 protein (that can be encoded by SEQ ID NO 69) wherein another promoter can drive expression of the Cas9 protein; wherein the first vector can comprise a ubiquitous or tissue-specific promoter (including a U6 or H1 promoter) linked to each gRNA; wherein the vector comprises an expression cassette in the order of Claims 10, 35-56, or 46; wherein the vector can comprise a Cas9 gRNA scaffold sequence of SEQ ID NO 138; wherein the ITRs can be AAV ITRs and the vector can be any of various AAV serotypes; wherein the composition comprises the first vector in a concentration at least 2-fold greater than that of the second vector; and to a cell comprising the system. The US428 claims are directed to a DNA targeting system comprising a single vector encoding two gRNAs and a Cas9 protein, and to methods of using it. Both claim sets are directed to a vector comprising gRNA for targeting a DMD gene. The US428 claims don’t recite every limitation recited by the instant claims, including the flanking ITRs and the dual vectors, but those would have been obvious in view of the prior art of App337 (¶36-37, ¶81, ¶29, ¶1050 and ¶1144, ¶76-81, ¶86-87, ¶1124, ¶524, ¶554, ¶199, ¶545, ¶1012-1014, ¶103, ¶957, ¶171, ¶1139, ¶1142, ¶1182, ¶525-531, ¶1253-1257, ¶27, SEQ ID NO 8, SEQ ID NO 38, SEQ ID NO 68759, SEQ ID NO 41113; Figs. 1I and 7), McCarty (§Abstract, §Discussion, Fig. 1ab), App878 (¶20, ¶37, SEQ ID NO 3; § starting at ¶87, Figs. 4-11), Hakim (§Abstract, §Discussion ¶4-5, Figs. 1-3, Suppl. Figs. 4, 11, 17), Gearing ( Fig 3, §Frew Lab Multiple Lentiviral ExpressionSystems [MuLE] Kit, §Why use multiplexed gRNAs?; §Multiplexing gRNAs: the basics), Hamar (Fig. 3), and evidence of Naso (§2 Adeno-Associated Virus [AAV] Vector Designs, Fig. 1) and Addgene (§CRISPR Overview, ¶2; §Glossary). As discussed, App337 teaches (¶1182) a two-vector delivery system wherein the gRNA molecules and Cas9 are packaged in separate delivery vehicles enhances tissue-specificity and Naso and App337 indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. Therefore it would have been obvious to an artisan before the effective filing date of the claimed invention to modify the US428 claims with the teachings in the prior art for the benefits of optimizing the composition/method of the US428 claims and of producing a scAAV that overcomes the rate-limiting step to transduction in vivo, producing a system has better tissue specificity than a single vector system, producing a composition that, if administered to a patient, would improve dystrophin expression in the heart and body-wide, and the benefits of using an expression cassette configuration known to reduce off-target activity, as described in the 103 rejections. One would have been motivated to do so with a reasonable expectation of success because the cited art indicates that making all of those changes was of benefit and was routine and conventional in the art of gene therapy. It would have been obvious to use the ITRs of App337 and Naso because those references indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. It would have been obvious to use a dual vector system as taught by App337 instead of a single vector system of the issued claims because App337 teaches (¶1182) a two-vector delivery system wherein the gRNA molecules and Cas9 are packaged in separate delivery vehicles enhances tissue-specificity. Furthermore, using a one or two vector system is merely a design choice and, as stated, the art teaches benefits to using a two vector system. Therefore the instant claims would have been obvious in view of the US428 claims and the cited prior art. Claims 3, 6, 9-10, 15, 18, 23-24, 29, 31, 34-37, 46, 51 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 8, 11-12, 15-16, 30-33, 35-45 of copending Application No. 16098464 (reference application, “App464”) in view of App337 as evidenced by Naso and by Addgene, and in view of the references McCarty, App878, Hakim, Gearing, and Hamar. Although the claims at issue are not identical they are directed to overlapping subject matter because the instant claims are directed to a CRISPR-Cas dual vector system comprising a first vector encoding a first gRNA that targets a DMD gene intron or exon and a second gRNA that targets a DMD gene intron or exon, wherein ITRs flank the gRNAs, wherein one ITR can be a WT ITR and the other can be a mutant ITR, wherein the intron can be intron 44 or 55 and the gRNAs can be SEQ ID NOs 55/57/135/137 or SEQ ID NOs 56/58/136/138 and a second vector encoding a Cas9 protein (that can be encoded by SEQ ID NO 69) wherein another promoter can drive expression of the Cas9 protein; wherein the first vector can comprise a ubiquitous or tissue-specific promoter (including a U6 or H1 promoter) linked to each gRNA; wherein the vector comprises an expression cassette in the order of Claims 10, 35-56, or 46; wherein the vector can comprise a Cas9 gRNA scaffold sequence of SEQ ID NO 138; wherein the ITRs can be AAV ITRs and the vector can be any of various AAV serotypes; wherein the composition comprises the first vector in a concentration at least 2-fold greater than that of the second vector; and to a cell comprising the system. The App464 claims are directed to a single vector encoding two gRNAs and a Cas9 protein, and to methods of using it. Both claim sets are directed to a vector comprising gRNA for targeting a DMD gene. The App464 claims don’t recite every limitation recited by the instant claims, including the flanking ITRs and the dual vectors, but those would have been obvious in view of the prior art of App337 (¶36-37, ¶81, ¶29, ¶1050 and ¶1144, ¶76-81, ¶86-87, ¶1124, ¶524, ¶554, ¶199, ¶545, ¶1012-1014, ¶103, ¶957, ¶171, ¶1139, ¶1142, ¶1182, ¶525-531, ¶1253-1257, ¶27, SEQ ID NO 8, SEQ ID NO 38, SEQ ID NO 68759, SEQ ID NO 41113; Figs. 1I and 7), McCarty (§Abstract, §Discussion, Fig. 1ab), App878 (¶20, ¶37, SEQ ID NO 3; § starting at ¶87, Figs. 4-11), Hakim (§Abstract, §Discussion ¶4-5, Figs. 1-3, Suppl. Figs. 4, 11, 17), Gearing ( Fig 3, §Frew Lab Multiple Lentiviral ExpressionSystems [MuLE] Kit, §Why use multiplexed gRNAs?; §Multiplexing gRNAs: the basics), Hamar (Fig. 3), and evidence of Naso (§2 Adeno-Associated Virus [AAV] Vector Designs, Fig. 1) and Addgene (§CRISPR Overview, ¶2; §Glossary). As discussed, App337 teaches (¶1182) a two-vector delivery system wherein the gRNA molecules and Cas9 are packaged in separate delivery vehicles enhances tissue-specificity and Naso and App337 indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. Therefore it would have been obvious to an artisan before the effective filing date of the claimed invention to modify the App464 claims with the teachings in the prior art for the benefits of optimizing the composition/method of the App464 claims and of producing a scAAV that overcomes the rate-limiting step to transduction in vivo, producing a system has better tissue specificity than a single vector system, producing a composition that, if administered to a patient, would improve dystrophin expression in the heart and body-wide, and the benefits of using an expression cassette configuration known to reduce off-target activity, as described in the 103 rejections. One would have been motivated to do so with a reasonable expectation of success because the cited art indicates that making all of those changes was of benefit and was routine and conventional in the art of gene therapy. It would have been obvious to use the ITRs of App337 and Naso because those references indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. It would have been obvious to use a dual vector system of App337 instead of a single vector system of the copending claims because App337 teaches (¶1182) a two-vector delivery system wherein the gRNA molecules and Cas9 are packaged in separate delivery vehicles enhances tissue-specificity. Furthermore, using a one or two vector system is merely a design choice and, as stated, the art teaches benefits to using a two vector system. Therefore the instant claims would have been obvious in view of the App464 claims and the cited prior art. Claims 3, 6, 9-10, 15, 18, 23-24, 29, 31, 34-37, 46, 51 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following copending applications in view of App337 as evidenced by Naso and by Addgene, and in view of the references McCarty, App878, Hakim, Gearing, and Hamar. App. No Claims 17603243 1, 7, 17, 20-25, 27, 29, 31-36 17603329 1-4, 6, 11-13, 15-17, 20-22, 35, 27, 30, 32, 34-36 17921316 1-2, 9, 13-14, 17-18, 23, 25, 27-28, 38-44 17921336 1, 8-10, 13-14, 19-20, 23-25, 28, 30-31, 36, 38, 40, 43-44 19181618 68-86 19663101 35-48 Although the claims at issue are not identical they are directed to overlapping subject matter because the instant claims are directed to a CRISPR-Cas dual vector system comprising a first vector encoding a first gRNA that targets a DMD gene intron or exon and a second gRNA that targets a DMD gene intron or exon, wherein ITRs flank the gRNAs, wherein one ITR can be a WT ITR and the other can be a mutant ITR, wherein the intron can be intron 44 or 55 and the gRNAs can be SEQ ID NOs 55/57/135/137 or SEQ ID NOs 56/58/136/138 and a second vector encoding a Cas9 protein (that can be encoded by SEQ ID NO 69) wherein another promoter can drive expression of the Cas9 protein; wherein the first vector can comprise a ubiquitous or tissue-specific promoter (including a U6 or H1 promoter) linked to each gRNA; wherein the vector comprises an expression cassette in the order of Claims 10, 35-56, or 46; wherein the vector can comprise a Cas9 gRNA scaffold sequence of SEQ ID NO 138; wherein the ITRs can be AAV ITRs and the vector can be any of various AAV serotypes; wherein the composition comprises the first vector in a concentration at least 2-fold greater than that of the second vector; and to a cell comprising the system. The copending claims are directed to a CRISPR/Cas-based editing system that comprises at least one gRNA and can comprise other elements, to a vector comprising the polynt-based editing system, and to methods of using it. All claim sets are directed to a vector comprising gRNA for targeting a DMD gene. The copending claims don’t recite every limitation recited by the instant claims, including the flanking ITRs and the dual vectors, but those would have been obvious in view of the prior art of App337 (¶36-37, ¶81, ¶29, ¶1050 and ¶1144, ¶76-81, ¶86-87, ¶1124, ¶524, ¶554, ¶199, ¶545, ¶1012-1014, ¶103, ¶957, ¶171, ¶1139, ¶1142, ¶1182, ¶525-531, ¶1253-1257, ¶27, SEQ ID NO 8, SEQ ID NO 38, SEQ ID NO 68759, SEQ ID NO 41113; Figs. 1I and 7), McCarty (§Abstract, §Discussion, Fig. 1ab), App878 (¶20, ¶37, SEQ ID NO 3; § starting at ¶87, Figs. 4-11), Hakim (§Abstract, §Discussion ¶4-5, Figs. 1-3, Suppl. Figs. 4, 11, 17), Gearing ( Fig 3, §Frew Lab Multiple Lentiviral ExpressionSystems [MuLE] Kit, §Why use multiplexed gRNAs?; §Multiplexing gRNAs: the basics), Hamar (Fig. 3), and evidence of Naso (§2 Adeno-Associated Virus [AAV] Vector Designs, Fig. 1) and Addgene (§CRISPR Overview, ¶2; §Glossary). As discussed, App337 teaches (¶1182) a two-vector delivery system wherein the gRNA molecules and Cas9 are packaged in separate delivery vehicles enhances tissue-specificity and Naso and App337 indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. Therefore it would have been obvious to an artisan before the effective filing date of the claimed invention to modify the copending claims with the teachings in the prior art for the benefits of optimizing the composition/method of the copending claims and of producing a scAAV that overcomes the rate-limiting step to transduction in vivo, producing a system has better tissue specificity than a single vector system, targeting editing to two sites, producing a composition that, if administered to a patient, would improve dystrophin expression in the heart and body-wide, and the benefits of using an expression cassette configuration known to reduce off-target activity, as described in the 103 rejections. One would have been motivated to do so with a reasonable expectation of success because the cited art indicates that making all of those changes was of benefit and was routine and conventional in the art of gene therapy. It would have been obvious to use the ITRs of App337 and Naso because those references indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. Note that the broadest of the instant claims recites only a system comprising two vectors, one with two gRNAs flanked by ITRs, and the other encoding a Cas protein. It would have been obvious to use a dual vector system of App337 instead of a single vector system of the copending claims because App337 teaches (¶1182) a two-vector delivery system wherein the gRNA molecules and Cas9 are packaged in separate delivery vehicles enhances tissue-specificity. Furthermore, using a one or two vector system is merely a design choice and, as stated, the art teaches benefits to using a two vector system. Therefore the instant claims would have been obvious in view of the copending claims and the cited prior art. Claims 3, 6, 9-10, 15, 18, 23-24, 29, 31, 34-37, 46, 51 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4, 8, 22-23 of copending Application No. 17921332 (reference application, “App332”) in view of App337 as evidenced by Naso and by Addgene, and in view of the references McCarty, App878, Hakim, Gearing, and Hamar. Although the claims at issue are not identical they are directed to overlapping subject matter because the instant claims are directed to a CRISPR-Cas dual vector system comprising a first vector encoding a first gRNA that targets a DMD gene intron or exon and a second gRNA that targets a DMD gene intron or exon, wherein ITRs flank the gRNAs, wherein one ITR can be a WT ITR and the other can be a mutant ITR, wherein the intron can be intron 44 or 55 and the gRNAs can be SEQ ID NOs 55/57/135/137 or SEQ ID NOs 56/58/136/138 and a second vector encoding a Cas9 protein (that can be encoded by SEQ ID NO 69) wherein another promoter can drive expression of the Cas9 protein; wherein the first vector can comprise a ubiquitous or tissue-specific promoter (including a U6 or H1 promoter) linked to each gRNA; wherein the vector comprises an expression cassette in the order of Claims 10, 35-56, or 46; wherein the vector can comprise a Cas9 gRNA scaffold sequence of SEQ ID NO 138; wherein the ITRs can be AAV ITRs and the vector can be any of various AAV serotypes; wherein the composition comprises the first vector in a concentration at least 2-fold greater than that of the second vector; and to a cell comprising the system. The App332 claims are directed to a pair of gRNAs identified by a method of screening for a pair of gRNA molecules for targeting a dystrophin gene and to a CRISPR/Cas9 system comprising the gRNA molecules, and other elements. App332 recites a pair of vectors wherein one encodes a pair of gRNAs and the other encodes a Cas protein. Both claim sets are directed to a CRISPR/Cas9 system comprising gRNA molecules that target a DMD gene. The App332 claims don’t recite every limitation recited by the instant claims, including the flanking ITRs, but those would have been obvious in view of the prior art of App337 (¶36-37, ¶81, ¶29, ¶1050 and ¶1144, ¶76-81, ¶86-87, ¶1124, ¶524, ¶554, ¶199, ¶545, ¶1012-1014, ¶103, ¶957, ¶171, ¶1139, ¶1142, ¶1182, ¶525-531, ¶1253-1257, ¶27, SEQ ID NO 8, SEQ ID NO 38, SEQ ID NO 68759, SEQ ID NO 41113; Figs. 1I and 7), McCarty (§Abstract, §Discussion, Fig. 1ab), App878 (¶20, ¶37, SEQ ID NO 3; § starting at ¶87, Figs. 4-11), Hakim (§Abstract, §Discussion ¶4-5, Figs. 1-3, Suppl. Figs. 4, 11, 17), Gearing ( Fig 3, §Frew Lab Multiple Lentiviral ExpressionSystems [MuLE] Kit, §Why use multiplexed gRNAs?; §Multiplexing gRNAs: the basics), Hamar (Fig. 3), and evidence of Naso (§2 Adeno-Associated Virus [AAV] Vector Designs, Fig. 1) and Addgene (§CRISPR Overview, ¶2; §Glossary). Therefore it would have been obvious to an artisan before the effective filing date of the claimed invention to modify the App332 claims with the teachings in the prior art for the benefits of optimizing the composition/method of the App332 claims and of producing a scAAV that overcomes the rate-limiting step to transduction in vivo, producing a composition that, if administered to a patient, would improve dystrophin expression in the heart and body-wide, and the benefits of using an expression cassette configuration known to reduce off-target activity, as described in the 103 rejections. One would have been motivated to do so with a reasonable expectation of success because the cited art indicates that making all of those changes was of benefit and was routine and conventional in the art of gene therapy. It would have been obvious to include the ITRs of App337 and Naso because those references indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. Therefore the instant claims would have been obvious in view of the App332 claims and the cited prior art. Claims 3, 6, 9-10, 15, 18, 23-24, 29, 31, 34-37, 46, 51 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 33-40 of copending Application No. 19646302 (reference application, “App302”) in view of App337 as evidenced by Naso and by Addgene, and in view of the references McCarty, App878, Hakim, Gearing, and Hamar. Although the claims at issue are not identical they are directed to overlapping subject matter because the instant claims are directed to a CRISPR-Cas dual vector system comprising a first vector encoding a first gRNA that targets a DMD gene intron or exon and a second gRNA that targets a DMD gene intron or exon, wherein ITRs flank the gRNAs, wherein one ITR can be a WT ITR and the other can be a mutant ITR, wherein the intron can be intron 44 or 55 and the gRNAs can be SEQ ID NOs 55/57/135/137 or SEQ ID NOs 56/58/136/138 and a second vector encoding a Cas9 protein (that can be encoded by SEQ ID NO 69) wherein another promoter can drive expression of the Cas9 protein; wherein the first vector can comprise a ubiquitous or tissue-specific promoter (including a U6 or H1 promoter) linked to each gRNA; wherein the vector comprises an expression cassette in the order of Claims 10, 35-56, or 46; wherein the vector can comprise a Cas9 gRNA scaffold sequence of SEQ ID NO 138; wherein the ITRs can be AAV ITRs and the vector can be any of various AAV serotypes; wherein the composition comprises the first vector in a concentration at least 2-fold greater than that of the second vector; and to a cell comprising the system. The App302 claims are directed to a method of treating a subject having a mutant dystrophin gene, comprising administering to the subject a CRISPR/Cas system comprising one or more viral vectors encoding a composition comprising first and second gRNAs, an S. aureus Cas9 protein, and one or more Cas9 gRNA scaffolds, and other elements. Both claim sets are directed to a vector comprising gRNA for targeting a DMD gene. The App302 claims don’t recite every limitation recited by the instant claims, including the flanking ITRs and the dual vectors, but those would have been obvious in view of the prior art of App337 (¶36-37, ¶81, ¶29, ¶1050 and ¶1144, ¶76-81, ¶86-87, ¶1124, ¶524, ¶554, ¶199, ¶545, ¶1012-1014, ¶103, ¶957, ¶171, ¶1139, ¶1142, ¶1182, ¶525-531, ¶1253-1257, ¶27, SEQ ID NO 8, SEQ ID NO 38, SEQ ID NO 68759, SEQ ID NO 41113; Figs. 1I and 7), McCarty (§Abstract, §Discussion, Fig. 1ab), App878 (¶20, ¶37, SEQ ID NO 3; § starting at ¶87, Figs. 4-11), Hakim (§Abstract, §Discussion ¶4-5, Figs. 1-3, Suppl. Figs. 4, 11, 17), Gearing ( Fig 3, §Frew Lab Multiple Lentiviral ExpressionSystems [MuLE] Kit, §Why use multiplexed gRNAs?; §Multiplexing gRNAs: the basics), Hamar (Fig. 3), and evidence of Naso (§2 Adeno-Associated Virus [AAV] Vector Designs, Fig. 1) and Addgene (§CRISPR Overview, ¶2; §Glossary). As discussed, App337 teaches (¶1182) a two-vector delivery system wherein the gRNA molecules and Cas9 are packaged in separate delivery vehicles enhances tissue-specificity and Naso and App337 indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. Therefore it would have been obvious to an artisan before the effective filing date of the claimed invention to modify the App302 claims with the teachings in the prior art for the benefits of optimizing the composition/method of the App302 claims and of producing a scAAV that overcomes the rate-limiting step to transduction in vivo, producing a system has better tissue specificity than a single vector system, producing a composition that, if administered to a patient, would improve dystrophin expression in the heart and body-wide, and the benefits of using an expression cassette configuration known to reduce off-target activity, as described in the 103 rejections. One would have been motivated to do so with a reasonable expectation of success because the cited art indicates that making all of those changes was of benefit and was routine and conventional in the art of gene therapy. It would have been obvious to use the ITRs of App337 and Naso because those references indicate it was known that those ITRs are a component of AAV2 vector and that including ITRs in a vector for gene therapy was necessary for genome replication and packaging. It would have been obvious to use a dual vector system as taught by App337 instead of a single vector system of the issued claims because App337 teaches (¶1182) a two-vector delivery system wherein the gRNA molecules and Cas9 are packaged in separate delivery vehicles enhances tissue-specificity. Furthermore, using a one or two vector system is merely a design choice (which is acknowledged because the App302 claims recite there can be one or more viral vectors) and, as stated, the art teaches benefits to using a two vector system. Therefore the instant claims would have been obvious in view of the App302 claims and the cited prior art. Sequence(s) Free of the Prior Art of Record The following sequences were searched and found to be free of the prior art of record: SEQ ID NOs 91-92 and 131. Claims directed to those SEQ ID NOs could be allowable, as long as all other issues (e.g., 112a/112b) are resolved. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. RUTHIE S ARIETI Examiner Art Unit 1635 /RUTH SOPHIA ARIETI/Examiner, Art Unit 1635 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Apr 20, 2023
Application Filed
Aug 05, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723246
ARC PROTEIN EXTRACELLULAR VESICLE NUCLEIC ACID DELIVERY PLATFORM
6y 2m to grant Granted Sep 01, 2026
Patent 12716066
PHARMACEUTICAL COMPOSITION CONTAINING HERES EXPRESSION INHIBITOR FOR PREVENTING OR TREATING SQUAMOUS CELL CARCINOMA
4y 8m to grant Granted Aug 25, 2026
Patent 12674162
COMPOSITIONS AND METHODS FOR TREATMENT OF KIDNEY DISEASE
1y 1m to grant Granted Jul 07, 2026
Patent 12655446
COMPOSITIONS AND METHODS FOR HEMOGLOBIN PRODUCTION
5y 8m to grant Granted Jun 16, 2026
Patent 12630828
APTAMERS FOR USE AGAINST AUTOANTIBODY-ASSOCIATED DISEASES
9y 3m to grant Granted May 19, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
47%
Grant Probability
99%
With Interview (+71.1%)
3y 5m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 90 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month