Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
The numbering of claims is not in accordance with 37 CFR 1.126 which requires the original numbering of the claims to be preserved throughout the prosecution. When claims are canceled, the remaining claims must not be renumbered. When new claims are presented, they must be numbered consecutively beginning with the number next following the highest numbered claims previously presented (whether entered or not).
Misnumbered claims 188-198 have been renumbered 189-199, which have been canceled.
Claims 1-2, 4, 6, 9, 17, 20, 24, 30, 34, 45, 47, 59, 175-176, 178, 186-188 and 200 are pending.
Applicant’s election of Group I that read on (A) anti-CD33 antigen-binding domain as the species of cytotoxic agent, (B) a combination of busulfan, melphalan, fludarabine, and rabbit anti-thymocyte globulin (rATG) as chemotherapeutic agents and (C) CD33-positive acute myeloid leukemia as the species of hematopoietic malignancy in the reply filed on April 17, 2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 175-176, 178, 186-188 and 200 are withdrawn from further consideration by the examiner, 37 C.F.R. 1.142(b) as being drawn to non-elected inventions.
Claims 1-2, 4, 6, 9, 17, 20, 24, 30, 34, 45, 47 and 59, drawn to a method, comprising administering to a subject: an effective amount of a population of genetically engineered hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 antigen; and an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain that read on (A) anti-CD33 antigen-binding domain as the species of cytotoxic agent, (B) a combination of busulfan, melphalan, fludarabine, and (C) rabbit anti-thymocyte globulin (rATG) as chemotherapeutic agents and are being acted upon in this Office Action.
Priority
Applicant’ claim priority to provisional application 63/106,136, filed Oct 27, 2020 and 63/165,950, filed March 25, 2021, is acknowledged.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on December 28, 2023 have been considered by the examiner and an initialed copy of the IDS is included with this Office Action.
Drawings
The drawings filed on April 24, 2023 are acceptable.
Specification
The lengthy specification has not been checked to the extent necessary to determine the presence of all possible minor errors. Applicant's cooperation is requested in correcting any errors of which applicant may become aware in the specification.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 45 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which applicant regards as the invention.
Claim 45 recites the limitation “subject of (i), (ii), or (iii)” in base claim 1. There is insufficient antecedent basis for this limitation in the claim.
Claim rejections under - 35 U.S.C. 112
The following is a quotation of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 4, 6, 9, 17, 20, 24, 30, 34, 45, 47 and 59 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The MPEP lists factors that can be used to determine if sufficient evidence of possession has been furnished in the disclosure of the Application. These include: (1) Actual reduction to practice, (2) Disclosure of drawings or structural chemical formulas, (3) Sufficient relevant identifying characteristics (such as: i. Complete structure, ii. Partial structure, iii. Physical and/or chemical properties, iv. Functional characteristics when coupled with a known or disclosed, and correlation between function and structure), (4) Method of making the claimed invention, (5) Level of skill and knowledge in the art, and (6) Predictability in the art. “Disclosure of any combination of such identifying characteristics that distinguish the claimed invention from other materials and would lead one of skill in the art to the conclusion that the applicant was in possession of the claimed species is sufficient.” MPEP § 2163.
MPEP § 2163 states that the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus.
An adequate written description must contain enough information about the actual makeup of the claimed products – “a precise definition, such as structure, formula, chemic name, physical properties of other properties, of species falling with the genus sufficient to distinguish the gene from other materials”, which may be present in “functional terminology when the art has established a correlation between structure and function” (Amgen page 1361).
Claim 1 encompasses a method, comprising administering to a subject: an effective amount of a population of genetically engineered hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 antigen; and an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain.
Claim 2 encompasses the method of claim 1, wherein the cytotoxic agent is an antibody-drug conjugate (ADC), optionally wherein the ADC is gemtuzumab ozogamicin.
Claim 4 encompasses the method of claim 1any one of claims 1-3, wherein the effective amount of the population of genetically engineered hematopoietic cells is about 106 cells/kilogram body weight of the subject to about 107 cells/kilogram body weight of the subject, optionally wherein the effective amount of the population of genetically engineered hematopoietic cells is about 3.0 x 106 cells/kilogram body weight of the subject.
Claim 6 encompasses the method of claim 1, wherein the effective amount of the cytotoxic agent is about 0.1 mg/in2 body surface area of the subject to about 2.0 mg/in2 body surface area of the subject, optionally wherein the effective amount of the cytotoxic agent is about 0.1 mg/m2, about 0.25 mg/m2, about 0.5 mg/m2, about 1.0 mg/m2, or about 2.0 mg/m2 body surface area of the subject.
Claim 9 encompasses the method of claim 1, wherein the population of genetically engineered hematopoietic cells and the cytotoxic agent are administered in temporal proximity, optionally wherein administering in temporal proximity comprises:(a) administering the population of genetically engineered hematopoietic cells and the cytotoxic agent within a single treatment regimen;(b) administering the population of genetically engineered hematopoietic cells and the cytotoxic agent simultaneously;(c) administering the population of genetically engineered hematopoietic cells and the cytotoxic agent concurrently;(d) administering the population of genetically engineered hematopoietic cells and the cytotoxic agent sequentially; or (e) administering the population of genetically engineered hematopoietic cells within 120, 90, or 60 days of administering the cytotoxic agent.
Claim 17 encompasses the method of claim 1, wherein the population of genetically engineered hematopoietic cells are:
(a) administered prior to the cytotoxic agent;
(b) administered in a single treatment regimen;
(c) administered intravenously; and/or
(d) thawed from a cryopreserved form prior to administration.
Claim 20 encompasses the method of claim 1, wherein the cytotoxic agent is:
(a) administered in multiple doses of the effective amount every four weeks;
(b) administered in multiple doses of about 2.0 mg/m² every four weeks; and/or
(c) reconstituted from a lyophilized form prior to administration.
Claim 24 encompasses the method of claim 1, wherein:
(a)the subject has been preconditioned prior to administering the cytotoxic agent and/or the hematopoietic cells; and/or
(b) the method further comprises preconditioning the subject prior to administering the cytotoxic agent and/or the hematopoietic cells, optionally wherein preconditioning according to (a) and/or (b) comprises:
(i) administering one or more chemotherapeutic agents to the subject, optionally wherein the one or more chemotherapeutic agents are selected from the group consisting of busulfan, melphalan, fludarabine, cyclophosphamide, and thiotepa;
(ii) total body irradiation of the subject; and/or
(iii) administering antibodies that bind human T cells, optionally wherein the antibodies comprise rabbit anti-thymocyte globulins (rATG).
Claim 30 encompasses the method of claim 1, wherein the subject has, or has been diagnosed with, a hematopoietic malignancy or a hematopoietic pre-malignant disease, and wherein the hematopoietic malignancy is characterized by the presence of CD33-positive malignant cells, or wherein the hematopoietic pre-malignant disease is characterized by the presence of CD33-positive pre-malignant cells, or
(b) has, or has been diagnosed with, a CD33-positive acute myeloid leukemia, a CD33- positive myelodysplastic syndrome, or a CD33-positive myelodysplastic syndrome and is at high risk of developing acute myeloid leukemia.
34. (Currently Amended) The method of claim 1 any one of claims 1-33, wherein the subject:
(a) is naive to chemotherapy and/or radiation therapy, optionally wherein the subject is naive to any treatment aimed to address a hematopoietic malignancy or hematopoietic pre-malignant disease or has previously received chemotherapy;
(b) has previously received induction therapy;
(c) has previously entered a complete hematological remission, optionally wherein the complete hematological remission is characterized by an incomplete recovery of peripheral counts
(d) has one or more risk factors associated with early leukemia relapse; optionally wherein the one or more risk factors associated with early leukemia relapse are selected from the group consisting of: bone marrow in morphological complete remission with presence of intermediate or high-risk disease-related genetics, presence of minimal residual disease (MRD) post cyto-reductive therapy, bone marrow with persistent leukemia blasts post cyto-reductive therapy, and bone marrow blast count of about 10% or less with no circulating blasts;(e) does not have a homozygous dominant genotype for CD33 single nucleotide polymorphism (SNP) rs12459419;(f) does not have acute promyelocytic leukemia or chronic myeloid leukemia;(g) does not have a genetic translocation associated with acute promyelocytic leukemia or chronic myeloid leukemia, optionally wherein the genetic translocation is t(15; 17)(922; q21) or t(9;22)(834; 11):(h) has not previously received a stem cell transplantation;(i) has not previously received the cytotoxic agent; and/or(j) has a CD33-negative absolute neutrophil count (ANC) of at least 1000/dL prior to receiving the cytotoxic agent.
Claim 45 encompasses the method of claim 1, further comprising:
(a) determining a percent donor chimerism and/or a level of CD33-negative myeloid hematopoiesis in a peripheral blood sample from the subject;
(b) obtaining autologous hematopoietic stem cells from the subject of (i), (ii), or (iii) or obtaining hematopoietic cells from a donor having an HLA haplotype that matches with the HLA haplotype of the subject of (i), (ii), or (iii); and/or(c) preparing the genetically engineered hematopoietic cells of (i), (ii), or (iii) by modifying an endogenous gene of the hematopoietic cells encoding the CD33 antigen.
Claim 47 encompasses the method of claim 1, wherein the genetically engineered hematopoietic cells are:
(a) hematopoietic stem cells, optionally wherein the hematopoietic stem cells are from bone marrow cells, cord blood cells, or peripheral blood mononuclear cells (PBMCs) and/or CD34+/CD33-; and/or
(b) autologous or allogenic, optionally wherein the genetically engineered hematopoietic cells are allogeneic hematopoietic stem cells obtained from a donor having an HLA haplotype that matches with the HLA haplotype of the subject.
Claim 59 encompasses a method, comprising administering to a subject:
(i) an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain, wherein the subject is receiving or has received an effective amount of a population of genetically engineered modified hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 agent; or
(ii) an effective amount of a population of genetically engineered hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 antigen, wherein the subject is receiving or has received an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain.
The specification exemplifies:
Example 1. Generation of Genetically Engineered Hematopoietic Cells Comprising a Modified Gene Encoding CD33
[0170] The Cas9 sgRNAs indicated in Table 1 were designed based on the SpCas9 PAM (5′-NGG-3′) with close proximity to the target region and evaluated for predicted specificity by minimizing potential off-target sites in the human genome with an online search algorithm (e.g., the Benchling algorithm, Doench et al 2016, Hsu et al 2013).
[0171] Cas9 sgRNAs are synthesized using the gRNA targeting domains provided below and the Cas9 sgRNA scaffold sequence 5′-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 18).
[0172] For example, the nucleotide sequence of sgRNA A is 5′-CCCCAGGACUACUCACUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 19, targeting domain sequence in bold).
[0173] For example, the nucleotide sequence of sgRNA B is 5′-ACCGAGGAGUGAGUAGUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 20, targeting domain sequence in bold).
[0174] For example, the nucleotide sequence of sgRNA C is 5′-GGUGGGGGCAGCUGACAACCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 21, targeting domain sequence in bold).
[0175] For example, the nucleotide sequence of sgRNA D is 5′-CGGUGCUCAUAAUCACCCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 22, targeting domain sequence in bold).
[0176] For example, the nucleotide sequence of sgRNA E is 5′-CCUCACUAGACUUGACCCACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 23, targeting domain sequence in bold).
[0177] All designed synthetic sgRNAs are produced with chemically modified nucleotides at the three terminal positions at both the 5′ and 3′ ends. The modified nucleotides contained 2′-O-methyl-3′-phosphorothioate (abbreviated as “ms”) and the ms-sgRNAs are HPLC-purified. Cas9 protein is purchased from Synthego.
[0178] For example, the nucleotide sequence of sgRNA A, showing the modified nucleotides, is 5′-CmsCmsCmsCAGGACUACUCACUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUmsU msUmsU-3′ (SEQ ID NO: 24, targeting domain sequence in bold).
[0179] For example, the nucleotide sequence of sgRNA E, showing the modified nucleotides, is 5′-CmsCmssUmsCACUAGACUUGACCCACGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUmsU msUmsU-3′ (SEQ ID NO: 25, targeting domain sequence in bold).
[0180] Peripheral blood mononuclear cells are collected from healthy donor subject by apheresis following hematopoietic stem cell mobilization. The donor CD34+ cells are electroporated with Cas9 protein and any of the indicated CD33-targeting Cas9 gRNAs disclosed herein, e.g., having the targeting domain sequences provided in Tables 1 and 3, e.g., gRNA A, gRNA, B, gRNA C, gRNA D, or gRNA E.
TABLE-US-00006 gRNA Name Targeting Domain Sequence PAM gRNA A CCCCAGGACUACUCACUCCU (SEQ ID NO: 9) CGG gRNA B ACCGAGGAGUGAGUAGUCCU (SEQ ID NO: 10) GGG gRNA C GGUGGGGGCAGCUGACAACC (SEQ ID NO: 11) AGG gRNA D CGGUGCUCAUAAUCACCCCA (SEQ ID NO: 12) CGG gRNA E CCUCACUAGACUUGACCCAC (SEQ ID NO: 15) AGG
[0181] The edited cells are cultured for less than 48 hours. Upon harvest, the cells are washed, resuspended in the final formulation, and cryopreserved.
[0182] A representative sample of the edited HSCs is evaluated for viability and expression of CD33, or absence thereof, by staining for CD33 using an anti-CD33 antibody (e.g., P67.7) and analyzed by flow cytometry. Edited CD33KO eHSPC populations exhibiting at least 70% cell viability and at least 45% CD33 editing efficiency (i.e., absence of CD33 expression in at least 45% of the cells in the cell population) at 48 hours after electroporation are used for HCT.
Example 2: Combination Treatment with CD33KO eHSPC and CD33-Targeted ADC (Mylotarg)
[0183] CD33 is a transmembrane receptor that is expressed on normal myeloid cells, as well as most leukemic myeloblasts (e.g., Larson et al. Cancer (2005) 104(7): 1442-1452; Kenderian et al. Leukemia (2015) 29(8): 1637-47; Wang et al. Mol. Ther. (2015) 23(1): 184-91; Pollard et al. J. Clin. Oncol. (2016) 34(7: 747-55). Hematopoietic stem cells that are genetically engineered to have reduced or eliminated expression of CD33 (“CD33KO eHSCs” or “CD33KO eHSPCs”) have the potential to improve the safety and efficacy of CD33 directed therapies, as they are not susceptible to the on-target, off-cancer cytotoxicity reported to be associated with CD33 directed therapies, and thus enable administration of the CD33 directed therapies at an optimal dose and schedule, e.g., without treatment delays or dose omissions.
[0184] The treatment regimen provided herein is directed to subjects having acute myeloid leukemia, or a pre-malignant stage thereof, e.g., myelodysplastic syndrome. Currently, CD33-directed therapies are limited by on-target cytotoxicity directed toward normal myeloid lineage cells. The approach provided herein eliminates this on-target toxicity by administering genetically engineered HSPC that lack expression of the CD33 epitope recognized by the CD33 targeted therapy. Subsequently, the normal myeloid compartment is protected from the on-target effects of CD33 targeted therapy leading to an improved therapeutic index for these agents and potentially better outcomes for subjects with AML.
[0185] This example provides a treatment regimen using allogeneic or autologous CRISPR/Cas9 genome-edited CD33KO eHSPCs lacking expression of CD33. Allogeneic eHSPCs are obtained by processing CD34-positive (CD34+) enriched stem cells obtained from a healthy donor who is HLA matched to recipient, i.e., the subject receiving the CD33KO eHSPCs. Autologous eHSPCs are obtained by processing CD34-positive (CD34+) enriched stem cells obtained from the same subject being treated, i.e., the HSPC donor and the subject receiving the CD33KO eHSPCs are the same. The CD33KO eHSPCs are infused into the recipient subject after receiving a conditioning regimen as part of a hematopoietic cell transplant (HCT).
Gemtuzumab Ozogamicin
[0186] Gemtuzumab ozogamicin/Mylotarg® is a CD33-directed antibody drug conjugate (ADC) approved by the U.S. Food and Drug Administration (FDA) to treat both newly diagnosed CD33-positive (CD33+) adult subjects with AML, as well as subjects with relapsed or refractory AML (R/R AML) who are 1 month of age and older.
[0187] In the case of relapsed or refractory subjects with AML, gemtuzumab ozogamicin/Mylotarg® is currently the only CD33-directed therapy approved by the U.S. FDA. Analyses provided in the “Highlights of Prescribing Information” of the U.S. Prescribing Information for Mylotarg® (Mylotarg 2020), as well as in the U.S. FDA publication on the approval summary, suggest that at doses of 2 mg/m.sup.2 (Norsworthy 2018), available CD33 is saturated in subjects with AML. In addition, the risk for sinusoidal obstruction syndrome/veno-occlusive disease (SOS/VOD), which is a severe and sometimes lethal toxicity associated with gemtuzumab ozogamicin/Mylotarg® administration, is substantially reduced at lower doses. This potentially larger margin of safety supports using a reduced dose in the post-HCT setting where subjects are known to be at higher risk for SOS/VOD. In the current gemtuzumab ozogamicin/Mylotarg® U.S. FDA approved product label, a “continuation” dose and schedule of 2 mg/m.sup.2 administered on day 1 of every 4 week treatment cycle for up to 8 cycles is listed for subjects with AML who are without evidence of disease progression.
[0188] In the clinical treatment regimens provided herein, a similar “continuation” dose and schedule is used as soon as 60 days post-HCT in subjects who have received CD33KO eHSPCs as part of their HCT. This provides for a potentially larger margin of safety in administering gemtuzumab ozogamicin/Mylotarg® in the post-HCT setting, to suppress early leukemia relapse, with the rationale that this allows the subject to undergo more robust immunological reconstitution, which provides a longer term “graft versus leukemia” effect.
Subjects
[0189] The clinical regimens for treating subjects having AML, or a pre-malignant form thereof, with a stem cell transplant comprising CD33KO eHSPCs and the ADC gemtuzumab ozogamicin/Mylotarg® as provided herein are useful for treating subjects having, or diagnosed with, AML that is characterized by expression of CD33, or a pre-malignant form of AML, e.g., MDS, that is characterized by expression of CD33. This includes subjects that are naïve to AML therapy; subjects who have received some form of AML therapy, including, for example, induction therapy; subjects who have experienced a complete hematological remission (CR1 or CR2, including complete remission with incomplete recovery of peripheral counts [CRi]) in response to AML therapy; and subjects with persistent or progressive disease, including, for example, subjects with persistent disease, which includes, for example, subjects with bone marrow blast counts of ≤10% and no clinical evidence of circulating blasts. The regimens provided herein are also useful for treating subjects having myelodysplastic syndrome (MDS) characterized by expression of CD33, including, for example, subjects who are at high risk of progression from MDS to AML.
[0190] The clinical regimens for treating subjects having AML, or a pre-malignant form thereof, with a hematopoietic stem cell transplant comprising CD33KO eHSPCs and the ADC gemtuzumab ozogamicin/Mylotarg® as provided herein regimen are further useful for treating subjects that exhibit one or more of the following adverse risk features: 1) intermediate or high-risk disease-related genetics at presentation and bone marrow that harbors evidence of MRD+ at the time of HCT; or 2) persistence of bone marrow-only leukemic blasts (≤10%) at the time of HCT (with any risk category of disease-related genetics at presentation).
Pre-HCT Conditioning
[0191] Typically, a clinical treatment regimen for including a hematopoietic stem cell transplant comprising CD33KO eHSPCs, including, for example, an HLA-matched allogeneic HCT, as provided in some of the examples herein, comprises a full conditioning regimen. The conditioning regimen may include, for example, busulfan/melphalan/fludarabine/rabbit anti-thymocyte globulin (rATG); or total body irradiation/cyclophosphamide/thiotepa/rATG. The appropriate conditioning regimen is selected for a given subject according to clinical guidelines, taking into account the subject's health and medical history.
Clinical Monitoring
[0192] Subjects receiving a clinical regimen including a hematopoietic stem cell transplant comprising CD33KO eHSPCs and the ADC gemtuzumab ozogamicin/Mylotarg®, as provided herein, are monitored for treatment-related adverse effects during the course of the treatment regimen, as well as during any conditioning or induction regimens that may be indicated, and are also assessed for disease status and the status of HCT graft and the hematopoietic system during treatment and/or after completion of the treatment regimen.
Example 3: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA a, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0193] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0194] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0195] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT. The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-CCCCAGGACUACUCACUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 19, targeting domain sequence in bold, chemical modifications as described in Example 1).
[0196] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0197] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0198] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33− ANC at 28 days after CD33KO eHSPC HCT.
[0199] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33− HSC engraftment and CD33− hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33− ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33− ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0200] Administration of gemtuzumab ozogamicin/Mylotarg® is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0201] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0202] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28d) treatment cycle.
[0203] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0204] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 4: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA B, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0205] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0206] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0207] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT.
[0208] The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-ACCGAGGAGUGAGUAGUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 20, targeting domain sequence in bold, chemical modifications as described for gRNAs in Example 1).
[0209] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0210] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0211] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33− ANC at 28 days after CD33KO eHSPC HCT.
[0212] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33-HSC engraftment and CD33-hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33-ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33-ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0213] Administration of gemtuzumab ozogamicin/Mylotarg is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0214] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0215] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28 d) treatment cycle.
[0216] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0217] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 5: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA C, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0218] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0219] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0220] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT.
[0221] The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-GGUGGGGGCAGCUGACAACCGUUUUAGAGCUAGAAAUAGCAAGUUAAAA UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 21, targeting domain sequence in bold, chemical modifications as described for gRNAs in Example 1).
[0222] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0223] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0224] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33-ANC at 28 days after CD33KO eHSPC HCT.
[0225] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33-HSC engraftment and CD33-hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33-ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33-ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0226] Administration of gemtuzumab ozogamicin/Mylotarg is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0227] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0228] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28d) treatment cycle.
[0229] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0230] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 6: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA D, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0231] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0232] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0233] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT.
[0234] The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-CGGUGCUCAUAAUCACCCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 22, targeting domain sequence in bold, chemical modifications as described for gRNAs in Example 1).
[0235] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0236] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0237] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33-ANC at 28 days after CD33KO eHSPC HCT.
[0238] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33-HSC engraftment and CD33-hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33-ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33-ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0239] Administration of gemtuzumab ozogamicin/Mylotarg® is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0240] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0241] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28d) treatment cycle.
[0242] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0243] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 7: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA E, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0244] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0245] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0246] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT.
[0247] The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-CCUCACUAGACUUGACCCACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 23, targeting domain sequence in bold, chemical modifications as provided in Example 1, see SEQ ID NO: 25).
[0248] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0249] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0250] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33-ANC at 28 days after CD33KO eHSPC HCT.
[0251] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33-HSC engraftment and CD33-hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33-ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33-ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0252] Administration of gemtuzumab ozogamicin/Mylotarg® is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0253] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0254] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28d) treatment cycle.
[0255] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0256] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 8: Combination Treatment
[0257] Subjects having acute myeloid leukemia (AML) are matched with a healthy stem cell donor based on 8/8 loci (HLA-A, -B, -C, DRB1). Up to two apheresis procedures are performed on the donor subject in order to obtain a minimum of 10×10.sup.6 viable cells/kg for the recipient subject.
[0258] At least about 10×10.sup.6 viable cells/kg for the recipient of CD34+ healthy donor cells are used to manufacture the CD33KO eHSPC HCT product and a minimum of 3.0×10.sup.6 viable cells/kg to produce the back-up graft (i.e., rescue dose). The CD33KO eHSPC HCT manufacturing process consists of CD34+ cell enrichment followed by electroporation and editing with a CD33 gRNA/Cas9 complex, for example using any of the CD33 gRNAs described herein, see Table 1. The edited cells are subsequently cultured for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved.
[0259] The recipient subject may undergo a myeloablative conditioning regimen (preconditioning) prior to administration of the CD33 edited hematopoietic cells. After completion of the conditioning regimen, the subject is administered the CD33KO eHSPC HCT on day 0 via an intravenous (IV) infusion. The subject is monitored for neutrophil recovery, which is defined as recovery of peripheral neutrophil count at 28 days following infusion. At day 60, if the subject has successful neutrophil engraftment, the subject receives a bone marrow biopsy to assess disease status and hematopoietic recovery. The percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood. Subjects must have a neutrophil count above a threshold (e.g., ≥1000/dL CD33-ANC) prior to receiving gemtuzumab ozogamicin/Mylotarg®. The subjects then receive gemtuzumab ozogamicin/Mylotarg® at a dose between about 0.1 mg/m.sup.2 to 2.0 mg/m.sup.2.
[0260] The subjects are continued to be evaluated and may receive one or more additional doses of gemtuzumab ozogamicin/Mylotarg® at the same dosage as the previous dose or at a different (increased or decreased) dosage.
Example 9: Combination Treatment Using Multiplexed Editing
[0261] Subjects having acute myeloid leukemia (AML) are matched with a healthy stem cell donor based on 8/8 loci (HLA-A, -B, -C, DRB1). Up to two apheresis procedures are performed on the donor subject in order to obtain a minimum of 10×10.sup.6 viable cells/kg for the recipient subject.
[0262] At least about 10×10.sup.6 viable cells/kg for the recipient of CD34+ healthy donor cells are used to manufacture the double edited hematopoietic cell product and a minimum of 3.0×10.sup.6 viable cells/kg to produce the back-up graft (i.e., rescue dose). The genetic editing manufacturing process consists of CD34+ cell enrichment followed by electroporation and editing with a CD33 gRNA/Cas9 complex, for example using any of the CD33 gRNAs described herein, see Table 1, as well as a gRNA/Cas9 complex targeting a second lineage-specific cell-surface antigen, such as any of the those described herein. The double edited cells are subsequently cultured for <48 hours. Cell surface levels of CD33 and the second lineage-specific cell-surface antigen may be assessed in the double edited cells, for example by flow cytometry.
[0263] Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved.
[0264] The recipient subject may undergo a myeloablative conditioning regimen (preconditioning) prior to administration of the double edited hematopoietic cells. After completion of the conditioning regimen, the subject is administered the double edited hematopoietic cells on day 0 via an intravenous (IV) infusion. The subject is monitored for neutrophil recovery, which is defined as recovery of peripheral neutrophil count at 28 days following infusion. At day 60, if the subject has successful neutrophil engraftment, the subject receives a bone marrow biopsy to assess disease status and hematopoietic recovery. The percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood. Subjects must have a neutrophil count above a threshold (e.g., ≥1000/dL CD33− ANC) prior to receiving gemtuzumab ozogamicin/Mylotarg®. The subjects then receive gemtuzumab ozogamicin/Mylotarg® at a dose between about 0.1 mg/m.sup.2 to 2.0 mg/m.sup.2.
[0265] The subjects are continued to be evaluated and may receive one or more additional doses of gemtuzumab ozogamicin/Mylotarg® at the same dosage as the previous dose or at a different (increased or decreased) dosage.
Example 10: Xenotransplantation Model for Use of Human CD33KO eHSPC Generated Using gRNA E and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0266] The objective of this study was to investigate whether human hematopoietic stem and progenitor cells (HSPCs) that have been genetic engineered to have reduced or eliminated expression of CD33, or their derivative cells (descendants thereof), are protected against the cytotoxicity of gemtuzumab ozogamicin/Mylotarg® using a mouse model.
[0267] Mobilized PBMCs were obtained from two human donors (Donor 1 and Donor 2) and screened to confirm that the cells are not homozygous for a single nucleotide polymorphism (SNP) at rs12459419, which causes an alternatively spliced transcript variant lacking exon 2, resulting in decreased expression of full-length CD33 isoform, and would therefore not be recognized or targeted by gemtuzumab ozogamicin/Mylotarg®.
[0268] Briefly, as shown in FIG. 2, CD34+ HSPCs from the donor were electroporated with CD33 gRNA E Cas9 ribonucleoprotein complex, as described in Example 1. Cells from the same donor were electroporated without RNP were used as negative controls (“Mock EP”). CD33 editing efficiency is shown in Table 4. Cell number and viability were also quantified prior to and after electroporation (Table 5).
TABLE-US-00007 TABLE 4 CD33 editing efficiency of human CD34+ HSPCs Donor gRNA Editing Frequency Donor 1 CD33 gRNA-E 86% Donor 2 CD33 gRNA-E 76%
TABLE-US-00008 TABLE 5 Cell numbers and viability Pre-EP 48 Hours Post-EP Viable Mock EP CD33KO Cell # per Viable Viable Donor Viability Condition Viability Cell # Viability Cell # Donor 1 98% 7.2 × 10.sup.7 93% 9.4 × 10.sup.7 94% 9.4 × 10.sup.7 Donor 2 97% 6.0 × 10.sup.7 88% 5.5 × 10.sup.7 87% 4.8 × 10.sup.7
[0269] CD33-edited HSPCs (CD33KO) and Mock EP control CD34+ HSPCs were injected via tail vein into sub-lethally irradiated NOD/scid/IL2R7.sup.null ((NOD.Cg-Prkdc.sup.scidIl2rg.sup.tm1Wjl, NSG™) mice. At 8 weeks post-transplantation, retro-orbital blood was collected from each mouse for flow cytometry analysis to assess engraftment of CD34+ HSPCs. Retro-orbital bleeding was also performed at 12 weeks post-transplantation to collect plasma and cell pellets, which were stored for further analysis. At 15 weeks post-transplantation, after hematopoietic reconstitution by transplanted human HSPCs, the mice were dosed intravenously with either gemtuzumab ozogamicin/Mylotarg® (0.33 mg/kg) or DPBS (Dulbecco's phosphate-buffered saline) as the vehicle control (“vehicle”). Eight days post-treatment with gemtuzumab ozogamicin/Mylotarg® or vehicle (at 16 weeks after transplantation), mice were euthanized and bone marrow, blood, and spleens were harvested for flow cytometry analysis. The experimental groupings for cells obtained from Donor 1 and Donor 2 are shown in Tables 6 and 7, respectively.
TABLE-US-00009 TABLE 6 Experimental groupings for cells obtained from Donor 1 Group Number of Mice mPB CD34.sup.+ HSPCs Treatment 1 16 CD33 gRNA-Cas9 Vehicle 2 16 RNP Mylotarg (0.33 mg/kg) 3 .sup. 16.sup.# Mock EP control Vehicle 4 16 Mylotarg (0.33 mg/kg)
TABLE-US-00010 TABLE 7 Experimental groupings for cells obtained from Donor 2 Group Number of Mice mPB CD34.sup.+ HSPCs Treatment 1 16 Mock EP control Vehicle 2 16 Mylotarg (0.33 mg/kg) 3 16 CD33 gRNA-Cas9 Vehicle 4 16 RNP Mylotarg (0.33 mg/kg)
[0270] As shown in FIG. 3A, for mice engrafted with Mock EP HSPCs from Donor 1, human leukocyte reconstitution (hCD45+ cells) was reduced by gemtuzumab ozogamicin/Mylotarg® treatment, for mice engrafted with CD33-edited HSPCs from Donor 1 were not impacted by gemtuzumab ozogamicin/Mylotarg®. Additionally, CD33 gene-editing did not result in a significant change in human cell leukocyte chimerism as evidenced by human CD45 staining. For mice engrafted with HSPCs from Donor 2, no statistically significant difference was observed in human cell chimerism between groups that received gemtuzumab ozogamicin/Mylotarg® treatment versus vehicle control, or comparing mice engrafted with CD33-edited HSPCs versus Mock EP HSPCs (FIG. 5A).
[0271] The percentages of CD33+ cells among total human leukocytes (hCD45+ cells) in the bone marrow of engrafted animals were analyzed by flow cytometry. For HSPCs from each donor, mice that were engrafted with the Mock EP HSPCs followed by treatment with gemtuzumab ozogamicin/Mylotarg® had a significant reduction of CD33+ cells, as compared to treatment with vehicle alone (FIGS. 3B, 5B). Moreover, mice engrafted with CD33-edited HSPCs showed a nearly complete loss of CD33+ cells, as compared to mice engrafted with Mock EP HSPCs, regardless of treatment with gemtuzumab ozogamicin/Mylotarg® or vehicle control (FIGS. 3B, 5B). Without wishing to be bound by any particular theory, these results are thought to be due to highly efficient editing of donor human HSPCs and demonstrate robust ablation of CD33+ cells by gemtuzumab ozogamicin/Mylotarg®. This suggests there is long-term persistence of CD33-edited HSPCs cells in this xenotransplant model.
[0272] Cells expressing different human myeloid markers were also evaluated from the human CD45+ (mouse CD45−) population. The fractions of monocytes (CD14+ myeloid cells) in total human leukocytes (hCD45+) in the bone marrow of engrafted mice were analyzed. For both donors, gemtuzumab ozogamicin/Mylotarg® treatment led to a near complete elimination of CD14+ myeloid cells in the mice engrafted with Mock EP HSPCs group (FIGS. 3C, 5C). In contrast, gemtuzumab ozogamicin/Mylotarg® treatment had less of an impact on the percentage of CD14+ myeloid cells in mice that were transplanted with CD33-edited HSPCs (FIGS. 3C, 5C). These results indicate that the CD33-edited myeloid cells were protected from the cytotoxicity of gemtuzumab ozogamicin/Mylotarg® (FIG. 3E). No significant difference was observed in the percentage of CD14+ myeloid cells between mice engrafted with Mock EP HSPCs and those engrafted CD33-edited HSPCs, supporting that loss of CD33 does not compromise long-term differentiation of CD14+ myeloid cells from HSPCs.
[0273] CD11b+ myeloid cells within the hCD45+ population of cells were also analyzed. For mice engrafted with Mock EP HSPCs from either donor, gemtuzumab ozogamicin/Mylotarg® treatment eradicated the majority of CD11b+ myeloid cells (FIGS. 3D, 5D). In contrast, gemtuzumab ozogamicin/Mylotarg® treatment had less of an impact on the percentage of CD11b+ myeloid cells in mice that were transplanted with CD33-edited HSPCs (FIGS. 3D, 5D). These results support that reduction in CD33 protects the CD11b+ myeloid cells against gemtuzumab ozogamicin/Mylotarg®. No significant difference was observed in the percentage of CD11b+ myeloid cells between mice engrafted with Mock EP HSPCs and those engrafted CD33-edited HSPCs, supporting that loss of CD33 does not compromise long-term differentiation of CD11b+ myeloid cells from HSPCs.
[0274] In addition to myeloid cells, the percentages of CD3+ T cells among total human CD45+ cells in the bone marrow of engrafted mice were analyzed. No statistically significant difference was observed in the percentage of CD3+ T cells in mice that were transplanted with Mock EP HSPCs as compared to mice that were transplanted with CD33-edited HSPCs (FIGS. 4A, 6A). As expected, CD3+ T cells were not affected by gemtuzumab ozogamicin/Mylotarg® treatment.
[0275] The percentages of CD19+ B cells among total human CD45+ cells in the bone marrow of engrafted animals were analyzed. No statistically significant difference was observed in the percentage of CD19+ B cells in mice that were transplanted with Mock EP HSPCs as compared to mice that were transplanted with CD33-edited HSPCs (FIGS. 4B, 6B). As expected, CD19+ B cells were not affected by gemtuzumab ozogamicin/Mylotarg® treatment.
[0276] Comparing vehicle-treated groups, mice transplanted with CD33-edited HSPCs and Mock EP HSPCs had equivalent levels of B cells, suggesting that B cell differentiation from HSPCs is not disturbed by CD33KO. Comparing the mice that received gemtuzumab ozogamicin/Mylotarg® treatment, mice transplanted with Mock EP HSPCs had a higher fraction of CD19+ B cells among total human leukocytes than those transplanted with CD33-edited HSPCs (FIGS. 4B, 6B). This likely reflects that since myeloid and lymphoid fractions make up most of the total human leukocyte compartment in the bone marrow of this mouse model, a decrease in the myeloid proportion (due to gemtuzumab ozogamicin/Mylotarg® treatment) will result in an apparent proportional increase in the lymphoid fraction, in the mice that received Mock EP HSPCs.
[0277] In addition, the percentages of CD34+CD38− human primitive HSPCs were evaluated in the bone marrow of engrafted mice. No statistically significant difference was observed in the percentage of CD34+CD38− cells in mice that received Mock EP HSPCs versus CD33-edited HSPCs nor between mice that received gemtuzumab ozogamicin/Mylotarg® treatment versus vehicle control (FIGS. 4C, 6C). These results suggest that loss of CD33 does not impact CD34+CD38− primitive HSPCs, and that the primitive HSPCs are not targeted by gemtuzumab ozogamicin/Mylotarg® cytotoxicity.
[0278] In sum, these analyses indicate that CD33-deficient cells are protected from gemtuzumab ozogamicin/Mylotarg cytotoxicity. Upon engraftment, CD33-edited HSPCs reconstituted a multilineage hematopoietic system with equivalent levels of human leukocyte chimerism, lymphoid and myeloid lineages, and primitive HSPCs, as control HSPCs. Additionally, a significant loss of CD33+ cells was observed in mice engrafted with CD33-edited HSPCs, demonstrating highly efficient CD33 disruption after 16 weeks and long-term persistence of CD33-deficient cells. In mice engrafted with control (unedited) HSPCs, gemtuzumab ozogamicin/Mylotarg® treatment effectively eliminated CD14+ and CD11b+ myeloid cells. In contrast, a significantly higher level of myeloid cells was retained post gemtuzumab ozogamicin/Mylotarg® treatment in animals transplanted with CD33-edited HSPCs. Taken together, these findings demonstrate that depletion of CD33 confers substantial protection to myeloid cells against gemtuzumab ozogamicin/Mylotarg® cytotoxicity in vivo.
Example 11: Clinical Scale Manufacturing of Human CD33KO eHSPC
[0279] Two clinical-scale batches of allogeneic CRISPR/Cas9 genome edited hematopoietic stem/progenitor cells (HSPCs) lacking the CD33 protein were manufactured for the treatment of human leukocyte antigen (HLA)-matched patients with high-risk CD33+ acute myeloid leukemia (AML). The resulting HSPC populations are suitable for infusion into HLA-matched human patients with AML undergoing hematopoietic cell transplant, e.g., patients who are known to be at high-risk for leukemia relapse and mortality post-transplantation.
[0280] The final HSPC populations were formulated at a volume of 45 mL in cryopreservation media ready for cryopreservation, storage in the vapor phase of liquid nitrogen, subsequent thawing and administration via intravenous (IV) infusion to a recipient patient.
[0281] Each batch was manufactured from leukapheresis starting material obtained from a single donor to generate a one-donor-to-one-recipient HLA matched product, allowing for the manufacture of the product for a specifically matched patient.
[0282] For each batch, a healthy donor was subjected to a leukapheresis procedure. Leukapheresis starting material was collected and stored at 2-8° C. before initiation of cell manipulation. Cell number and viability of the leukapheresis starting material was tested by flow cytometry. Cell viability was confirmed to be ≥80%. A sample was removed for cell analysis and other assessments.
[0283] A leukapheresis rescue dose was removed from the leukapheresis material to obtain a volume comprising 3×10.sup.6 CD34+ cells/kg of patient weight. The rescue dose material was cryopreserved and stored in the vapor phase of liquid nitrogen at ≤−140° C.
[0284] After rescue dose removal, the leukapheresis starting material was processed to remove red blood cells, platelets, and plasma. The processed material was then enriched for CD34-positive cells and then transferred into 250 mL conical tubes.
[0285] A Cas9/gRNA ribonucleoprotein (RNP) complex was prepared prior to electroporation by mixing Cas9 protein and gRNA E under sterile conditions. Cells in the 250 mL conical tube were spun down at 200×g, resuspended in electroporation buffer, mixed with the prepared RNP complex, and electroporated in a single-use sterile electroporation cassette.
[0286] Post-electroporation, the cells were removed from the cassette, transferred to culture media, and incubated in suspension culture at 37° C. and 5% CO.sub.2. Cell cultures were monitored for cell count and viability. Once cells recovered from electroporation (determined by cell viability being ≥80%), the cells were washed to reduce cellular debris and other residuals, and resuspended in serum-free, animal component-free, and defined cryopreservation medium containing 10% DMSO. The cells were formulated at a volume of 45 mL and cryopreserved in a controlled rate freezer (CRF). Samples were taken to determine cell counts, viability, percentage of cells expressing particular markers (e.g., CD34, CD3, CD19, CD19, CD56), editing efficiency, and residual Cas9 as shown in Table 8 below.
TABLE-US-00011 TABLE 8 Analysis of exemplary cell preparations BATCH 1 BATCH 2 Volume 45 ml 45 ml Viable cell concentration 6.5 × 10.sup.6 cells/mL 3.6 × 10.sup.6 cells/mL Viability 78% 70% CD34.sup.+ 95% 96% CD3.sup.+ 0% 1% CD19.sup.+ 0.3% 0.9% CD14.sup.+ 0.2% 0.2% CD56.sup.+ 1.1% 1.1% CD33 edited 67% 64% Residual Cas9 BLLQ BLLQ BLLQ = below lower limit of quantification.
Regarding administering to a subject (claims 1, 2, 4, 6, 9, 17, 20), the subject encompasses healthy as well as subject having hematopoietic malignancy or hematopoietic pre-malignant disease. The specification discloses treating a subject having acute myeloid leukemia (AML) or pre-malignant form thereof having myelodysplastic syndrome, see para. [0184].
However, neither the specification nor the art teaches administering a healthy subject a population of genetically knockout CD33 expression of hematopoietic cells and cytotoxic agent comprising any anti-CD33 antigen-binding domain. There are no in vivo working examples.
Regarding any genetically engineered hematopoietic cells, or descendants thereof, the specification discloses allogeneic or autologous hematopoietic stem cells that are genetically engineered to have reduced or eliminated expression of CD33 (“CD33KO eHSCs” or “CD33KO eHSPCs”) using sgRNAs comprising the nucleotide sequences of SEQ ID NO: 24, 25.
Regarding any cytotoxic agent comprising any anti-CD33 antigen-binding domain, the specification just one Gemtuzumab ozogamicin, which is a CD33-directed antibody drug conjugate (ADC) approved by the U.S. Food and Drug Administration (FDA) to treat both newly diagnosed CD33-positive (CD33+) adult subjects with AML, as well as subjects with relapsed or refractory AML (R/R AML) who are 1 month of age and older.
However, the specification does not teach i. Complete structure, e.g., heavy and light chains variable domains, ii. Partial structure, e.g., six CDRs and functional features share by members of the genus of anti-CD33 antibodies linked to any and all possible cytotoxic agent for administering to a subject and engineered hematopoietic cells or descendants thereof.
It is known in the art that antibodies have a large repertoire of distinct structures and that a huge variety of antibodies can be made to bind to a single epitope.
For example, Lloyd et al. taught that hundreds of functional antibody fragments can be isolated from an antibody library that bind to the same antigen wherein these antibodies have distinct heavy and light chain sequences (Lloyd et al. Protein Engineering, Design & Selection 22:159-168, 2009; see, e.g., Discussion).
Similarly, Edwards et al., J Mol Biol. 334(1): 103-118, 2003; PTO 892, found that over 1000 antibodies, all different in amino acid sequence, were generated to a single protein; 568 different amino acid sequences identified for the V(H) CDR3 domains of these antibodies (Abstract). Given that hundreds of unique antibody structures may bind a single antigen, the structure of an antibody cannot be predicted from the structure of the antigen (as held in Amgen), and a single species, or small group of species, cannot define a structure-function relationship so as to be representative of all the antibodies that bind to that antigen (as held in Abbvie).
Regarding antibody drug conjugate, the state of the prior art is such that the location or site of conjugation on the drug and the antibody affect conjugate stability, and pharmacokinetics of antibody drug conjugates.
For example, Strop et al (Chemistry and Biology 20: 161-167, 2013; PTO 892) teach drug position can have a significant effect on linker stability and antibody pharmacokinetics. The site of conjugation on the drug and antibody can influence ADC properties differently in mice and rats, highlighting potential pitfalls of examining efficacy in mouse xenograft models and toxicity in rats or nonhuman primates, see abstract, p 166, p. 168 right col, in particular.
Nejadmoghaddam et al (Avicenna Journal of Medical Biotechnology 2(1): 3-23, 2019; PTO 892) discusses major obstacles of antibody-drug conjugates include off-target toxicity, tumor marker selection, antibody specificity, adequately affinity and receptor-mediated internalization are major aspects of choice, cytotoxic payload (e.g., up to 7 drugs per antibody), cytotoxic payload linkage strategy, aqueous solubility, non-immunogenic and stability in storage and bloodstream, see entire document, abstract, p. 15, in particular.
There are insufficient in vivo working examples. It is unpredictable which anti-CD33 conjugate in combination with genetically engineered hematopoietic cells or descendants thereof having recued or eliminated CD33 expression is effective to treat a subject having acute myeloid leukemia (AML) or pre-malignant form thereof having myelodysplastic syndrome.
Vas-Gath, Inc. v. Mahurkar, 935 F.2d 1555, 1562-63, 19 USPQ2d 1111 (Fed. Cir. 1991), makes clear that: "applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the 'written description' inquiry, whatever is now claimed." (See page 1117.) The specification does not "clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed." (See Vas-Gath at page 1116.).
Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method for isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (CAFC 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016.
One cannot describe what one has not conceived. See Fiddles v. Baird, 30 USPQ2d 1481, 1483. In Fiddles v. Baird, claims directed to mammalian FGF’s were found unpatentable due to lack of written description for the broad class. The specification provided only the bovine sequence. Thus, the specification fails to describe these DNA sequences.
For genus claims, an adequate written description of a claimed genus requires more than a generic statement of an invention's boundaries. A patent must set forth either a representative number of species falling within the scope of the genus or structural features common to the members of the genus. Kubin, Exparte, 83 USPQ2d 1410 (Bd. Pat. App. & Int. 2007); Ariad Pharms., Inc. v. Eli Lilly& Co., 598 F.3d 1336, 1350 (Fed. Cir. 2010).
Therefore, only (1) a method of treating a hematopoietic malignancy, comprising administering to a subject in need thereof: (a) an effective amount of a population of genetically engineered CD33 knockout hematopoietic cells (HCs) or descendants thereof, comprising: (i) a genetically engineered gene encoding CD33 that is engineered to have reduced or eliminated expression of CD33 using sgRNAs comprising the nucleotide sequences as shown in the working example, and (ii) a therapeutically effective amount of gemtuzumab ozogamicin, but not the full breadth of the claims meets the written description provision of 35 U.S.C. § 112, first paragraph.
Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. § 112 is severable from its enablement provision (see page 1115).
Claims 1-2, 4, 6, 9, 17, 20, 24, 30, 34, 45, 47 and 59 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for (1) a method of treating a hematopoietic malignancy, comprising administering to a subject in need thereof: (a) an effective amount of a population of genetically engineered CD33 knockout hematopoietic cells (HCs) or descendants thereof, comprising: (i) a genetically engineered gene encoding CD33 that is engineered to have reduced or eliminated expression of CD33 using sgRNAs comprising the nucleotide sequences as shown in the working example, and (ii) a therapeutically effective amount of gemtuzumab ozogamicin, does not reasonably provide enablement for a method of removing any and all thrombogenic agents from an immunoglobulin containing solution. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
Enablement is considered in view of the Wands factors (MPEP 2164.01(a)). These factors include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. . In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988).
Claim 1 encompasses a method, comprising administering to a subject: an effective amount of a population of genetically engineered hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 antigen; and an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain.
Claim 2 encompasses the method of claim 1, wherein the cytotoxic agent is an antibody-drug conjugate (ADC), optionally wherein the ADC is gemtuzumab ozogamicin.
Claim 4 encompasses the method of claim 1any one of claims 1-3, wherein the effective amount of the population of genetically engineered hematopoietic cells is about 106 cells/kilogram body weight of the subject to about 107 cells/kilogram body weight of the subject, optionally wherein the effective amount of the population of genetically engineered hematopoietic cells is about 3.0 x 106 cells/kilogram body weight of the subject.
Claim 6 encompasses the method of claim 1, wherein the effective amount of the cytotoxic agent is about 0.1 mg/in2 body surface area of the subject to about 2.0 mg/in2 body surface area of the subject, optionally wherein the effective amount of the cytotoxic agent is about 0.1 mg/m2, about 0.25 mg/m2, about 0.5 mg/m2, about 1.0 mg/m2, or about 2.0 mg/m2 body surface area of the subject.
Claim 9 encompasses the method of claim 1, wherein the population of genetically engineered hematopoietic cells and the cytotoxic agent are administered in temporal proximity, optionally wherein administering in temporal proximity comprises:(a) administering the population of genetically engineered hematopoietic cells and the cytotoxic agent within a single treatment regimen;(b) administering the population of genetically engineered hematopoietic cells and the cytotoxic agent simultaneously;(c) administering the population of genetically engineered hematopoietic cells and the cytotoxic agent concurrently;(d) administering the population of genetically engineered hematopoietic cells and the cytotoxic agent sequentially; or (e) administering the population of genetically engineered hematopoietic cells within 120, 90, or 60 days of administering the cytotoxic agent.
Claim 17 encompasses the method of claim 1, wherein the population of genetically engineered hematopoietic cells are:
(a) administered prior to the cytotoxic agent;
(b) administered in a single treatment regimen;
(c) administered intravenously; and/or
(d) thawed from a cryopreserved form prior to administration.
Claim 20 encompasses the method of claim 1, wherein the cytotoxic agent is:
(a) administered in multiple doses of the effective amount every four weeks;
(b) administered in multiple doses of about 2.0 mg/m² every four weeks; and/or
(c) reconstituted from a lyophilized form prior to administration.
Claim 24 encompasses the method of claim 1, wherein:
(a)the subject has been preconditioned prior to administering the cytotoxic agent and/or the hematopoietic cells; and/or
(b) the method further comprises preconditioning the subject prior to administering the cytotoxic agent and/or the hematopoietic cells, optionally wherein preconditioning according to (a) and/or (b) comprises:
(i) administering one or more chemotherapeutic agents to the subject, optionally wherein the one or more chemotherapeutic agents are selected from the group consisting of busulfan, melphalan, fludarabine, cyclophosphamide, and thiotepa;
(ii) total body irradiation of the subject; and/or
(iii) administering antibodies that bind human T cells, optionally wherein the antibodies comprise rabbit anti-thymocyte globulins (rATG).
Claim 30 encompasses the method of claim 1, wherein the subject has, or has been diagnosed with, a hematopoietic malignancy or a hematopoietic pre-malignant disease, and wherein the hematopoietic malignancy is characterized by the presence of CD33-positive malignant cells, or wherein the hematopoietic pre-malignant disease is characterized by the presence of CD33-positive pre-malignant cells, or
(b) has, or has been diagnosed with, a CD33-positive acute myeloid leukemia, a CD33-positive myelodysplastic syndrome, or a CD33-positive myelodysplastic syndrome and is at high risk of developing acute myeloid leukemia.
34. (Currently Amended) The method of claim 1 any one of claims 1-33, wherein the subject:
(a) is naive to chemotherapy and/or radiation therapy, optionally wherein the subject is naive to any treatment aimed to address a hematopoietic malignancy or hematopoietic pre-malignant disease or has previously received chemotherapy;
(b) has previously received induction therapy;
(c) has previously entered a complete hematological remission, optionally wherein the complete hematological remission is characterized by an incomplete recovery of peripheral counts
(d) has one or more risk factors associated with early leukemia relapse; optionally wherein the one or more risk factors associated with early leukemia relapse are selected from the group consisting of: bone marrow in morphological complete remission with presence of intermediate or high-risk disease-related genetics, presence of minimal residual disease (MRD) post cyto-reductive therapy, bone marrow with persistent leukemia blasts post cyto-reductive therapy, and bone marrow blast count of about 10% or less with no circulating blasts;(e) does not have a homozygous dominant genotype for CD33 single nucleotide polymorphism (SNP) rs12459419;(f) does not have acute promyelocytic leukemia or chronic myeloid leukemia;(g) does not have a genetic translocation associated with acute promyelocytic leukemia or chronic myeloid leukemia, optionally wherein the genetic translocation is t(15; 17)(922; q21) or t(9;22)(834; 11):(h) has not previously received a stem cell transplantation;(i) has not previously received the cytotoxic agent; and/or(j) has a CD33-negative absolute neutrophil count (ANC) of at least 1000/dL prior to receiving the cytotoxic agent.
Claim 45 encompasses the method of claim 1, further comprising:
(a) determining a percent donor chimerism and/or a level of CD33-negative myeloid hematopoiesis in a peripheral blood sample from the subject;
(b) obtaining autologous hematopoietic stem cells from the subject of (i), (ii), or (iii) or obtaining hematopoietic cells from a donor having an HLA haplotype that matches with the HLA haplotype of the subject of (i), (ii), or (iii); and/or(c) preparing the genetically engineered hematopoietic cells of (i), (ii), or (iii) by modifying an endogenous gene of the hematopoietic cells encoding the CD33 antigen.
Claim 47 encompasses the method of claim 1, wherein the genetically engineered hematopoietic cells are:
(a) hematopoietic stem cells, optionally wherein the hematopoietic stem cells are from bone marrow cells, cord blood cells, or peripheral blood mononuclear cells (PBMCs) and/or CD34+/CD33-; and/or
(b) autologous or allogenic, optionally wherein the genetically engineered hematopoietic cells are allogeneic hematopoietic stem cells obtained from a donor having an HLA haplotype that matches with the HLA haplotype of the subject.
Claim 59 encompasses a method, comprising administering to a subject:
(i) an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain, wherein the subject is receiving or has received an effective amount of a population of genetically engineered modified hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 agent; or
(ii) an effective amount of a population of genetically engineered hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 antigen, wherein the subject is receiving or has received an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain.
The specification exemplifies:
Example 1. Generation of Genetically Engineered Hematopoietic Cells Comprising a Modified Gene Encoding CD33
[0170] The Cas9 sgRNAs indicated in Table 1 were designed based on the SpCas9 PAM (5′-NGG-3′) with close proximity to the target region and evaluated for predicted specificity by minimizing potential off-target sites in the human genome with an online search algorithm (e.g., the Benchling algorithm, Doench et al 2016, Hsu et al 2013).
[0171] Cas9 sgRNAs are synthesized using the gRNA targeting domains provided below and the Cas9 sgRNA scaffold sequence 5′-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 18).
[0172] For example, the nucleotide sequence of sgRNA A is 5′-CCCCAGGACUACUCACUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 19, targeting domain sequence in bold).
[0173] For example, the nucleotide sequence of sgRNA B is 5′-ACCGAGGAGUGAGUAGUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 20, targeting domain sequence in bold).
[0174] For example, the nucleotide sequence of sgRNA C is 5′-GGUGGGGGCAGCUGACAACCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 21, targeting domain sequence in bold).
[0175] For example, the nucleotide sequence of sgRNA D is 5′-CGGUGCUCAUAAUCACCCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 22, targeting domain sequence in bold).
[0176] For example, the nucleotide sequence of sgRNA E is 5′-CCUCACUAGACUUGACCCACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 23, targeting domain sequence in bold).
[0177] All designed synthetic sgRNAs are produced with chemically modified nucleotides at the three terminal positions at both the 5′ and 3′ ends. The modified nucleotides contained 2′-O-methyl-3′-phosphorothioate (abbreviated as “ms”) and the ms-sgRNAs are HPLC-purified. Cas9 protein is purchased from Synthego.
[0178] For example, the nucleotide sequence of sgRNA A, showing the modified nucleotides, is 5′-CmsCmsCmsCAGGACUACUCACUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUmsU msUmsU-3′ (SEQ ID NO: 24, targeting domain sequence in bold).
[0179] For example, the nucleotide sequence of sgRNA E, showing the modified nucleotides, is 5′-CmsCmssUmsCACUAGACUUGACCCACGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUmsU msUmsU-3′ (SEQ ID NO: 25, targeting domain sequence in bold).
[0180] Peripheral blood mononuclear cells are collected from healthy donor subject by apheresis following hematopoietic stem cell mobilization. The donor CD34+ cells are electroporated with Cas9 protein and any of the indicated CD33-targeting Cas9 gRNAs disclosed herein, e.g., having the targeting domain sequences provided in Tables 1 and 3, e.g., gRNA A, gRNA, B, gRNA C, gRNA D, or gRNA E.
PNG
media_image1.png
165
670
media_image1.png
Greyscale
[0181] The edited cells are cultured for less than 48 hours. Upon harvest, the cells are washed, resuspended in the final formulation, and cryopreserved.
[0182] A representative sample of the edited HSCs is evaluated for viability and expression of CD33, or absence thereof, by staining for CD33 using an anti-CD33 antibody (e.g., P67.7) and analyzed by flow cytometry. Edited CD33KO eHSPC populations exhibiting at least 70% cell viability and at least 45% CD33 editing efficiency (i.e., absence of CD33 expression in at least 45% of the cells in the cell population) at 48 hours after electroporation are used for HCT.
Example 2: Combination Treatment with CD33KO eHSPC and CD33-Targeted ADC (Mylotarg)
[0183] CD33 is a transmembrane receptor that is expressed on normal myeloid cells, as well as most leukemic myeloblasts (e.g., Larson et al. Cancer (2005) 104(7): 1442-1452; Kenderian et al. Leukemia (2015) 29(8): 1637-47; Wang et al. Mol. Ther. (2015) 23(1): 184-91; Pollard et al. J. Clin. Oncol. (2016) 34(7: 747-55). Hematopoietic stem cells that are genetically engineered to have reduced or eliminated expression of CD33 (“CD33KO eHSCs” or “CD33KO eHSPCs”) have the potential to improve the safety and efficacy of CD33 directed therapies, as they are not susceptible to the on-target, off-cancer cytotoxicity reported to be associated with CD33 directed therapies, and thus enable administration of the CD33 directed therapies at an optimal dose and schedule, e.g., without treatment delays or dose omissions.
[0184] The treatment regimen provided herein is directed to subjects having acute myeloid leukemia, or a pre-malignant stage thereof, e.g., myelodysplastic syndrome. Currently, CD33-directed therapies are limited by on-target cytotoxicity directed toward normal myeloid lineage cells. The approach provided herein eliminates this on-target toxicity by administering genetically engineered HSPC that lack expression of the CD33 epitope recognized by the CD33 targeted therapy. Subsequently, the normal myeloid compartment is protected from the on-target effects of CD33 targeted therapy leading to an improved therapeutic index for these agents and potentially better outcomes for subjects with AML.
[0185] This example provides a treatment regimen using allogeneic or autologous CRISPR/Cas9 genome-edited CD33KO eHSPCs lacking expression of CD33. Allogeneic eHSPCs are obtained by processing CD34-positive (CD34+) enriched stem cells obtained from a healthy donor who is HLA matched to recipient, i.e., the subject receiving the CD33KO eHSPCs. Autologous eHSPCs are obtained by processing CD34-positive (CD34+) enriched stem cells obtained from the same subject being treated, i.e., the HSPC donor and the subject receiving the CD33KO eHSPCs are the same. The CD33KO eHSPCs are infused into the recipient subject after receiving a conditioning regimen as part of a hematopoietic cell transplant (HCT).
Gemtuzumab Ozogamicin
[0186] Gemtuzumab ozogamicin/Mylotarg® is a CD33-directed antibody drug conjugate (ADC) approved by the U.S. Food and Drug Administration (FDA) to treat both newly diagnosed CD33-positive (CD33+) adult subjects with AML, as well as subjects with relapsed or refractory AML (R/R AML) who are 1 month of age and older.
[0187] In the case of relapsed or refractory subjects with AML, gemtuzumab ozogamicin/Mylotarg® is currently the only CD33-directed therapy approved by the U.S. FDA. Analyses provided in the “Highlights of Prescribing Information” of the U.S. Prescribing Information for Mylotarg® (Mylotarg 2020), as well as in the U.S. FDA publication on the approval summary, suggest that at doses of 2 mg/m.sup.2 (Norsworthy 2018), available CD33 is saturated in subjects with AML. In addition, the risk for sinusoidal obstruction syndrome/veno-occlusive disease (SOS/VOD), which is a severe and sometimes lethal toxicity associated with gemtuzumab ozogamicin/Mylotarg® administration, is substantially reduced at lower doses. This potentially larger margin of safety supports using a reduced dose in the post-HCT setting where subjects are known to be at higher risk for SOS/VOD. In the current gemtuzumab ozogamicin/Mylotarg® U.S. FDA approved product label, a “continuation” dose and schedule of 2 mg/m.sup.2 administered on day 1 of every 4 week treatment cycle for up to 8 cycles is listed for subjects with AML who are without evidence of disease progression.
[0188] In the clinical treatment regimens provided herein, a similar “continuation” dose and schedule is used as soon as 60 days post-HCT in subjects who have received CD33KO eHSPCs as part of their HCT. This provides for a potentially larger margin of safety in administering gemtuzumab ozogamicin/Mylotarg® in the post-HCT setting, to suppress early leukemia relapse, with the rationale that this allows the subject to undergo more robust immunological reconstitution, which provides a longer term “graft versus leukemia” effect.
Subjects
[0189] The clinical regimens for treating subjects having AML, or a pre-malignant form thereof, with a stem cell transplant comprising CD33KO eHSPCs and the ADC gemtuzumab ozogamicin/Mylotarg® as provided herein are useful for treating subjects having, or diagnosed with, AML that is characterized by expression of CD33, or a pre-malignant form of AML, e.g., MDS, that is characterized by expression of CD33. This includes subjects that are naïve to AML therapy; subjects who have received some form of AML therapy, including, for example, induction therapy; subjects who have experienced a complete hematological remission (CR1 or CR2, including complete remission with incomplete recovery of peripheral counts [CRi]) in response to AML therapy; and subjects with persistent or progressive disease, including, for example, subjects with persistent disease, which includes, for example, subjects with bone marrow blast counts of ≤10% and no clinical evidence of circulating blasts. The regimens provided herein are also useful for treating subjects having myelodysplastic syndrome (MDS) characterized by expression of CD33, including, for example, subjects who are at high risk of progression from MDS to AML.
[0190] The clinical regimens for treating subjects having AML, or a pre-malignant form thereof, with a hematopoietic stem cell transplant comprising CD33KO eHSPCs and the ADC gemtuzumab ozogamicin/Mylotarg® as provided herein regimen are further useful for treating subjects that exhibit one or more of the following adverse risk features: 1) intermediate or high-risk disease-related genetics at presentation and bone marrow that harbors evidence of MRD+ at the time of HCT; or 2) persistence of bone marrow-only leukemic blasts (≤10%) at the time of HCT (with any risk category of disease-related genetics at presentation).
Pre-HCT Conditioning
[0191] Typically, a clinical treatment regimen for including a hematopoietic stem cell transplant comprising CD33KO eHSPCs, including, for example, an HLA-matched allogeneic HCT, as provided in some of the examples herein, comprises a full conditioning regimen. The conditioning regimen may include, for example, busulfan/melphalan/fludarabine/rabbit anti-thymocyte globulin (rATG); or total body irradiation/cyclophosphamide/thiotepa/rATG. The appropriate conditioning regimen is selected for a given subject according to clinical guidelines, taking into account the subject's health and medical history.
Clinical Monitoring
[0192] Subjects receiving a clinical regimen including a hematopoietic stem cell transplant comprising CD33KO eHSPCs and the ADC gemtuzumab ozogamicin/Mylotarg®, as provided herein, are monitored for treatment-related adverse effects during the course of the treatment regimen, as well as during any conditioning or induction regimens that may be indicated, and are also assessed for disease status and the status of HCT graft and the hematopoietic system during treatment and/or after completion of the treatment regimen.
Example 3: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA a, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0193] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0194] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0195] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT. The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-CCCCAGGACUACUCACUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 19, targeting domain sequence in bold, chemical modifications as described in Example 1).
[0196] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0197] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0198] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33− ANC at 28 days after CD33KO eHSPC HCT.
[0199] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33− HSC engraftment and CD33− hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33− ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33− ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0200] Administration of gemtuzumab ozogamicin/Mylotarg® is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0201] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0202] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28d) treatment cycle.
[0203] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0204] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 4: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA B, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0205] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0206] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0207] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT.
[0208] The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-ACCGAGGAGUGAGUAGUCCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 20, targeting domain sequence in bold, chemical modifications as described for gRNAs in Example 1).
[0209] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0210] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0211] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33− ANC at 28 days after CD33KO eHSPC HCT.
[0212] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33-HSC engraftment and CD33-hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33-ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33-ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0213] Administration of gemtuzumab ozogamicin/Mylotarg is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0214] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0215] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28 d) treatment cycle.
[0216] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0217] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 5: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA C, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0218] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0219] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0220] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT.
[0221] The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-GGUGGGGGCAGCUGACAACCGUUUUAGAGCUAGAAAUAGCAAGUUAAAA UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 21, targeting domain sequence in bold, chemical modifications as described for gRNAs in Example 1).
[0222] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0223] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0224] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33-ANC at 28 days after CD33KO eHSPC HCT.
[0225] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33-HSC engraftment and CD33-hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33-ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33-ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0226] Administration of gemtuzumab ozogamicin/Mylotarg is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0227] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0228] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28d) treatment cycle.
[0229] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0230] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 6: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA D, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0231] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0232] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0233] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT.
[0234] The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-CGGUGCUCAUAAUCACCCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 22, targeting domain sequence in bold, chemical modifications as described for gRNAs in Example 1).
[0235] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0236] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0237] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33-ANC at 28 days after CD33KO eHSPC HCT.
[0238] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33-HSC engraftment and CD33-hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33-ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33-ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0239] Administration of gemtuzumab ozogamicin/Mylotarg® is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0240] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0241] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28d) treatment cycle.
[0242] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0243] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 7: Treatment of a Subject Having AML with CD33KO eHSPC Generated Using gRNA E, and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0244] A subject having CD33-positive AML is treated with an allogeneic HCT comprising CD33KO eHSPCs and with the ADC gemtuzumab ozogamicin/Mylotarg®.
[0245] For the HCT, a population of cells comprising CD34+ hematopoietic stem cells is obtained from a healthy donor who is HLA matched at 8/8 loci (HLA-A, —B, —C, DRB1) to the subject.
[0246] After G-CSF/plerixafor mobilization, up to two apheresis procedures are performed in order to obtain a minimum of 10×10.sup.6 viable cells/kg (where kg refers to recipient subject weight) from the donor for processing and subsequent administration to the recipient subject. From this apheresis product, at least 3.0×10.sup.6 viable cells/kg (recipient weight) undergo minimal manipulation and are cryopreserved to serve as a back-up stem cell source, e.g., for use as a rescue dose. The remainder of the apheresis product is used for processing and preparation of the CD33KO eHSPC population for HCT.
[0247] The CD33KO eHSPC population for HCT is prepared by enriching the apheresis product for CD34+ cells, followed by electroporation and editing with a CD33 gRNA/Cas9 complex, as described in Example 1, using a Cas9 sgRNA comprising the nucleotide sequence 5′-CCUCACUAGACUUGACCCACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′ (SEQ ID NO: 23, targeting domain sequence in bold, chemical modifications as provided in Example 1, see SEQ ID NO: 25).
[0248] The edited cells are subsequently placed in culture for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved. Cell viability and editing efficiency are confirmed using a representative sample as described in Example 1, and CD33KO eHSPC populations meeting the criteria set forth in Example 1 (at least 70% viability and at least 45% CD33 editing efficiency) are used for HCT. A population for administration to a subject comprises a CD33KO eHSPC population satisfying these viability and editing efficiency criteria of at least 3×10.sup.6 cells/kg body weight of the recipient subject, and preferably comprises at least 4×10.sup.6 cells/kg, 5×10.sup.6 cells/kg, 6×10.sup.6 cells/kg, or 7×10.sup.6 cells/kg of the recipient subject.
[0249] After completion of the conditioning regimen, the subject receives an HCT comprising the thawed CD33KO eHSPCs via an intravenous (IV) infusion. The day of the HCT is day 0 of the treatment regimen.
[0250] The subject is assessed for CD33KO eHSPC engraftment at day 28 by measuring the absolute peripheral neutrophil count (ANC) for CD33KO (CD33−) neutrophils in the subject. The subject is deemed to exhibit neutrophil recovery (also referred to as successful CD33KO neutrophil engraftment) if the subject exhibits an absolute peripheral CD33KO neutrophil count of ≥1000/dL CD33-ANC at 28 days after CD33KO eHSPC HCT.
[0251] If the subject exhibits neutrophil recovery at day 28, a bone marrow biopsy is obtained from the subject on day 60 in order to assess disease status and hematopoietic recovery. In addition, percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood at this time. If the subject exhibits successful CD33-HSC engraftment and CD33-hematopoiesis at day 60, the subject is subsequently administered gemtuzumab ozogamicin/Mylotarg®. The CD33-ANC is monitored in the subject prior to administration of gemtuzumab ozogamicin/Mylotarg®, and the subject should preferably have ≥1000/dL CD33-ANC prior to receiving gemtuzumab ozogamicin/Mylotarg®.
[0252] Administration of gemtuzumab ozogamicin/Mylotarg® is preferably initiated within 30 days of the bone marrow biopsy at day 60, i.e., is preferably initiated by day 90. However, initiation of gemtuzumab ozogamicin/Mylotarg® may be delayed up to day 120 if a subject's clinical status, e.g., in view of comorbidities, including, for example, HCT-related comorbidities, necessitate such a delay, or in order to allow attainment of ≥1000/dL CD33-ANC in a subject. If gemtuzumab ozogamicin/Mylotarg® is initiated more than 30 days after the Day 60 bone marrow biopsy, a repeat bone marrow biopsy is completed prior to starting gemtuzumab ozogamicin/Mylotarg®.
[0253] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject at a dose within the range of 0.1 mg/m.sup.2 to 2 mg/m.sup.2, e.g., at a dose of 0.1 mg/m.sup.2, 0.25 mg/m.sup.2, 0.5 mg/m.sup.2, 1 mg/m.sup.2, or 2 mg/m.sup.2. A dose of 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg® is preferred for most subjects. However, some subjects may be administered a lower dose, e.g., in the event of treatment-related adverse effects, e.g., dose-limited toxicities (DLT), or in view of the health status, comorbidities, or the medical history of the individual subject.
[0254] Gemtuzumab ozogamicin/Mylotarg® is administered to the subject in a regimen of 4-week (28d) treatment cycles, wherein the subject receives the entire dose of a respective treatment cycle, e.g., at 2 mg/m.sup.2 of gemtuzumab ozogamicin/Mylotarg®, on day 1 of the respective 4-week (28d) treatment cycle.
[0255] For most subjects, four consecutive treatment cycles of gemtuzumab ozogamicin/Mylotarg®, and thus four doses of gemtuzumab ozogamicin/Mylotarg®, spread 4 weeks apart from each other, are preferred. However, in some subjects, additional gemtuzumab ozogamicin/Mylotarg® treatment cycles may be indicated, e.g., up to four additional “continuation” treatment cycles, e.g., at the same dose of the initial four treatment cycles, or at a lower dose, if clinically advisable, e.g., based on the subject's clinical status.
[0256] At completion of the last gemtuzumab ozogamicin/Mylotarg® treatment cycle, the subject is monitored for disease status and hematopoietic chimerism and is monitored for these parameters every six months for five years after completion of the final treatment cycle.
Example 8: Combination Treatment
[0257] Subjects having acute myeloid leukemia (AML) are matched with a healthy stem cell donor based on 8/8 loci (HLA-A, -B, -C, DRB1). Up to two apheresis procedures are performed on the donor subject in order to obtain a minimum of 10×10.sup.6 viable cells/kg for the recipient subject.
[0258] At least about 10×10.sup.6 viable cells/kg for the recipient of CD34+ healthy donor cells are used to manufacture the CD33KO eHSPC HCT product and a minimum of 3.0×10.sup.6 viable cells/kg to produce the back-up graft (i.e., rescue dose). The CD33KO eHSPC HCT manufacturing process consists of CD34+ cell enrichment followed by electroporation and editing with a CD33 gRNA/Cas9 complex, for example using any of the CD33 gRNAs described herein, see Table 1. The edited cells are subsequently cultured for <48 hours. Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved.
[0259] The recipient subject may undergo a myeloablative conditioning regimen (preconditioning) prior to administration of the CD33 edited hematopoietic cells. After completion of the conditioning regimen, the subject is administered the CD33KO eHSPC HCT on day 0 via an intravenous (IV) infusion. The subject is monitored for neutrophil recovery, which is defined as recovery of peripheral neutrophil count at 28 days following infusion. At day 60, if the subject has successful neutrophil engraftment, the subject receives a bone marrow biopsy to assess disease status and hematopoietic recovery. The percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood. Subjects must have a neutrophil count above a threshold (e.g., ≥1000/dL CD33-ANC) prior to receiving gemtuzumab ozogamicin/Mylotarg®. The subjects then receive gemtuzumab ozogamicin/Mylotarg® at a dose between about 0.1 mg/m.sup.2 to 2.0 mg/m.sup.2.
[0260] The subjects are continued to be evaluated and may receive one or more additional doses of gemtuzumab ozogamicin/Mylotarg® at the same dosage as the previous dose or at a different (increased or decreased) dosage.
Example 9: Combination Treatment Using Multiplexed Editing
[0261] Subjects having acute myeloid leukemia (AML) are matched with a healthy stem cell donor based on 8/8 loci (HLA-A, -B, -C, DRB1). Up to two apheresis procedures are performed on the donor subject in order to obtain a minimum of 10×10.sup.6 viable cells/kg for the recipient subject.
[0262] At least about 10×10.sup.6 viable cells/kg for the recipient of CD34+ healthy donor cells are used to manufacture the double edited hematopoietic cell product and a minimum of 3.0×10.sup.6 viable cells/kg to produce the back-up graft (i.e., rescue dose). The genetic editing manufacturing process consists of CD34+ cell enrichment followed by electroporation and editing with a CD33 gRNA/Cas9 complex, for example using any of the CD33 gRNAs described herein, see Table 1, as well as a gRNA/Cas9 complex targeting a second lineage-specific cell-surface antigen, such as any of the those described herein. The double edited cells are subsequently cultured for <48 hours. Cell surface levels of CD33 and the second lineage-specific cell-surface antigen may be assessed in the double edited cells, for example by flow cytometry.
[0263] Upon harvest, after the culture duration is finished, cells are washed, resuspended in the final formulation, and cryopreserved.
[0264] The recipient subject may undergo a myeloablative conditioning regimen (preconditioning) prior to administration of the double edited hematopoietic cells. After completion of the conditioning regimen, the subject is administered the double edited hematopoietic cells on day 0 via an intravenous (IV) infusion. The subject is monitored for neutrophil recovery, which is defined as recovery of peripheral neutrophil count at 28 days following infusion. At day 60, if the subject has successful neutrophil engraftment, the subject receives a bone marrow biopsy to assess disease status and hematopoietic recovery. The percent donor chimerism and CD33-negative (CD33−) myeloid hematopoiesis are determined from the peripheral blood. Subjects must have a neutrophil count above a threshold (e.g., ≥1000/dL CD33− ANC) prior to receiving gemtuzumab ozogamicin/Mylotarg®. The subjects then receive gemtuzumab ozogamicin/Mylotarg® at a dose between about 0.1 mg/m.sup.2 to 2.0 mg/m.sup.2.
[0265] The subjects are continued to be evaluated and may receive one or more additional doses of gemtuzumab ozogamicin/Mylotarg® at the same dosage as the previous dose or at a different (increased or decreased) dosage.
Example 10: Xenotransplantation Model for Use of Human CD33KO eHSPC Generated Using gRNA E and the CD33-Targeted ADC Gemtuzumab Ozogamicin/Mylotarg®
[0266] The objective of this study was to investigate whether human hematopoietic stem and progenitor cells (HSPCs) that have been genetic engineered to have reduced or eliminated expression of CD33, or their derivative cells (descendants thereof), are protected against the cytotoxicity of gemtuzumab ozogamicin/Mylotarg® using a mouse model.
[0267] Mobilized PBMCs were obtained from two human donors (Donor 1 and Donor 2) and screened to confirm that the cells are not homozygous for a single nucleotide polymorphism (SNP) at rs12459419, which causes an alternatively spliced transcript variant lacking exon 2, resulting in decreased expression of full-length CD33 isoform, and would therefore not be recognized or targeted by gemtuzumab ozogamicin/Mylotarg®.
[0268] Briefly, as shown in FIG. 2, CD34+ HSPCs from the donor were electroporated with CD33 gRNA E Cas9 ribonucleoprotein complex, as described in Example 1. Cells from the same donor were electroporated without RNP were used as negative controls (“Mock EP”). CD33 editing efficiency is shown in Table 4. Cell number and viability were also quantified prior to and after electroporation (Table 5).
TABLE-US-00007 TABLE 4 CD33 editing efficiency of human CD34+ HSPCs Donor gRNA Editing Frequency Donor 1 CD33 gRNA-E 86% Donor 2 CD33 gRNA-E 76%
TABLE-US-00008 TABLE 5 Cell numbers and viability Pre-EP 48 Hours Post-EP Viable Mock EP CD33KO Cell # per Viable Viable Donor Viability Condition Viability Cell # Viability Cell # Donor 1 98% 7.2 × 10.sup.7 93% 9.4 × 10.sup.7 94% 9.4 × 10.sup.7 Donor 2 97% 6.0 × 10.sup.7 88% 5.5 × 10.sup.7 87% 4.8 × 10.sup.7
[0269] CD33-edited HSPCs (CD33KO) and Mock EP control CD34+ HSPCs were injected via tail vein into sub-lethally irradiated NOD/scid/IL2R7.sup.null ((NOD.Cg-Prkdc.sup.scidIl2rg.sup.tm1Wjl, NSG™) mice. At 8 weeks post-transplantation, retro-orbital blood was collected from each mouse for flow cytometry analysis to assess engraftment of CD34+ HSPCs. Retro-orbital bleeding was also performed at 12 weeks post-transplantation to collect plasma and cell pellets, which were stored for further analysis. At 15 weeks post-transplantation, after hematopoietic reconstitution by transplanted human HSPCs, the mice were dosed intravenously with either gemtuzumab ozogamicin/Mylotarg® (0.33 mg/kg) or DPBS (Dulbecco's phosphate-buffered saline) as the vehicle control (“vehicle”). Eight days post-treatment with gemtuzumab ozogamicin/Mylotarg® or vehicle (at 16 weeks after transplantation), mice were euthanized and bone marrow, blood, and spleens were harvested for flow cytometry analysis. The experimental groupings for cells obtained from Donor 1 and Donor 2 are shown in Tables 6 and 7, respectively.
TABLE-US-00009 TABLE 6 Experimental groupings for cells obtained from Donor 1 Group Number of Mice mPB CD34.sup.+ HSPCs Treatment 1 16 CD33 gRNA-Cas9 Vehicle 2 16 RNP Mylotarg (0.33 mg/kg) 3 .sup. 16.sup.# Mock EP control Vehicle 4 16 Mylotarg (0.33 mg/kg)
TABLE-US-00010 TABLE 7 Experimental groupings for cells obtained from Donor 2 Group Number of Mice mPB CD34.sup.+ HSPCs Treatment 1 16 Mock EP control Vehicle 2 16 Mylotarg (0.33 mg/kg) 3 16 CD33 gRNA-Cas9 Vehicle 4 16 RNP Mylotarg (0.33 mg/kg)
[0270] As shown in FIG. 3A, for mice engrafted with Mock EP HSPCs from Donor 1, human leukocyte reconstitution (hCD45+ cells) was reduced by gemtuzumab ozogamicin/Mylotarg® treatment, for mice engrafted with CD33-edited HSPCs from Donor 1 were not impacted by gemtuzumab ozogamicin/Mylotarg®. Additionally, CD33 gene-editing did not result in a significant change in human cell leukocyte chimerism as evidenced by human CD45 staining. For mice engrafted with HSPCs from Donor 2, no statistically significant difference was observed in human cell chimerism between groups that received gemtuzumab ozogamicin/Mylotarg® treatment versus vehicle control, or comparing mice engrafted with CD33-edited HSPCs versus Mock EP HSPCs (FIG. 5A).
[0271] The percentages of CD33+ cells among total human leukocytes (hCD45+ cells) in the bone marrow of engrafted animals were analyzed by flow cytometry. For HSPCs from each donor, mice that were engrafted with the Mock EP HSPCs followed by treatment with gemtuzumab ozogamicin/Mylotarg® had a significant reduction of CD33+ cells, as compared to treatment with vehicle alone (FIGS. 3B, 5B). Moreover, mice engrafted with CD33-edited HSPCs showed a nearly complete loss of CD33+ cells, as compared to mice engrafted with Mock EP HSPCs, regardless of treatment with gemtuzumab ozogamicin/Mylotarg® or vehicle control (FIGS. 3B, 5B). Without wishing to be bound by any particular theory, these results are thought to be due to highly efficient editing of donor human HSPCs and demonstrate robust ablation of CD33+ cells by gemtuzumab ozogamicin/Mylotarg®. This suggests there is long-term persistence of CD33-edited HSPCs cells in this xenotransplant model.
[0272] Cells expressing different human myeloid markers were also evaluated from the human CD45+ (mouse CD45−) population. The fractions of monocytes (CD14+ myeloid cells) in total human leukocytes (hCD45+) in the bone marrow of engrafted mice were analyzed. For both donors, gemtuzumab ozogamicin/Mylotarg® treatment led to a near complete elimination of CD14+ myeloid cells in the mice engrafted with Mock EP HSPCs group (FIGS. 3C, 5C). In contrast, gemtuzumab ozogamicin/Mylotarg® treatment had less of an impact on the percentage of CD14+ myeloid cells in mice that were transplanted with CD33-edited HSPCs (FIGS. 3C, 5C). These results indicate that the CD33-edited myeloid cells were protected from the cytotoxicity of gemtuzumab ozogamicin/Mylotarg® (FIG. 3E). No significant difference was observed in the percentage of CD14+ myeloid cells between mice engrafted with Mock EP HSPCs and those engrafted CD33-edited HSPCs, supporting that loss of CD33 does not compromise long-term differentiation of CD14+ myeloid cells from HSPCs.
[0273] CD11b+ myeloid cells within the hCD45+ population of cells were also analyzed. For mice engrafted with Mock EP HSPCs from either donor, gemtuzumab ozogamicin/Mylotarg® treatment eradicated the majority of CD11b+ myeloid cells (FIGS. 3D, 5D). In contrast, gemtuzumab ozogamicin/Mylotarg® treatment had less of an impact on the percentage of CD11b+ myeloid cells in mice that were transplanted with CD33-edited HSPCs (FIGS. 3D, 5D). These results support that reduction in CD33 protects the CD11b+ myeloid cells against gemtuzumab ozogamicin/Mylotarg®. No significant difference was observed in the percentage of CD11b+ myeloid cells between mice engrafted with Mock EP HSPCs and those engrafted CD33-edited HSPCs, supporting that loss of CD33 does not compromise long-term differentiation of CD11b+ myeloid cells from HSPCs.
[0274] In addition to myeloid cells, the percentages of CD3+ T cells among total human CD45+ cells in the bone marrow of engrafted mice were analyzed. No statistically significant difference was observed in the percentage of CD3+ T cells in mice that were transplanted with Mock EP HSPCs as compared to mice that were transplanted with CD33-edited HSPCs (FIGS. 4A, 6A). As expected, CD3+ T cells were not affected by gemtuzumab ozogamicin/Mylotarg® treatment.
[0275] The percentages of CD19+ B cells among total human CD45+ cells in the bone marrow of engrafted animals were analyzed. No statistically significant difference was observed in the percentage of CD19+ B cells in mice that were transplanted with Mock EP HSPCs as compared to mice that were transplanted with CD33-edited HSPCs (FIGS. 4B, 6B). As expected, CD19+ B cells were not affected by gemtuzumab ozogamicin/Mylotarg® treatment.
[0276] Comparing vehicle-treated groups, mice transplanted with CD33-edited HSPCs and Mock EP HSPCs had equivalent levels of B cells, suggesting that B cell differentiation from HSPCs is not disturbed by CD33KO. Comparing the mice that received gemtuzumab ozogamicin/Mylotarg® treatment, mice transplanted with Mock EP HSPCs had a higher fraction of CD19+ B cells among total human leukocytes than those transplanted with CD33-edited HSPCs (FIGS. 4B, 6B). This likely reflects that since myeloid and lymphoid fractions make up most of the total human leukocyte compartment in the bone marrow of this mouse model, a decrease in the myeloid proportion (due to gemtuzumab ozogamicin/Mylotarg® treatment) will result in an apparent proportional increase in the lymphoid fraction, in the mice that received Mock EP HSPCs.
[0277] In addition, the percentages of CD34+CD38− human primitive HSPCs were evaluated in the bone marrow of engrafted mice. No statistically significant difference was observed in the percentage of CD34+CD38− cells in mice that received Mock EP HSPCs versus CD33-edited HSPCs nor between mice that received gemtuzumab ozogamicin/Mylotarg® treatment versus vehicle control (FIGS. 4C, 6C). These results suggest that loss of CD33 does not impact CD34+CD38− primitive HSPCs, and that the primitive HSPCs are not targeted by gemtuzumab ozogamicin/Mylotarg® cytotoxicity.
[0278] In sum, these analyses indicate that CD33-deficient cells are protected from gemtuzumab ozogamicin/Mylotarg cytotoxicity. Upon engraftment, CD33-edited HSPCs reconstituted a multilineage hematopoietic system with equivalent levels of human leukocyte chimerism, lymphoid and myeloid lineages, and primitive HSPCs, as control HSPCs. Additionally, a significant loss of CD33+ cells was observed in mice engrafted with CD33-edited HSPCs, demonstrating highly efficient CD33 disruption after 16 weeks and long-term persistence of CD33-deficient cells. In mice engrafted with control (unedited) HSPCs, gemtuzumab ozogamicin/Mylotarg® treatment effectively eliminated CD14+ and CD11b+ myeloid cells. In contrast, a significantly higher level of myeloid cells was retained post gemtuzumab ozogamicin/Mylotarg® treatment in animals transplanted with CD33-edited HSPCs. Taken together, these findings demonstrate that depletion of CD33 confers substantial protection to myeloid cells against gemtuzumab ozogamicin/Mylotarg® cytotoxicity in vivo.
Example 11: Clinical Scale Manufacturing of Human CD33KO eHSPC
[0279] Two clinical-scale batches of allogeneic CRISPR/Cas9 genome edited hematopoietic stem/progenitor cells (HSPCs) lacking the CD33 protein were manufactured for the treatment of human leukocyte antigen (HLA)-matched patients with high-risk CD33+ acute myeloid leukemia (AML). The resulting HSPC populations are suitable for infusion into HLA-matched human patients with AML undergoing hematopoietic cell transplant, e.g., patients who are known to be at high-risk for leukemia relapse and mortality post-transplantation.
[0280] The final HSPC populations were formulated at a volume of 45 mL in cryopreservation media ready for cryopreservation, storage in the vapor phase of liquid nitrogen, subsequent thawing and administration via intravenous (IV) infusion to a recipient patient.
[0281] Each batch was manufactured from leukapheresis starting material obtained from a single donor to generate a one-donor-to-one-recipient HLA matched product, allowing for the manufacture of the product for a specifically matched patient.
[0282] For each batch, a healthy donor was subjected to a leukapheresis procedure. Leukapheresis starting material was collected and stored at 2-8° C. before initiation of cell manipulation. Cell number and viability of the leukapheresis starting material was tested by flow cytometry. Cell viability was confirmed to be ≥80%. A sample was removed for cell analysis and other assessments.
[0283] A leukapheresis rescue dose was removed from the leukapheresis material to obtain a volume comprising 3×10.sup.6 CD34+ cells/kg of patient weight. The rescue dose material was cryopreserved and stored in the vapor phase of liquid nitrogen at ≤−140° C.
[0284] After rescue dose removal, the leukapheresis starting material was processed to remove red blood cells, platelets, and plasma. The processed material was then enriched for CD34-positive cells and then transferred into 250 mL conical tubes.
[0285] A Cas9/gRNA ribonucleoprotein (RNP) complex was prepared prior to electroporation by mixing Cas9 protein and gRNA E under sterile conditions. Cells in the 250 mL conical tube were spun down at 200×g, resuspended in electroporation buffer, mixed with the prepared RNP complex, and electroporated in a single-use sterile electroporation cassette.
[0286] Post-electroporation, the cells were removed from the cassette, transferred to culture media, and incubated in suspension culture at 37° C. and 5% CO.sub.2. Cell cultures were monitored for cell count and viability. Once cells recovered from electroporation (determined by cell viability being ≥80%), the cells were washed to reduce cellular debris and other residuals, and resuspended in serum-free, animal component-free, and defined cryopreservation medium containing 10% DMSO. The cells were formulated at a volume of 45 mL and cryopreserved in a controlled rate freezer (CRF). Samples were taken to determine cell counts, viability, percentage of cells expressing particular markers (e.g., CD34, CD3, CD19, CD19, CD56), editing efficiency, and residual Cas9 as shown in Table 8 below.
TABLE-US-00011 TABLE 8 Analysis of exemplary cell preparations BATCH 1 BATCH 2 Volume 45 ml 45 ml Viable cell concentration 6.5 × 10.sup.6 cells/mL 3.6 × 10.sup.6 cells/mL Viability 78% 70% CD34.sup.+ 95% 96% CD3.sup.+ 0% 1% CD19.sup.+ 0.3% 0.9% CD14.sup.+ 0.2% 0.2% CD56.sup.+ 1.1% 1.1% CD33 edited 67% 64% Residual Cas9 BLLQ BLLQ BLLQ = below lower limit of quantification.
Regarding administering to a subject (claims 1, 2, 4, 6, 9, 17, 20), the subject encompasses healthy as well as subject having hematopoietic malignancy or hematopoietic pre-malignant disease. The specification discloses treating a subject having acute myeloid leukemia (AML) or pre-malignant form thereof having myelodysplastic syndrome, see para. [0184].
However, neither the specification nor the art teaches administering a healthy subject a population of genetically knockout CD33 expression of hematopoietic cells and cytotoxic agent comprising any anti-CD33 antigen-binding domain. There are no in vivo working examples.
Regarding any genetically engineered hematopoietic cells, or descendants thereof, the specification discloses allogeneic or autologous hematopoietic stem cells that are genetically engineered to have reduced or eliminated expression of CD33 (“CD33KO eHSCs” or “CD33KO eHSPCs”) using sgRNAs comprising the nucleotide sequences of SEQ ID NO: 24, 25.
Regarding any cytotoxic agent comprising any anti-CD33 antigen-binding domain, the specification discloses just one Gemtuzumab ozogamicin, which is a CD33-directed antibody drug conjugate (ADC) approved by the U.S. Food and Drug Administration (FDA) to treat both newly diagnosed CD33-positive (CD33+) adult subjects with AML, as well as subjects with relapsed or refractory AML (R/R AML) who are 1 month of age and older.
However, the specification does not teach i. Complete structure, e.g., heavy and light chains variable domains, ii. Partial structure, e.g., six CDRs and functional features share by members of the genus of anti-CD33 antibodies linked to or conjugated to any and all possible cytotoxic agent for administering to a subject and engineered hematopoietic cells or descendants thereof.
It is known in the art that antibodies have a large repertoire of distinct structures and that a huge variety of antibodies can be made to bind to a single epitope.
For example, Lloyd et al. taught that hundreds of functional antibody fragments can be isolated from an antibody library that bind to the same antigen wherein these antibodies have distinct heavy and light chain sequences (Lloyd et al. Protein Engineering, Design & Selection 22:159-168, 2009; see, e.g., Discussion).
Similarly, Edwards et al., (J Mol Biol. 334(1): 103-118, 2003; PTO 892), found that over 1000 antibodies, all different in amino acid sequence, were generated to a single protein; 568 different amino acid sequences identified for the V(H) CDR3 domains of these antibodies (Abstract). Given that hundreds of unique antibody structures may bind a single antigen, the structure of an antibody cannot be predicted from the structure of the antigen, and a single species, or small group of species, cannot define a structure-function relationship so as to be representative of all the antibodies that bind to that antigen.
Regarding antibody drug conjugate, the state of the prior art is such that the location or site of conjugation on the drug and the antibody affect conjugate stability, and pharmacokinetics of antibody drug conjugates.
For example, Strop et al (Chemistry and Biology 20: 161-167, 2013; PTO 892) teach drug position can have a significant effect on linker stability and antibody pharmacokinetics. The site of conjugation on the drug and antibody can influence ADC properties differently in mice and rats, highlighting potential pitfalls of examining efficacy in mouse xenograft models and toxicity in rats or nonhuman primates, see abstract, p 166, p. 168 right col, in particular.
Nejadmoghaddam (Avicenna Journal of Medical Biotechnology 2(1): 3-23, 2019; PTO 892) discusses major obstacles of antibody-drug conjugates include off-target toxicity, tumor marker selection, antibody specificity, adequately affinity and receptor-mediated internalization are major aspects of choice, cytotoxic payload (e.g., up to 7 drugs per antibody), cytotoxic payload linkage strategy, aqueous solubility, non-immunogenic and stability in storage and bloodstream, see entire document, abstract, p. 15, in particular.
There are insufficient in vivo working examples. It is unpredictable which anti-CD33 conjugate in combination with genetically engineered hematopoietic cells or descendants thereof having recued or eliminated CD33 expression is effective to treat any subject having acute myeloid leukemia (AML) or pre-malignant form thereof having myelodysplastic syndrome.
As such, it would require undue experimentation of one skilled in the art to practice the claimed invention. See page 1338, footnote 7 of Ex parte Aggarwal, 23 USPQ2d 1334 (PTO Bd. Pat App. & Inter. 1992).
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-2, 30, 47 and 59 are rejected under 35 U.S.C. 102 (a)(1) as being anticipated by Mukherjee (US20170326179 A1, published November 16, 2017; PTO 892).
Claim 1 recites a method, comprising administering to a subject: an effective amount of a population of genetically engineered hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 antigen; and an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain.
Claim 2 encompasses the method of claim 1, wherein the cytotoxic agent is an antibody-drug conjugate (ADC), optionally wherein the ADC is gemtuzumab ozogamicin.
Claim 30 encompasses the method of claim 1, wherein the subject has, or has been diagnosed with, a hematopoietic malignancy.
Claim 47 encompasses the method of claim 1, wherein the genetically engineered hematopoietic cells are:
(a) hematopoietic stem cells, optionally wherein the hematopoietic stem cells are from bone marrow cells, cord blood cells, or peripheral blood mononuclear cells (PBMCs) and/or CD34+/CD33-.
Claim 59 encompasses a method, comprising administering to a subject:
(i) an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain, wherein the subject is receiving or has received an effective amount of a population of genetically engineered modified hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 agent; or
(ii) an effective amount of a population of genetically engineered hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 antigen, wherein the subject is receiving or has received an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain.
Regarding claims 1, 2 and 59 (ii), Mukherjee teaches methods for treating a hematopoietic malignancy, the method comprising administering to a subject in need thereof (i) an effective amount of an agent targeting a lineage-specific cell-surface antigen, wherein the agent comprises an antigen-binding fragment that binds the lineage-specific cell-specific cell-surface antigen. In some embodiments, the agent can be an immune cell (e.g., a T cell) expressing a chimeric receptor that comprises the antigen-binding fragment that binds the lineage-specific cell-surface antigen. In some embodiments, the immune cells, the hematopoietic cells, or both, are allogeneic or autologous. The hematopoietic cells are hematopoietic stem cells (e.g., CD34.sup.+/CD33.sup.− HSCs). In some embodiments, the hematopoietic stem cells can be obtained from bone marrow cells or peripheral blood mononuclear cells (PBMCs), see para. [0008]. The genetically engineered hematopoietic cells (e.g., HSCs) are deficient in a lineage-specific cell-surface antigen, e.g., CD33, which presents on the hematopoietic cell before genetic engineering. In some embodiments, the whole or a portion of an endogenous gene encoding the lineage-specific cell-surface antigen is deleted, for example by genome editing (e.g., involving a zinc finger nuclease (ZFN), a transcription activator-like effector-based nuclease (TALEN), or a CRISPR-Cas system), See para. [0017]. In some embodiments, the cell is a hematopoietic cell, such as a hematopoietic stem cell (e.g., CD34.sup.+), see para. [0020]. A typical amount of cells, i.e., immune cells or hematopoietic cells, administered to a mammal (e.g., a human) can be, for example, in the range of one million (1 x 106) to 100 billion cells; however, amounts below or above this exemplary range are also within the scope of the present disclosure, see para. [0181].
The HSCT described in this Example can be either autologous or allogeneic, and both approaches are suitable and can be incorporated in the methods described in the present disclosure, see para. [0250]. Treatment of a Patient with a CD33 Antibody Attached to a Toxin, see para. [0251].
Regarding claim 2, Mukherjee teaches that the Patients are also treated with CD33 Immunotoxin Gemtuzumab Ozogamicin (GO), which is a cytotoxic agent comprising an anti-CD33 antigen-binding domain as per claim 1, see para. [0252]. Patients will be treated with 9 mg/m.sup.2 of anti-CD33 antibody gemtuzumab ozogamicin (GO) as a 2-hour intravenous infusion in 2 doses separated by 2 weeks, see para. [0253].
Regarding claim 30, Mukherjee teaches that the subject is a human subject having a hematopoietic malignancy. As used herein a hematopoietic malignancy refers to a malignant abnormality involving hematopoietic cells (e.g., blood cells, including progenitor and stem cells). Examples of hematopoietic malignancies include, without limitation, Hodgkin's lymphoma, non-Hodgkin's lymphoma, leukemia, or multiple myeloma. Leukemias include acute myeloid leukemia or chronic lymphoblastic leukemia, and chronic lymphoid leukemia, see para. [0191]. In some embodiments, the leukemia is acute myeloid leukaemias (AML). AML is characterized as a heterogeneous, clonal. neoplastic disease that originates from transformed cells that have progressively acquired critical genetic changes that disrupt key differentiation and growth-regulatory pathways, see para. [0192], in particular. The term “or” does not require hematopoietic pre-malignant disease or part (b).
Regarding claim 47(a), Mukherjee teaches the genetically engineered hematopoietic cells are hematopoietic stem cells, e.g., CD34+/CD33- HSCs, see para. [0008], reference claim 16. The hematopoietic stem cells are from bone marrow cells or peripheral blood mononuclear cells (PBMCs), see reference claim 17, in particular.
Thus, the reference teachings anticipate the claimed invention.
Claims 1-2, 30, 47 and 59 are rejected under 35 U.S.C. 102 (a)(1) as being anticipated by Mukherjee et al. (WO2019046285, published on March 7, 2019, IDS).
Claim 1 recites a method, comprising administering to a subject: an effective amount of a population of genetically engineered hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 antigen; and an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain.
Claim 2 encompasses the method of claim 1, wherein the cytotoxic agent is an antibody-drug conjugate (ADC), optionally wherein the ADC is gemtuzumab ozogamicin.
Claim 59 encompasses a method, comprising administering to a subject:
(i) an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain, wherein the subject is receiving or has received an effective amount of a population of genetically engineered modified hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 agent; or
(ii) an effective amount of a population of genetically engineered hematopoietic cells, or descendants thereof, comprising a modified gene encoding CD33 that is engineered to have reduced or eliminated expression of a CD33 antigen, wherein the subject is receiving or has received an effective amount of a cytotoxic agent comprising an anti-CD33 antigen-binding domain.
Regarding claims 1, 2 and 59 (ii), Mukherjee et al. discloses a method of treating a hematopoietic malignancy comprising infusing patients in need thereof with CD33 depleted hematopoietic stem cells (HSCT, see p. 45, line 55, line 15-20) wherein the cells comprising engineered hematopoietic cell having substantially reduced expression of the antigen, e.g., CD33 via CRISPR-Cas9 system, see p. 49-53, p. 56. The HSCT described in this Example can be either autologous or allogeneic. The patients are also treated with anti-CD33 antibody conjugated to cytotoxic agent, e.g., diphtheria toxin (see p. 82, line 3-6) or Immunotoxin Gemtuzumab Ozogamicin, see p. 4, lines 24-26, p. 15, line 15, p. 53-54, p. 80, line 27 to page 81, line 34-35, Example 3, p. 84, claims 1-10, 17-28, in particular.
The hematopoietic cells (HSCT) can be autologous hematopoietic stem cell (see p. 79) or allogeneic, and they are CD34+/CD33-, see p. 9, line 4-5, p. 6, lines 23-24. The hematopoietic cells (e.g., hematopoietic stem cells) may be homozygous for rsl2459419-T allele, or may be heterozygous for rsl2459419-T allele (e.g., rs12459419-CT). The hematopoietic cells (e.g., hematopoietic stem cells) may carry at least one allele which results in deletion of exon 2 or a mutated exon 2 in CD33 mature transcript. In some embodiments, the whole or a portion of exon 2 of CD33 is deleted or mutated in CD33 mature transcript. Genome editing or genetic engineering, e.g., involving a zinc finger nuclease (ZFN), a transcription activator-like effector-based nuclease (TALEN), or a CRISPR-Cas system, may be used to engineer hematopoietic cells (e.g., HSCs) that comprise mature transcript of CD33 with mutated or deficient exon 2.
Regarding claim 30, Mukherjee teaches that the human subject has a hematopoietic malignancy, see p. 66, line 25-26. Examples of hematopoietic malignancies include acute myeloid leukemia (AML), see p. 66, line 30 to 32, in particular. The term “or” does not require hematopoietic pre-malignant disease or part (b).
Regarding claim 47, Mukherjee teaches the genetically engineered hematopoietic cells are hematopoietic stem cells, e.g., CD34+, see p. 79.
Thus, the reference teachings anticipate the claimed invention.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102 of this title, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a).
Claims 1, and 6 are rejected under 35 U.S.C. 103 as being unpatentable over Mukherjee (US 20170326179 A1, published November 16, 2017; PTO 892) in view of MYLOTARG™ (gemtuzumab ozogamicin) FDA approved 2000; PTO 892.
The teachings of Mukherjee have been discussed supra.
Mukherjee does not teach the method wherein the wherein the effective amount of the cytotoxic agent is about 0.1 mg/m2 body surface area of the subject to about 2.0 mg/m2 body surface area of the subject as per claim 6.
However, FDA recommended dose of MYLOTARG (gemtuzumab ozogamicin) for injection is 2 mg/m2 as a single agent on Day 1 every 4 weeks for treating newly-diagnosed CD33-positive AML depend on patient’s hematologic and nonhematologic toxicities, see p. 3, in particular.
In view of the combine teachings of the references, it is within the purview of one of ordinary skilled in the pharmaceutical art before the effective filling date of the claimed invention to adjust the dosage such as about 0.1 to about 2.0 mg/m2 based on patient’s body surface area, age, condition and combination therapy.
One of ordinary skill in the art would have been motivated, with a reasonable expectation of success, to do so in order to minimize cytotoxicity.
Claims 1, 2, 9, 17, 20, 24, 34, 45 and 47 are rejected under 35 U.S.C. 103 as being unpatentable over Mukherjee (US 20170326179 A1, published November 16, 2017; PTO 892) in view of WO2018142364 publication (published August 9, 2018; PTO 892), Gill (US20180250339 (issued September 6, 2018; PTO 892) and Bolen (US20200093865, published March 26, 2020; PTO 892).
The teachings of Mukherjee have been discussed supra.
Mukherjee does not teach the method wherein the effective amount of the population of genetically engineered hematopoietic cells is about 106 cells/kg body weight of the subject to about 107 cells/kg body weight as per claim 4, wherein the population of genetically engineered hematopoietic cells and the cytotoxic agent are administered simultaneously as per claim 9 (b), or concurrently as per claim 9 (c) or sequentially as per claim 9(d) or wherein the population of genetically engineered hematopoietic cells are administered intravenously as per claim 17(c) or wherein the method further comprises preconditioning the subject prior to administering the cytotoxic agent and/or the hematopoietic cells as per claim 24, wherein the subject has, or has been diagnosed with, a hematopoietic malignancy as per claim 34 or wherein the method further comprising: obtaining autologous hematopoietic stem cells from the subject or a donor having an HLA haplotype that matches with the HLA haplotype of the subject as per claim 45 or wherein the genetically engineered hematopoietic cells are: (a) hematopoietic stem cells, optionally wherein the hematopoietic stem cells are from bone marrow cells, cord blood cells, or peripheral blood mononuclear cells (PBMCs) and/or CD34+/CD33-; and/or (b) autologous or allogenic, optionally wherein the genetically engineered hematopoietic cells are allogeneic hematopoietic stem cells obtained from a donor having an HLA haplotype that matches with the HLA haplotype of the subject as per claim 47.
However, the WO2018142364 publication teaches the population of cells comprising human hematopoietic stem cells (HSPCs), e.g., CD34+ modified with the gRNA molecule (see p. 79, lines 10-11, p. 179, lines 10-15, p. 190, line 18-22) or modified with a CRISPR system (see p. 180) and the population comprises at least about 1 millions, e.g., at least about 1 million CD34+ cells per kg to at least 4 million cells per kg body weight of subject, see p. 170 to 171, line 10. The cells are autologous or allogenic, see p. 190, line 21-22, p. 196, in particular.
Regarding claims 9(b), (c), (d) and 17(a), Gill teaches and claims a method of treating a cancer in a subject in need thereof, the method comprises: administering to the subject a population of modified hematopoietic stem and progenitor cells (HSPCs) that are resistant to the CD33-targeted therapy (Example 2), wherein the HSPCs comprise an insertion and/or deletion in an endogenous gene locus encoding for CD33 that is introduced by a CRISPR system comprising a guide nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 3, and wherein the insertion and/or deletion is capable of downregulating gene expression of CD33, thereby treating cancer in the subject. The cells compositions of the present invention are administered to a patient in conjunction with (e.g., before, simultaneously or following, aka sequentially) bone marrow transplantation, T cell ablative therapy using either chemotherapy agents such as, fludarabine, external-beam radiation therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH, see para. [0189].
Regarding claim 9, Gill teaches that the modified cells are administered to a patient in conjunction with (e.g., before, simultaneously or following) any number of relevant treatment modalities, including but not limited to treatment with agents such as Cytarabine (also known as ARA-C, aka cytotoxic agent), chemotherapy, radiation, immunosuppressive agents, such as cyclosporin, azathioprine, methotrexate, mycophenolate, and FK506, antibodies, or other immunoablative agents such as CAM PATH, anti-CD3 antibodies or other antibody therapies, cytotoxin, fludarabine, cyclosporin, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines, and irradiation, see para. [0189].
Regarding claim 17(C), Gill teaches that the administration of the cells of the invention may be carried out in any convenient manner known to those of skill in the art. The cells of the present invention may be administered to a subject by injection or intravenous (i.v.) injection, or intraperitoneally, see para. [0184].
Regarding claim 47(a), Gill teaches that the HSPCs are autologous cell obtained from a source selected from the group consisting of peripheral blood mononuclear cells, cord blood cells, bone marrow, lymph nodes, and a spleen. In another embodiment, the cell is CD34+., see para. [0161], reference claims 49, 53, and 65, CD33 KO HSPCs are Resistant to CD33-Targeted Therapy, Example 2, in particular. The advantage is that the CD33 modified hematopoietic stem and progenitor cells (HSPCs) escape targeting by a cytotoxic targeted therapy (Example 2).
Likewise, Bolen teaches genetically engineered hematopoietic stem cells (HSCs) having genetically modified or edited genes of one or more lineage-specific cell-surface antigen, e.g., CD33 wherein the HSCs escapes targeting by a cytotoxic agent that targets the corresponding wild-type CD33 antigen and retains its biological activity, see para. [0016].
Regarding claim 2, Bolen teaches that the methods involve administering to the subject a population of genetically engineered cells lacking an epitope in exon 2 or exon 3 of CD33 and one or more antibodies antibody-drug conjugates (ADC) that target cells expressing CD33, see para. [0546], [0539], [540]. The lineage-specific cell-surface antigens in the HSCs or descendant cells can escape targeting by cytotoxic agents that are specific to the corresponding wild-type lineage-specific cell-surface antigen(s), see para. [0005] to [0008], [0047].
Regarding claim 20(a), Bolen teaches that the cytotoxic agent is administered one or more doses per week, e.g., 2, 3, 4 or more administration, or every four weeks, see para. [0565]. It is within the purview of one of ordinary skill in the pharmaceutical art to administer cytotoxic agent every four weeks based on patient compliance or convenience. It has long been settled to be no more than routine experimentation for one of ordinary skill in the art to discover an optimum value of a result effective variable. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum of workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233,235-236 (C.C.P.A. 1955). "No invention is involved in discovering optimum ranges of a process by routine experimentation." Id. at 458, 105 USPQ at 236-237. The "discovery of an optimum value of a result effective variable in a known process is ordinarily within the skill of the art." Application of Boesch, 617 F.2d 272, 276, 205 USPQ 215,218-219 (C.C.P.A. 1980).
Regarding claim 24(a), Bolen teaches that the subject is preconditioned prior to administration of the cytotoxic agent and/or hematopoietic cells, see para. [0562]. In general, preconditioning a subject involves subjecting the patient to one or more therapy, such as a chemotherapy or other type of therapy, such as irradiation. In some embodiments, the preconditioning may induce or enhance the patient's tolerance of one or more subsequent therapy (e.g., a targeted therapy), as described herein. In some embodiments, the pre-conditioning involves administering one or more chemotherapeutic agents to the subject. Non-limiting examples of chemotherapeutic agents include fludarabine, fluorouracil, gemcitabine, hydroxyurea, idarubicin, imatinib, irinotecan, mechlorethamine, mercaptopurine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, teniposide, tioguanine, topotecan, valrubicin, vinblastine, vincristine, vindesine, and vinorelbine, see para. [0562].
Regarding claim 34(a), Bolen teaches that the subject has relapsed cancer, e.g., relapsed AML or cancer that is resistant to the first immunotherapeutic agent (aka previously received treatment), see para. [0198] to [0199], [0205]. The first immunotherapeutic agent is a cytotoxic agent that targets cells expressing either the first lineage-specific cell-surface antigen or the second lineage-specific cell-surface antigen, see para. [0042]. In some examples, the first immunotherapeutic agent is a cytotoxic agent that targets cells expressing the first lineage-specific cell-surface antigen, and the method further comprises administering to the subject a second immunotherapeutic agent when the hematopoietic malignancy relapses in the subject, see para. [0043].
Regarding claims 45(b, c), 47(b), Bolen teaches that the HSCs are obtained from a donor having a HLA haplotype that is matched with the HLA haplotype of the subject, see para. [0321]. The HSCs are obtained from a sample from a subject (or donor), such as bone marrow sample or from a blood sample. Alternatively or in addition, HSCs may be obtained from an umbilical cord. In some embodiments, the HSCs are from bone marrow, cord blood cells, or peripheral blood mononuclear cells (PBMCs), see para. [0324] and genetically engineering such HSCs by modifying an endogenous gene of the HSCs encoding the CD33 antigen, see para. [0330] to [0347].
Bolen teaches the method further comprises administering to the subject an effective amount of a first immunotherapeutic agent, e.g., cytotoxic agent, see para. [0222] to [0223]. The engineered hematopoietic cells comprising one or more genetically engineered gene(s) encoding lineage-specific cell-surface protein(s) (e.g., CD33 lineage-specific cell-surface protein described herein) and the immune cells engineered to target an epitope of the lineage-specific cell-surface protein(s) are both allogeneic to the subject, see para. [0555].
In view of the combine teachings of the references, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filling date of the claimed invention to treat a hematopoietic malignancy as taught by Mukherjee, Gill or Bolen by administering at least about 1 million CD34+ cells per kg to at least 4 million genetically engineered hematopoietic stem cells or descendants thereof lacking CD33 expression per kg body weight of subject as taught by WO2018142364 publication and an effective amount of a cytotoxic agent comprising anti-CD33 antigen-binding domain conjugated to a toxin such as gemtuzumab ozogamicin wherein the hematopoietic stem cells isolated from a source selected from the group consisting of peripheral blood mononuclear cells, cord blood cells, bone marrow as taught by Gill or the hematopoietic stem cells (HSCs) are obtained from a donor having a HLA haplotype that is matched with the HLA haplotype of the subject and the subject is preconditioned prior to administration of the cytotoxic agent and/or hematopoietic cells as taught by Bolen to arrive at the claimed invention with a reasonable expectation of success, e.g., genetically engineered hematopoietic stem cells of descendants thereof lacking CD33 expression and are resistant to anti-CD33 target therapy.
One of ordinary skill in the art would have been motivated to do so because Gill teaches that genetically hematopoietic cells lacking CD33 expression escape targeting by anti-CD33 cytotoxic targeted therapy (Example 2) and Mukherjee teaches that cytotoxic agent can be anti-CD33 antibody conjugated to drug such as gemtuzumab ozogamicin.
One of ordinary skill in the art would have been motivated to do so because Bolen teaches that genetically hematopoietic cells lacking CD33 expression escapes targeting by a cytotoxic agent that targets the corresponding wild-type CD33 antigen and retains its biological activity (see para. [0016]) and Mukherjee teaches that cytotoxic agent can be anti-CD33 antibody conjugated to drug such as gemtuzumab ozogamicin. Further, [T]he idea of combining them flows logically from their having been individually taught in the prior art." In re Kerkhoven, 626 F.2d 846, 850, 205USPQ 1069, 1072 (CCPA 1980) (see MPEP 2144.06).
“The combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” KSR Int’l Co. v. Teleflex Inc., 550 U.S. 398, 416 (2007).
“The test of obviousness is not express suggestion of the cl aimed invention in any or all of the references but rather what the references taken collectively would suggest to those of ordinary skill in the art presumed to be familiar with them.” See In re Rosselet 146 USPQ 183, 186 (CCPA 1965).
“There is no requirement (under 35 USC 103(a)) that the prior art contain an express suggestion to combine known elements to achieve the claimed invention. Rather, the suggestion to combine may come from the prior art, as filtered through the knowledge of one skilled in the art.,” Motorola, Inc, v. Interdigital Tech. Corn., 43 USPQ2d 1481, 1489 (Fed. Cir. 1997).
Accordingly, the claimed invention as a whole was prima facie obvious to one of ordinary skill in the art before the effective filling date of the claimed invention especially in the absence of evidence to the contrary.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to PHUONG HUYNH whose telephone number is (571)272-0846. The examiner can normally be reached on 9:00 a.m. to 6:30 p.m. The examiner can also be reached on alternate alternative Friday from 9:00 a.m. to 5:30 p.m.
If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Misook Yu, can be reached at 571-270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-272-0839.
Information regarding the status of an application may be obtained from Patent Center. Status information for published applications may be obtained from Patent Center. Status information for unpublished applications is available through Patent Center for authorized users only. Should you have questions about access to Patent Center, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) Form at https://www.uspto.gov/patents/uspto-automated- interview-request-air-form.
/PHUONG HUYNH/ Primary Examiner, Art Unit 1641
Prosecution Insights