Prosecution Insights
Last updated: July 17, 2026
Application No. 18/034,933

SPECIFIC REACTION MIXTURE FOR USE IN THE DIAGNOSIS OF COVID-19 WITH ISOTHERMAL AMPLIFICATION METHOD

Final Rejection §103§112
Filed
May 02, 2023
Priority
Nov 03, 2020 — TÜ 2020/17556 +1 more
Examiner
JADHAO, SAMADHAN JAISING
Art Unit
1672
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Istanbul Medipol Universitesi
OA Round
2 (Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
3m
Est. Remaining
98%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
26 granted / 50 resolved
-8.0% vs TC avg
Strong +46% interview lift
Without
With
+45.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
35 currently pending
Career history
104
Total Applications
across all art units

Statute-Specific Performance

§101
1.4%
-38.6% vs TC avg
§103
61.5%
+21.5% vs TC avg
§102
5.6%
-34.4% vs TC avg
§112
12.2%
-27.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 50 resolved cases

Office Action

§103 §112
DETAILED ACTION Final Rejection Notice of Pre-AIA or AIA Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of Claims 2. Claims 2-7 as amended on 03/30/2026 are pending. Priority 3. Acknowledgment is made of applicant’s claim for foreign priority under 35 U.S.C. 119 (a)-(d). The certified copy has been filed in parent Application No. TR2020/17556, filed on 11/03/2020. This application 18/034,933 filed on 11/02/2021 is 371 of PCT/TR2021/051120. Information Disclosure Statement 4. The information disclosure statement (IDS) submitted on 05/02/2023 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Withdrawn Objection to Claim 5. Withdrawn objection to the claim 5 in view of amendment of the claim filed on 03/30/2026. Withdrawn Objection to Specification 6. Withdrawn objection to the specification in view of amendment filed on 03/30/2026. Withdrawn Claim Rejections - 35 USC § 112 7. Withdrawn rejection of claims 2-7 under 35 U.S.C. 112(b) in view of the amendment of the specification filed on 03/30/2026. Claim Rejections - 35 USC § 103 (Modified) 8. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 9. Claims 2-3 and 6-7 are rejected under 35 U.S.C. 103 as being unpatentable over De Leao E Flores et al 2020 (WO2021220192A2 published 11/04/2021, with an earlier priority to 116317 filed on 04/30/2020), and further in view of Jensen et al 2010 (PLoS ONE 5(6): e11024), Moore et al 2017 (Scientific Reports, 7:40244), Wang et al 2015 (Molecules. 2015, 7;20(4):6048-59), Manomat et al 2019 (Tropical Biomedicine 36(2): 495–504, 2019), Carter et al 2017 (J Virol Methods, 2017; 244: 32–38) and Thermo Fisher Scientific Inc 2016 (published 2016). Claims 2-3, and 6-7: De Leao E Flores et al 2020 is directed to method and portable device for detection and identification of SARS-CoV-2 virus specific sequences of nucleic acids in different samples by utilization of isothermal amplification method (LAMP assay method). De Leao E Flores et al 2020 teaches the claimed six primer sequences that hybridize to nucleic acid sequence of SARS CoV-2 (See, WO2021220192A2, p. 30-31, Table 2, and as recited below), and 0.1% Tween-20 in the assay reaction composition (See, WO2021220192A2, p. 31, Lamp reaction, line 13), SYBR green (cyanine-based nucleic acid fluorescence dyes) (WO2021220192A2, claim 3 limitation) (See, WO2021220192A2, claim 27, p. 3 lines 24-34, p. 28 lines 1-8). Leao E Flores et al 2020 teaches the instant primer sequences identified by SEQ ID NO: 1-6 as recited below (See, Table 2, WO2021220192A2): Instant claim 2 SEQ ID NO: 1 has 100% identity with prior art WO2021220192A2 SEQ ID NO: 18 as recited in claim 4. Qy 1 TGCCTCAACTTGAACAGC 18 |||||||||||||||||| Db 1 TGCCTCAACTTGAACAGC 18 Instant claim 2 SEQ ID NO: 2 has 100% identity with prior art WO2021220192A2 SEQ ID NO: 19 as recited in claim 4. Qy 1 TTCATAAGGATCAGTGCCAAG 21 ||||||||||||||||||||| Db 1 TTCATAAGGATCAGTGCCAAG 21 Instant claim 2 SEQ ID NO: 3 has 100% identity with prior art WO2021220192A2 SEQ ID NO: 20 as recited in claim 4. Qy 1 CACCAAGTGTCTCACCACTACGGCACCTCATGGTCATGTTAT 42 |||||||||||||||||||||||||||||||||||||||||| Db 1 CACCAAGTGTCTCACCACTACGGCACCTCATGGTCATGTTAT 42 Instant claim 2 SEQ ID NO: 4 has 100% identity with prior art WO2021220192A2 SEQ ID NO: 21 as recited in claim 4. Qy 1 CTCATGTGGGCGAAATACCAGTCCACCAGCTCCTTTATTACC 42 |||||||||||||||||||||||||||||||||||||||||| Db 1 CTCATGTGGGCGAAATACCAGTCCACCAGCTCCTTTATTACC 42 (v) Instant claim 2 SEQ ID NO: 5 has 100% identity with prior art WO2021220192A2 SEQ ID NO: 22 as recited in claim 4. Qy 1 ACCGTACTGAATGCCTTCG 19 ||||||||||||||||||| Db 1 ACCGTACTGAATGCCTTCG 19 (vi) Instant claim 2 SEQ ID NO: 6 has 100% identity with prior art WO2021220192A2 SEQ ID NO: 23 as recited in claim 4. Qy 1 GGCTTACCGCAAGGTTCT 18 |||||||||||||||||| Db 1 GGCTTACCGCAAGGTTCT 18 De Leao E Flores et al 2020 does not teach comprising DMSO (polyoxyethylene sorbitan monolaurate) in the primer mixture of the SARS CoV-2 nucleic acid isothermal amplification method. Jensen et al 2010 is in the nucleic acid amplification art and teaches 1-10% DMSO or 0.5-2.5 M Betaine greatly improve amplification of GC-rich constructs in de novo synthesis (See, abstract, p.2 col 2 para 3 Additives, entire article). Moore et al 2017 discloses recombinase polymerase amplification (RPA) as a novel isothermal method which rapidly amplifies and detects norovirus nucleic acids and teaches 0.2% DMSO improves detection of norovirus RNA in a sample (See, Abstract, Figure S3 (b)). Wang et al 2015 is in the loop-mediated isothermal amplification art and teaches DMSO addition in the reaction mixture for increased specificity and sensitivity in loop-mediated isothermal amplification method to detect nucleic acid sequence specific to Listeria monocytogenes to increase the sensitivity and specificity of the LAMP reactions (See, abstract, entire article). Manomat et al 2019 is in the art and teaches reliable interpretation and long-term stability using SYBRTM safe fluorescent assay for loop-mediated isothermal amplification (LAMP) detection of Leishmania species (See, abstract and entire article). Carter et al 2017 is in the isothermal amplification art and teaches addition of SYBR Safe dye to the reaction mixture. Interestingly, we found that the cyanine dye SYBR Safe did not inhibit the reaction, and when added during reaction setup produced a high signal-to-noise ratio. Visualization of SYBR Safe-containing reactions using a handheld UV lamp allowed for easy, unambiguous determination of positive reactions, with equivalent sensitivity as gel electrophoresis (See, abstract, p. 4 Section on Visual detection of ZEBOV RNA using RT-LAMP). Thermo Fisher Scientific Inc 2016 teaches SYBR Safe DNA Gel Stain is offered as either a concentrate or a ready-to-use solution. Determining or adjusting concentration of Tween 20, DMSO or SYBR Safe fluorescent dye in the isothermal amplification reaction depend on the GC% content of the SARS CoV-2 target nucleic acid sequence and the target amplification for optimal performance of the SARS CoV-2 isothermal LAMP assay and is a routine laboratory approach (See as recited supra, De Leao E Flores et al 2020, Jensen et al 2010, Moore et al 2017, Wang et al 2015, Manomat et al 2019, Carter et al 2017 and Thermo Fisher Scientific Inc 2016). See In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955) and In re Geisler, 116 F.3d 1465, 43 USPQ2d 1362 (Fed. Cir. 1997); In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955); Peterson, 315 F.3d at 1330, 65 USPQ2d at 1382. Furthermore, according to section 2144.05 of the MPEP, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. “[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation.” In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). See also Peterson, 315 F.3d at 1330, 65 USPQ2d at 1382 (“The normal desire of scientists or artisans to improve upon what is already generally known provides the motivation to determine where in a disclosed set of percentage ranges is the optimum combination of percentages”). It would have been obvious to one of the ordinary skills in the art before the effective filing date of the claimed invention to modify the prior art teachings of De Leao E Flores et al 2020 with additional teachings of Jensen et al 2010, Moore et al 2017 and Wang et al 2015 on DMSO and teachings of Manomat et al 2019, Carter et al 2017 and Thermo Fisher Scientific Inc 2016 on SYBR Safe addition in the nucleic acid amplification/isothermal nucleic acid amplification method to arrive at the inventions of claims 2-3 and 6-7. One of the ordinary skills in the art would have been motivated to increase the sensitivity and specificity of the SARS CoV-2 isothermal amplification assay to detect SARS CoV-2 infection (COVID-19) and for commercial success of the primers and the claimed assay. There would be a reasonable expectation of success given the applied prior art teachings in the art as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claims 2-3 and 6-7. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A, C-G). 10. Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of De Leao E Flores et al 2020 (WO2021220192A2 published 11/04/2021, with an earlier priority to 116317 filed on 04/30/2020), Jensen et al 2010 (PLoS ONE 5(6): e11024), Moore et al 2017 (Scientific Reports, 7:40244), Wang et al 2015 (Molecules. 2015, 7;20(4):6048-59), Manomat et al 2019 (Tropical Biomedicine 36(2): 495–504, 2019), Carter et al 2017 (J Virol Methods, 2017; 244: 32–38) and Thermo Fisher Scientific Inc 2016 (published 2016) as applied to claims 2-3 and 6-7 above and further in view of Chen et al 2020 (CN111560478A published 08/21/2020), Liotti et al 2020 (Eur J Clin Microbiol Infect Dis., 2020 Sep 4;40(2):269–277), Zheng et al 2020 (CN111850172A, published 10/30/2020) and as evidenced by ATCC 2024 (See PDF printout of webpage ATCC 2024 related to prior commercial availability of synthetic N gene RNA of SARS CoV-2). Claim 4: The combined teachings of De Leao E Flores et al 2020, Jensen et al 2010, Moore et al 2017, Wang et al 2015, Manomat et al 2019, Carter et al 2017 and Thermo Fisher Scientific Inc 2016 teaches and renders obvious the limitation of claim 4 except a kit and SARS-CoV-2 synthetic nucleocapsid RNA recited in SEQ ID No: 7. Zheng et al 2020 (CN111850172A) teaches a kit LAMP primer set and kit for detection of SARS-CoV-2 based on the N gene of SARS-CoV-2. Zheng et al 2020 teaches kit comprises DNA polymerase, MgSO4, buffer, dNTPs (See, abstract, claims 1-13, entire prior art). Chen et al 2020 (CN111560478A) teaches SARS-CoV-2 nucleocapsid RNA sequence (DNA format) recited in in instant SEQ ID No: 7. The sequence taught Chen et al 2020 by is shown (COVID-19 MN906947 sequence alignment DNA, figure 2) below: Qy 1 CCCTATGTGTTCATCAAACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 17 CCCTATGTGTTCATCAAACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTT 76 Qy 61 GAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTCGTAGTGGTGAGACACTTGGTGTC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 77 GAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTCGTAGTGGTGAGACACTTGGTGTC 136 Qy 121 CTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAGAAC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 137 CTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAGAAC 196 Qy 181 GGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 197 GGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGC 256 Qy 241 GACGAGCTTGGCACTGATCCTTATGAAGA 269 ||||||||||||||||||||||||||||| Db 257 GACGAGCTTGGCACTGATCCTTATGAAGA 285 Liotti et al 2020 is in the SARS COV-2 molecular diagnostic art and teaches a molecular diagnostic assay comprising SARS CoV-2 synthetic N RNA as a positive control and ATCC as a source of the synthetic RNA (See, abstract, p. 271 col 1 para on Quanty COVID-19 assay). Determining or adjusting concentration to 0; 0.5% - 2.0% dimethyl sulfoxide (DMSO), and 0.05% - 0.2% Tween 20 in the isothermal amplification reaction depend on the GC% content of the SARS CoV-2 target nucleic acid sequence and the target amplification for optimal performance of the SARS CoV-2 isothermal LAMP assay and is a routine laboratory approach (See as recited supra, De Leao E Flores et al 2020, Jensen et al 2010, Moore et al 2017, Wang et al 2015, Manomat et al 2019, Carter et al 2017 and Thermo Fisher Scientific Inc 2016). See In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955) and In re Geisler, 116 F.3d 1465, 43 USPQ2d 1362 (Fed. Cir. 1997); In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955); Peterson, 315 F.3d at 1330, 65 USPQ2d at 1382. Furthermore, according to section 2144.05 of the MPEP, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. “[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation.” In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). See also Peterson, 315 F.3d at 1330, 65 USPQ2d at 1382 (“The normal desire of scientists or artisans to improve upon what is already generally known provides the motivation to determine where in a disclosed set of percentage ranges is the optimum combination of percentages”). According to MPEP § 2112.01(III), “Where the only difference between a prior art product and a claimed product is printed matter that is not functionally related to the product, the content of the printed matter will not distinguish the claimed product from the prior art. In re Ngai, ** > 367 F.3d 1336, 1339, 70 USPQ2d 1862, 1864 (Fed. Cir. 2004) < (Claim at issue was a kit requiring instructions and a buffer agent. The Federal Circuit held that the claim was anticipated by a prior art reference that taught a kit that included instructions and a buffer agent, even though the content of the instructions differed.). See also In re Gulack, 703 F.2d 1381, 1385-86, 217 USPQ 401, 404 (Fed. Cir. 1983)( "Where the printed matter is not functionally related to the substrate, the printed matter will not distinguish the invention from the prior art in terms of patentability….[T]he critical question is whether there exists any new and unobvious functional relationship between the printed matter and the substrate." ).” It would have been obvious to one of the ordinary skills in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of De Leao E Flores et al 2020, Jensen et al 2010, Moore et al 2017, Wang et al 2015, Manomat et al 2019, Carter et al 2017 and Thermo Fisher Scientific Inc 2016 with the additional teachings of Zheng et al 2020, Liotti et al 2020 and Chen et al 2020 to arrive at the invention of claim 4. One of the ordinary skills in the art would have been motivated to develop and package the SARS CoV-2 isothermal amplification assay kit to detect SARS CoV-2 infection (COVID-19) in the samples for rapid diagnostics and commercial success. It would have been obvious to one of ordinary skill in the art at the time the invention was made to package components into a kit. One would be motivated to do this for commercial exploitation of the invention and to provide convenience for the end user. There would be a reasonable expectation of success given the applied prior art teachings in the art as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claim 4. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A, C-G). 11. Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of De Leao E Flores et al 2020 (WO2021220192A2 published 11/04/2021, with an earlier priority to 116317 filed on 04/30/2020), Jensen et al 2010 (PLoS ONE 5(6): e11024), Moore et al 2017 (Scientific Reports, 7:40244), Wang et al 2015 (Molecules. 2015, 7;20(4):6048-59), Manomat et al 2019 (Tropical Biomedicine 36(2): 495–504, 2019), Carter et al 2017 (J Virol Methods, 2017; 244: 32–38), Thermo Fisher Scientific Inc 2016 (published 2016), Chen et al 2020 (CN111560478A published 08/21/2020), Liotti et al 2020 (Eur J Clin Microbiol Infect Dis., 2020 Sep 4;40(2):269–277), Zheng et al 2020 (CN111850172A, published 10/30/2020), as evidenced by ATCC 2024 as applied to claim 4 above and further in view of Thi et al 2020 (Sci. Transl. Med. 12, eabc7075, 12 August 2020). Claim 5: The combined prior art teachings of De Leao E Flores et al 2020, Jensen et al 2010, Moore et al 2017, Wang et al 2015, Manomat et al 2019, Carter et al 2017, Thermo Fisher Scientific Inc 2016, Chen et al 2020, Liotti et al 2020, and Zheng et al 2020, as recited supra, are incorporated here in entirety and these combined prior art disclosures teaches the instant claim 5 directed to an isothermal amplification method for use in the diagnosis of Covid-19, and the steps characterized in the claimed method. See, De Leao E Flores et al 2020 (WO2021220192A2) teaches primer sequences (SEQ ID NO: 1-6) as recited above, abstract of and claims 1-35; Chen et al 2020 (CN111560478A) teaches SARS CoV-2 N RNA (DNA) sequence as claimed in SEQ ID NO: 7 and Liotti et al 2020 for synthetic SARS CoV-2 N RNA sequence as a positive control. Wang et al 2015 teaches setting up a positive and negative control method steps in the reaction of LAMP assay (See, page 6050, section 2.2. Optimization of DMSO Concentration). Manomat et al 2019 teaches method step for setting up a negative (water) sample or no template control (NTC) was included in all LAMP assay amplification (See, page 497 col 2 para 1). Thi et al 2020 discloses a colorimetric RT-LAMP assay and the claimed active steps of the method for detection of SARS CoV-2 RNA in clinical samples (See, abstract, figures 1-6 and associated legends, methods pages 9-11, entire article). It would have been obvious to one of the ordinary skills in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of De Leao E Flores et al 2020, Jensen et al 2010, Moore et al 2017, Wang et al 2015, Manomat et al 2019, Carter et al 2017, Thermo Fisher Scientific Inc 2016, Chen et al 2020, Liotti et al 2020, and Zheng et al 2020, with the additional teachings of Thi et al 2020 to arrive at the invention of claim 5 directed to the claimed method involving different steps to perform and interpret results of the claimed isothermal amplification method for the diagnosis of COVID-19. One of the ordinary skills in the art would have been motivated to develop the SARS CoV-2 isothermal amplification assay method to detect SARS CoV-2 infection (COVID-19) in the samples for providing a rapid diagnostics service for commercial success. It would have been obvious to one of ordinary skill in the art at the time the invention was made to package components into a kit. One would be motivated to do this for commercial exploitation of the invention and to provide diagnostic service to the COVID-19 infection suspected patients or for apparently healthy individuals for travel or work-related clearance purpose. There would be a reasonable expectation of success given the applied prior art teachings in the art as recited supra. This is analogous to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claim 5. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A, C-G). Response to Arguments 12. Applicant's arguments filed on 03/30/2026 have been fully considered but they are not persuasive. The obviousness rejection is modified by reciting the teachings from the same prior arts applied in non-final rejection office action (11/28/2025) in view of amended claims (claims 4-5) listing filed on 03/30/2026. 13. Applicant’s arguments: Upon entry of the present amendments, claims 2-7 remain in the present case. Reconsideration of the rejections, in light of the foregoing amendments and present remarks, is respectfully requested. The present amendments have been entered for the purpose of correcting informalities in the original claim language and for the purpose of more clearly distinguishing the present invention from the prior art. In the Official Action, claims 2, 3, 6 and 7 were rejected under 35 U.S.C. § 103(a) as being obvious over the De Leao E Flores article in view of the Jensen article, the Moore article, the Wang article, the Manomat article, the Carter article and the Thermo Fisher Scientific article. Claim 4 was rejected based upon these references and further in view of the Chen Chinese patent, the Liotti article, Zheng Chinese patent and the ATCC article. Claim 5 was rejected based upon these references and further in view of the Thi article. Claims 2-7 were rejected under 35 U.S.C. § 112(b) or 35 U.S.C. § 112(pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which Applicant regards as the invention. The specification was also objected to because of the use of various trademarks such as "tween 20", "SYBR Safe". There is an also objection relative to the use of the term "master mixture". As an overview to the present amendments, claims 2-7 have been amended so as to present the claims in a more proper U.S. format, including proper antecedent bases and proper structural interrelationships throughout. Any indefinite terminology found in the original claim language has been corrected herein. In particular, the indefinite term "tween 20" is now identified by its chemical name of "polyoxyethylene sorbitan monolaurate". The "SYBR Safe" is now identified by its chemical name as a "cyanine-base nucleic acid". The master mixture is identified as having "DNA polymerase, dNTPs, a buffer and MgSO4". In general, Applicant respectfully contends that the prior art teaches away from the present invention. In particular, the Wang article indicates that ratios of DMSO below 5% are unsuccessful. As claimed, the present invention utilizes 0.5% to 2%o DMSO. Applicant respectfully contends that this is an unexpected result in that the prior art teaches away from such a result. The claims are specific to this content range. Specifically, in the Official Action, the Wang article was relied upon heavily to suggest that the addition of DMSO to LAMP reactions to increase specificity is a matter of routine optimization, or obvious modification. However, a close examination of the Wang article reveals that it explicitly teaches away from the specific low-concentration range of DMSO as claimed. Independent claim 2 recites a specific reaction mixture comprising 0.5%o to 2.0% DMSO. In contrast, the Wang article investigated the effects of DMSO concentrations at 5%, 7.5% and 10%. Crucially, the Wang article reported that at 5% DMSO, "one of the two negative controls amplified as well". This indicates a failure to prevent non-specific amplification. The Wang article concluded that a "lower concentration of DMSO does not inhibit non-specific amplification" and determined that a concentration of 7.5% was optimal. As such, Applicant respectfully contends that a person having ordinary skill in the art, looking to solve the problem of the false positives based in the Wang article, would be discouraged from using DMSO concentrations that are lower than 5%. The prior art requires higher concentrations (approximately 7.5%). The fact that the reaction mixture claimed achieves high specificity and eliminates false positives at a low range of 0.5% to 2% of the DMSO is an unexpected result that directly contradicts the teachings of the cited prior art. As such, Applicant respectfully contends that independent claims 2, 4 and 5 would not be obvious in view of the prior art references. In the Official Action, it was asserted that discovery and optimum range as a matter of routine experimentation under MPEP§ 2144 .05. Applicant respectfully contends that this rule does not apply when the claimed range produces a new and unexpected result which is different in kind and not merely in degree from the results of the prior art. As noted above, the prior art indicates that low concentrations of DMSO (e.g. 5%) are ineffective for specificity. The present application has identified a critical range (e.g. 0.5% to 2%) where the specific combination of the claimed primers (SEQ ID NOs: 1-6) and the claimed additives function synergistically to provide a rapid and specific diagnosis without the inhibition often caused by higher DMSO concentrations. The specific combination is neither taught nor suggested by the disparate references cited in the Official Action. Independent claim 4 pertains to the "kit". Claim 4 was rejected based upon the previous references and further in view of the Chen, the Liotti, Zheng, and the ATCC articles. Claim 4 is directed to a kit comprising the specific reaction mixture recited in claim 2. Since the reaction mixture of claim 2 is patentable for the reasons set forth above, the kit containing this unique and non-obvious mixture should be likewise patentable. The addition of standard kit components (e.g. positive controls, water) cited in the secondary references (e.g. Chen, Liotti) does not cure the deficiencies of the primary references regarding the inventive mixture itself. The Applicant further contends that claim 5 is also patentable over the prior art. Claim 5 is also been rejected based the upon the wide variety of references cited above, along with the Thi publication. Claim 5 recites a method utilizing the specific primer mixture and additives of claim 2. Although the Thi publication may disclose certain colorimetric RT-LAMP steps, it does not teach or suggest the use of the specific reaction mixture of 0.5 to 2% DMSO and 0.05 % to 0.2% of the polyoxyethylene sorbitan monolaurate in combination with SEQ ID NOs: 1-6 as claimed. The success of the claimed method and, in particular, its ability to reduce false positives while maintaining speed, is directly attributable to the non-reaction mixture. Applicant respectfully contends that since the mixture itself is non-obvious, the method of using that mixture to diagnose COVID-19 is also non-obvious. Applicant further contends that the combination of such a huge number of prior art references is evidence of the "non-obviousness" of the present invention. Separate components in this wide variety of prior art references are mixed and matched together in an attempt to show the present invention, as claimed. However, Applicant respectfully contends that a person having ordinary skill in the art would not be able to do such by picking and choosing between such a large variety of prior art references in order to deduce the present invention. This is especially true since none of the prior art references include the 0.5% to 2% of DMSO. Applicant has revised the specification so as to include the proper chemical names for the trademarked items. Based upon the foregoing analysis, Applicant contends that independent claims 2, 4 and 5 are now in proper condition for allowance. Additionally, those claims which are dependent upon these independent claims should also be in condition for allowance. Reconsideration of the rejections and allowance of the claims at an early date is earnestly solicited. Response to arguments: In response to applicant's argument that the examiner has combined an excessive number of references, reliance on a large number of references in a rejection does not, without more, weigh against the obviousness of the claimed invention. See In re Gorman, 933 F.2d 982, 18 USPQ2d 1885 (Fed. Cir. 1991). Applicant has traversed the obviousness rejection of claims 2-7 by traversing rejection of independent claim 2 by selectively attacking an individual reference Wang et al 2015 with an argument “teaching away” DMSO concentration. However, Applicant has not addressed the Jensen et al 2010 teaching of nucleic acid amplification comprising 1-10% DMSO or 0.5-2.5 M Betaine greatly that improve amplification of GC-rich constructs in de novo synthesis (as recited supra). Additionally, applicant fails to appreciate the Moore et al 2017 reference that discloses recombinase polymerase amplification (RPA) as a novel isothermal method which rapidly amplifies and detects norovirus nucleic acids and teaches 0.2% DMSO that improves detection of norovirus RNA in a sample (as recited supra). Accordingly, the prior art teaches toward DMSO and Betaine concentrations within the scope of the instant claim in which these DMSO or Betaine amounts greatly improve amplification of GC-rich constructs. It is known in the art that DMSO is primarily added to PCR reactions as a denaturing aid and destabilizer. DMSO helps amplify difficult, complex, or GC-rich DNA templates by preventing the DNA strands from prematurely re-annealing and disrupting the formation of interfering secondary structures like hairpins. Improves Specificity: It minimizes off-target primer binding and the formation of primer-dimers. The GC content of nucleic acid varies based on the sequence and pathogen as a viral, bacterial or fungal origin. Therefore, optimization of DMSO or Betaine would be required for each newly developed nucleic acid amplification assay for optimal performance. See MPEP 2144.05. The Supreme Court has clarified that an "obvious to try" line of reasoning may properly support an obviousness rejection. In In re Antonie, 559 F.2d 618, 195 USPQ 6 (CCPA 1977), the CCPA held that a particular parameter must first be recognized as a result-effective variable, i.e., a variable which achieves a recognized result, before the determination of the optimum or workable ranges of said variable might be characterized as routine experimentation, because "obvious to try" is not a valid rationale for an obviousness finding. However, in KSR International Co. v. Teleflex Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421, 82 USPQ2d at 1397 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Additionally, applicant fails to point out how the Wang reference teaches away or how it is somehow distinguishes over the above recited close prior art references that contain DMSO overlapping amounts within the scope of the instant claims. See e.g. MPEP 2144.04 which establishes a prima facie case of obviousness where the reference amounts overlap with the claimed invention. Secondary Evidence: Applicant argues that the fact that the reaction mixture claimed achieves high specificity and eliminates false positives at a low range of 0.5% to 2% of the DMSO is an unexpected result that directly contradicts the teachings of the cited prior art. As such, Applicant respectfully contends that independent claims 2, 4 and 5 would not be obvious in view of the prior art references. In the Official Action, it was asserted that discovery and optimum range as a matter of routine experimentation under MPEP§ 2144 .05. Applicant respectfully contends that this rule does not apply when the claimed range produces a new and unexpected result which is different in kind and not merely in degree from the results of the prior art. In Response: The combined prior art teachings as applied to instant claim 2-7 rendered obvious the claims. The results obtained by the applicant’s inventions as being claimed as “unexpected results” would have been reasonably expected to be obtained by the ordinary skills in the art by optimization of DMSO and Betaine concentration for the claimed assay specificity improvement reasons over GC content of nucleic acid as recited supra. Additionally, applicant’s asserted “unexpected” results are “expected” in light of the above prior art references. Applicant's arguments filed on 03/30/2026 have been fully considered but they are not persuasive, and the rejection as recited supra is maintained. 14. Relevant Prior Art: Huang et al 2020. RT-LAMP for rapid diagnosis of coronavirus SARS-CoV-2. Microb Biotechnol. 2020 Jul;13 RT-LAMP primer set and kit for detection of novel coronavirus SARS-CoV-2 (4):950-961. Zhu et al 2020. CN111518947A. RT-LAMP primer set and kit for detection of novel coronavirus SARS-CoV-2. Liang et al 2019 (US20190218604A1). Additive composition used in lamp reaction. Frackman et al 1998. Betaine and DMSO: Enhancing Agents for PCR. Promega Notes Number 65, 1998, p. 27. Brambati et al 2021 (CA3174251A1, priority 03/31/2020). Assays for the detection of sars-cov-2. Nkere et al 2018. Chromogenic detection of yam mosaic virus by closed-tube reverse transcription loop-mediated isothermal amplification (CT-RT-LAMP). Arch Virol. 2018 Apr;163(4):1057-1061. Teaches use of Betaine as an additive (substitute for DMSO) (See, p. 1058 col 2, para 2). Shen et al 2020. CN111793716A. A LAMP detection primer set, kit and detection method for detecting 2019 new coronavirus. Yoshikawa et al 2020. Development and evaluation of a rapid and simple diagnostic assay for COVID-19 based on loop-mediated isothermal amplification. PLoS Negl Trop Dis 14(11): e0008855. Tanner et al 2010. Loop-Mediated Isothermal Amplification for Detection of Nucleic Acids. Teaches LAMP assay reaction mixture comprising 0.2% Tween 20. Current Protocols in Molecular Biology. Supplement 105. Unit 15.14. Conclusion 15. No claim is allowed. 16. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. 17. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SAMADHAN JAISING JADHAO/Examiner, Art Unit 1672 /BENNETT M CELSA/Primary Examiner, Art Unit 1600
Read full office action

Prosecution Timeline

May 02, 2023
Application Filed
Jun 03, 2025
Response after Non-Final Action
Nov 28, 2025
Non-Final Rejection mailed — §103, §112
Mar 30, 2026
Response Filed
Jun 18, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600750
METHODS FOR INACTIVATING AND STORING RESPIRATORY SYNCYTIAL VIRUS
4y 8m to grant Granted Apr 14, 2026
Patent 12577279
INFLUENZA VIRUS VACCINES AND USES THEREOF
3y 11m to grant Granted Mar 17, 2026
Patent 12516351
NOVEL AAV CAPSIDS AND COMPOSITIONS CONTAINING SAME
4y 2m to grant Granted Jan 06, 2026
Patent 12516352
NOVEL AAV CAPSIDS AND COMPOSITIONS CONTAINING SAME
4y 2m to grant Granted Jan 06, 2026
Patent 12496338
CAR for Treatment of HIV Infection
5y 7m to grant Granted Dec 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
98%
With Interview (+45.8%)
3y 6m (~3m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 50 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month