DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 1-12, 15-18 are pending.
Applicant’s election without traverse of Group II, claims 12 and 15-18 in the reply filed on 05/11/2026 is acknowledged. Claims 1-11 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 05/11/2026.
Claims 12, 15-18 are examined here.
Priority
The priority to UK Application 2016863.9, filed on 10/23/2020, via its PCT/EP2021/079580, filed on 10/25/2021, is recognized. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
All examined claims enjoy the priority to the filing of ‘863.9.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 04/21/2023 and 05/11/2026 were filed before the mailing date of the instant Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
The listing of references at the end of the specification (pg. 81) is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892 or in the IDS, they have not been considered.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification/Fig. 1 are not identified by sequence identifiers in accordance with 37 CFR 1.821(d).
The specification notes 2’ modified sequences of greater than 9 nt. that lack SEQ ID NOs (pg. 9, lines 21-22, 28-29; see pg. 10, 11, 16, 17, 22, 25, and structural formulas of sequences on pg. 23-25, 26-28).
Fig. 1 is a structural formula of a sequence but lacks SEQ ID NO.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Interpretation
The claimed subject matter is directed to “miR-29 compound.” The specification describes miR-29 compound as comprising a guide and passenger strands, which mimics the biological activity of native miR-29a (pg. 2, line 29-31). miR-29 family, which include miR-29a, miR-29b-1, miR-29b-2 and miR-29c, has overlapping biological activity and are included as miR-29 compounds. Thus, it is interpreted that miR-29 compounds comprise the sequence of miR-29a, miR-29b, miR-29c, either as a single-stranded mimic or double-stranded mimic.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 15 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 15 recites the broad recitation of at least 95 μg, and the claim also recites at least 190 μg, at least 475 μg, at least 1420 μg, at least 1900 μg, (and/or?) at least 4270 μg, each higher dose being a narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
In the interest of compact prosecution, the claim is interpreted as requiring at least 95 μg.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 12, 15-18 are rejected under 35 U.S.C. 103 as being unpatentable over Watts et al. (2017, Mol. Ther., 25, 2415-2426, “Watts”, shares co-inventors but is outside the grace period) and Rigoutsos et al. (US20170009295, pub. 01/12/2017, “Rigoutsos”).
Watts discloses that tendon injuries (tendinopathies) are common in human and equine athletes and characterized by dysregulated collagen matrix, resulting in tendon damage (abstract, relevant to instant cl. 12, 18). Watts evaluated miR29a replacement therapy as a therapeutic option to treat tendinopathy in an equine model and demonstrated that miR29a treatment reduced collagen 3 transcript levels at week 2 with relative lesion cross-sectional area significantly lowered in miR29a-treated tendons compared to control tendons (abstract). Watts concluded that locally delivered miR29a therapy improves early tendon healing (abstract). Watts disclose administrating miR29a mimics (pg. 2421). The methods disclose “tendons [of adult horses] were injected with 1.5 mL of 100 nM miR29a (based on preliminary rodent in vivo studies) in PBS” (pg. 2421; relevant to instant 12, 17). Watts administered a single dose of miR29a (pg. 2421). The approximate dose calculated is ~2.1 µg (based on the MW provided in Table A of specification, pg. 28).
Watts does not disclose 47 µg (cl. 12) nor the claimed ranges of cl. 15 nor up to 4740 ug (4.740 mg) (cl. 16) nor the about 1 ml of sterile aqueous solution.
The specification indicates that “about” is optional and defines “about” as +/- 10% (pg. 35, line 28, thus range is 0.9 mL to 1.1 mL).
Although Watts does not disclose the exact dose or the ranges and volume (1 mL), MPEP 2144.05(I) indicates that where claimed ranges are merely close, overlaps or lie inside the prior art range, a prima facie case of obviousness exists and that 2144.05(II)(A) indicates that “differences in concentration . . . will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration . . . is critical” since “it is not inventive to discover the optimum or workable ranges by routine experimentation.”
Here the concentration of the volume of prior art (1.5 mL) is close to the claimed volume of about 1 mL. Further Watts discloses that miR29a amount was determined based on preliminary in vivo studies.
Rigoutsos discloses in their titled application “Novel human miRNAs for use in diagnosis, prognosis, and therapy of human conditions and diseases” that effective dose of either miRNA mimic or antagonists of miRNA sequences can be estimated in cell culture assays, then animal models to determine IC50 and LD50/ED50, and the dosage can be determined by physician (i.e. a medical provider) and adjusted, as necessary, to suit observed effects and indicates that, for example, “therapeutic dose range for miRNA mimic can be 0.01 - 5.0 mg of miRNA per kg of patient body weight (mg/kg)” (par. 201-204). Rigoutsos discloses that desired dose can be administered one time or multiple times (par. 205). Further Rigoutsos discloses that pharmaceutically acceptable carrier includes pyrogen-free water, i.e. sterile-water (par. 199). Here, claims 12 and 15 do not recite have an upper-limit of the dose range, and under BRI, is interpreted to be 5 mg as noted in specification, pg. 13, line 14; while claim 16 adds an upper-limit to the range (47 µg – 4.7 mg). Thus the claimed doses overlap, since they do not have an upper-limit, or lie inside that of the prior art, thus the dose range is prima facie obvious.
One of the KSR’s rationale for supporting conclusion of obviousness is “obvious to try,” requiring the following three findings: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
Here, the problem is identifying an optimal dose of drug to administer. Based on Rigoutsos, a skilled artisan, including a medical provider, can determine various doses within a range based on finite factors, including prior studies, IC50 (reduction in biomarker, e.g. collagen) and/or body weight. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried modifying the dose of miR29a mimic of Watts in view of Rigoutsos to have arrived at the claimed invention with a reasonable expectation of success. Here based on success of Watts of administering miR29a locally as a single administration to a tendon of a horse to treat tendinopathy and of Rigoutsos disclosing methods of identifying optimal dose, a skilled reasonable would reasonably expect success by trying to test various doses of miR29a mimic on any subject to treat tendinopathy. Thus, claims 12, 15-18 are obvious.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Obvious Double Patenting: 9,932,582
Claims 12, 15-18 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 14, 17, of U.S. Patent No. 9932582B2 (Gilchrist) in view of Watts et al. (2017, Mol. Ther., 25, 2415-2426, “Watts”, shares co-inventors but is outside the grace period) and Rigoutsos et al. (US20170009295, pub. 01/12/2017, “Rigoutsos”).
Claims 1, 14 and 17 of Gilchrist teaches a method of treating tendon damage by delivering miR-29 mimic to a tendon of the subject (see cl. 1 of Gilchrist below).
Claim 1: A method of treating tendon damage or increasing tendon tensile strength in a subject in need thereof, the method comprising delivering miR-29, a mimic thereof, or a precursor of either, to a tendon of the subject wherein the miR-29 is miR-29a, miR-29b1, miR29b2 or miR-29c or a combination thereof and
wherein the miR-29 mimic comprises a guide strand comprising the sequence:
UAGCACCAUCUGAAAUCGGUUA (hsa-miR-29a) (SEQ ID NO: 1);
UAGCACCAUUUGAAAUCAGUGUU (hsa-miR-29b1 and 2) (SEQ ID NO: 2);
or UAGCACCAUUUGAAAUCGGUUA (hsa-miR-29c) (SEQ ID NO: 3)
(wherein the seed sequence is underlined in each case); or which differs from said sequence at:
(i) no more than three positions within the seed sequence; and
(ii) no more than five positions outside the seed sequence.
MPEP 804(II)(2)(B)(1) discloses that to understand the scope of the claims, the portion of the specification of the reference that describes the subject matter that falls within the scope of a reference claim may be relied upon to properly construe the scope of the claim.
Gilchrist’s claims 1 and 17’s subject matter of delivering miRNA29 mimic to a tendon of the subject encompasses, as disclosed by the specification, subcutaneous injection at the site of infliction in acceptable aqueous solution (Col. 22, l. 61-65, corresponding to instant cl. 12, 16).
Gilchrist’s claim 14 teaches tendinopathy (corresponds to instant cl. 18).
Gilchrist does not disclose the exact dose of 47 μg nor the claimed range of doses nor the volume of administration.
The disclosure of Watts discloses a single administration of miR-29a mimic in a 1.5 mL of aqueous solution and Rigoutsos discloses optimal determination of doses (corresponds to instant cl. 12, 15-17). Thus, cl. 12, 15-18 are obvious.
Obvious Double Patenting: 10,472,631
Claims 12, 15-18 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 3, 8, 9, 10, 11, 12 of U.S. Patent No. 10,472,631 (“Millar”) in view of Watts et al. (2017, Mol. Ther., 25, 2415-2426, “Watts”, shares co-inventors but is outside the grace period) and Rigoutsos et al. (US20170009295, pub. 01/12/2017, “Rigoutsos”).
Millar’s claim 1 teaches a method of modulating relative collagen compositions in a tissue in need thereof, the method comprising delivering to the tissue a mimic of miR-29b. Millar’s claim 11 teaches the tissue is an affected tendon.
To understand the scope of the claims, the specification discloses subcutaneous injection at the site of affliction in acceptable aqueous solution (Col. 22, line 61-65) and the methods encompass treatment of tendinopathy (Col. 21, line 61-62), corresponding to instant cl. 12, 17, 18.
Millar does not disclose the exact dose of 47 μg nor the claimed range of doses nor the volume of administration.
The disclosure of Watts discloses a single administration of miR-29a mimic in a 1.5 mL of aqueous solution and Rigoutsos discloses optimal determination of doses (corresponding to instant cl. 12, 15-17). Thus, cl. 12, 15-18 are obvious.
Provisional Rejection: App: 18/648316
Claims 12, 15-18 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 10, 11, 12, 13 of copending Application No. 18/648,316 (‘316). Although the claims at issue are not identical, they are not patentably distinct from each other.
Claims 10-13 of ‘316 teach method of treating tendon damage by a single administration by injection of 47 μg to 4740 μg of miR-29 compound in a volume of about 1 ml of sterile aqueous solution to treat tendinopathy, corresponding to instant cl. 12, 15-18.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Allowable Subject Matter
No claim allowed.
Closing Paragraph
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600
Prosecution Insights