DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim(s) 160, 162-171, and 173 are pending and under consideration.
Preliminary Amendments
Applicant’s preliminary amendment filed on 12/28/2023 is acknowledged. The claims were amended to (1) cancel 1-159, 161 and 172; (2) amend 160, 162-164, 167-169, and 171.
Applicant’s preliminary amendment filed on 08/17/2026 is acknowledged. Specification was amended to insert required SEQ ID NOs and amend the “Sequence listing” statement.
Priority
Acknowledgement is made that this application is a 371 of PCT/US2021/058232 filed 11/05/2021 and claims priority based on provisional application filed as 63/110,837 on 11/06/2020.
All claims are given the priority date of 11/06/2020.
Information Disclosure Statement
Receipt of the information disclosure statement(s) on 09/03/2026 is acknowledged. The signed and initialed PTO-1449 form(s) has/have been mailed with this action.
Specification
The use of the term following terms, which is/are a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
ThermoFisher (p.156, para 1);
Lipofectamine (p.158, para 1; and p.160, para 1);
RNeasy (p.162, para 3);
RiboZero (p.162, para 3); and
NEBNext (p.162, para 3).
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112(b) – indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim(s) 160, 162-171, and 173 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim(s) 160 and 164 are rejected because the metes and bounds of SEQ ID NOs: 2-8 and 10-11 are unclear. Per the Sequence Listing, SEQ ID NOs: 2-8 (i.e., ugugaagcgaagugcacacggu) are the same sequence, as well as SEQ ID NOs: 10 and 11 are the same sequence (i.e., uccgcaguauggaucggcagau). However, the specification on page 4 paragraph 3 to page 5 teaches modifications, “Examples of such analogs and/or modified residues include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2'-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs). Additionally, nucleic acids can include one or more UNA moieties.” In another instance, the specification on 156 teaches in table 1 (see below) that SEQ ID NOs: 2-8 or10-11 can have differing modifications (e.g., phosphorothioate linkages, 2’-O-Methyl, 2’-F, and/or Unlocked nucleic acids). The sequence listing filed 08/17/2026 does not recite the modifications as described in the specification, thus, if Applicant intends for any modifications to be a required limitation, Applicant must recite the modifications in the body of the claim.
Claim(s) 165 and 166 are rejected because the metes and bounds of SEQ ID NOs 1, 6, and 7 are unclear. As stated above, SEQ ID NOs: 6-7 are the same sequence (i.e., ugugaagcgaagugcacacggu) in the Sequence Listing, however these sequences can have differing modifications as seen in table 1 (see below) of the specification on page 156 and described on page 4-5 (see excerpt above). SEQ ID NO: 1 per the Sequence listing does not require modifications, however, in table 1 on page 156 of the specification, SEQ ID NO: 1 can contain modifications (e.g., phosphorothioate linkages, 2’-O-Methyl, and/or 2’-F). If Applicant intends for any modifications to be a required limitation, Applicant must recite the modifications in the body of the claim.
Claim 163 and 173 are rejected because the metes and bounds of “siRNA 2-9” are unclear. By claiming “siRNA 2-9”, “siRNA” refers back to table 1 of the specification on page 156 (see below) where siRNA 2-9 are listed by both SEQ ID NO and enumerated sequences that could have differing modifications. For instance, the SEQ Listing does not require the SEQ ID NOs to have the differing modifications. SEQ ID NOs: 2-8 are the same sequence in the SEQ listing, as well as SEQ ID NOs: 10 and 11 are the same sequence. If Applicant intends for any modifications to be a required limitation, Applicant must recite the modifications in the body of
PNG
media_image1.png
560
986
media_image1.png
Greyscale
the claim.
An example of a claim language that could overcome this rejection is:
. . . wherein R2 is an siRNA comprising either SEQ ID NO: 2 or SEQ ID NO: 10 represented by any one of the following modified sequences as the antisense strand:
usGsugaagcgaaguGcAcacsgsgr(u),
usU(g)sugaagcgaaguGcAcacsgsgr(u),
usGsU(u)gaagcgaaguGcAcacsgsgr(u),
usGsuU(g)aagcgaaguGcAcacsgsgr(u),
usGsugU(a)agcgaaguGcAcacsgsgr(u),
usGsugaU(a)gcgaaguGcAcacsgsgr(u),
usGsugaaU(g)cgaaguGcAcacsgsgr(u),
usCscgcaguauggaUcGgcasgsar(u), or
usCscgcU(a)guauggaUcGgcasgsar(u);
wherein a lower-case letter represents 2'-O-Methyl nucleotides, an upper-case letter represents 2'-Fluoro nucleotides, “s” represents a phosphorothioate linker, “r(nucleotide)” represents an unmodified nucleotide, and “U(nucleotide)” represents an unlocked nucleotide.
Accordingly, claim(s) 162, 167-171, and 173 are rejected for being dependent upon claim 160.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 160, 162-171, and 173 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Mendez et al (WO 2019/051257 A2; published March 14th, 2019).
PNG
media_image2.png
130
1074
media_image2.png
Greyscale
PNG
media_image3.png
90
938
media_image3.png
Greyscale
Of note: SEQ ID NO: 1 and 2 are being interpreted as sequences containing the modifications corresponding to table 1 on page 156 of the specification.
All other SEQ ID NOs in the instant claim set are being interpreted as what is provided by the SEQ listing, i.e., sequences with no modifications. siRNA 2-9 (of claim 173) are being interpreted as consisting of the SEQ ID NOs from the SEQ listing.
Regarding claim 160, Mendez et al discloses on page 123, formula 236 with siRNA 125 which comprises SEQ ID NOs: 205 and 206 (see image below).
PNG
media_image6.png
254
688
media_image6.png
Greyscale
Wherein SEQ ID NO: 205 of Mendez et al is 100% identical to instant SEQ ID NO: 1 (including the modifications described in table 1 of the instant specification). Wherein SEQ ID NO: 206 of Mendez et al is 100% identical to instant SEQ ID NO: 2 (including the modifications described in table 1 of the instant specification).
Wherein, formula 236 is:
PNG
media_image7.png
254
472
media_image7.png
Greyscale
Regarding claim 162, Mendez et al discloses on page 123, formula 236 (see above) with siRNA 125 which comprises SEQ ID NOs: 205 and 206 (see image above). SEQ ID NO: 206 reads on instant SEQ ID NOs: 3-8.
Regarding claim 163 and 173, Mendez et al discloses on page 123, formula 26 (see above) with siRNA 125. siRNA 125 reads on siRNA 2-7.
Regarding claim(s) 164-166, Mendez et al discloses on page 122, the phosphodiester bond linkage between the compound and the siRNA (see below). Further, Mendez et al discloses on page 123, formula 236 with siRNA 125 which comprises SEQ ID NOs: 205 and 206 (see image above). SEQ ID NO: 205 of Mendez reads on instant SEQ ID NO: 1 (as interpreted from the instant SEQ listing and from the described modifications in table 1 of the instant specification). SEQ ID NO: 206 of Mendez et al reads on instant SEQ ID NO: 2 (as interpreted from the instant SEQ listing and from the described modifications in table 1 of the instant specification) and also instant SEQ ID NOs: 3-8 (as interpreted from the instant SEQ listing).
PNG
media_image8.png
260
400
media_image8.png
Greyscale
Regarding claim 167, Mendez et al discloses, “The agents (i.e., conjugates and additional therapeutic agents) can be formulated for and administered using any acceptable route of administration depending on the agent selected. . . The agents may be administered in any convenient administrative form, e.g., tablets, powders, capsules, solutions, dispersions, suspensions, syrups, sprays, suppositories, gels, emulsions, patches, etc. Such compositions may contain components conventional in pharmaceutical preparations, e.g., diluents, carriers, pH modifiers, sweeteners, bulking agents, and further active agents.”, (p. 162, lines 5-6 and lines 28-31).
Regarding claim 168, Mendez et al discloses, “In some embodiments, one or more of the siRNA molecules described herein are formulated into nucleic acid-lipid particles, and the particles are administered to a mammal (e.g., a human) requiring such treatment. In certain instances, a therapeutically effective amount of the nucleic acid-lipid particle can be
administered to the mammal, (e.g., for treating HBV and/or HDV infection in a human being). The nucleic acid-lipid particles described herein are particularly useful for targeting liver cells in humans which is the site of most HBV gene expression.”, (p. 43, lines 23-29).
Regarding claim 169, Mendez et al discloses treating a patient with HBV infection with conjugates of the invention (i.e., oligonucleotide comprised of the compound of Formula 1 (see p. 11, lines 23-30) (p. 4, lines 4-7).
Regarding claim 170, Mendez et al discloses subcutaneous administration (p.43, lines 29-31).
Regarding claim 171, Mendez et al discloses, “In certain embodiments, methods of the invention further comprise administering at least one additional therapeutic agent. In certain embodiments, the at least one additional therapeutic agent is selected from the group consisting of: (A) an agent that controls viral replication; (B) an agent that reduces viral Ags; (C) an immune enhancer; and (D) an immune stimulant. These classes of additional therapeutic agents are further described below as Category I, II and III agents.”, (p.12, lines 11-19).
Accordingly, claim(s) 160, 162-171, and 173 are anticipated by Mendez et al.
Claim(s) 160, 162-170, and 173 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by 823 (US Patent 11,427,823 B2; published August 30th, 2022; filed April 11th, 2017; #8 on IDS filed 09/03/2026).
The applied reference has a common Applicant/Inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement.
All SEQ ID NOs in the instant claim set are being interpreted as what is provided by the SEQ listing, i.e., sequences with no modifications. siRNA 2-9 (of claim 173) are being interpreted as consisting of the SEQ ID NOs from the SEQ listing.
Regarding claim(s) 160, 162-166, and 173, 823 discloses formula I in columns 71-72 (see formula below).
PNG
media_image9.png
210
638
media_image9.png
Greyscale
PNG
media_image10.png
190
642
media_image10.png
Greyscale
PNG
media_image13.png
652
844
media_image13.png
Greyscale
Wherein siRNA 25 consists of SEQ ID NOs: 49 and 50. SEQ ID NO: 49 of 823 reads on instant SEQ ID NO: 1, and SEQ ID NO: 50 of 823 reads on instant SEQ ID NOs: 2-8 (see alignment below).
Regarding claim 167, 823 discloses, “One aspect of this invention is pharmaceutical composition comprising a compound of formula I, and a pharmaceutically acceptable carrier.”, (col 88, lines 40-42).
Regarding claim 168, 823 discloses, “Another aspect of this invention is a method to deliver a double stranded siRNA to the liver of an animal comprising administering a compound of formula I or a pharmaceutically acceptable salt thereof, to the animal.”, (col 88, lines 43-46).
Regarding claim 169, 823 discloses, “Another aspect of this invention is a method to treat a disease or disorder (e.g., a liver disease or a viral infection, such as a hepatitis B viral infection) in an animal comprising administering a compound of formula I or a pharmaceutically acceptable salt thereof, to the animal. . . In certain embodiments, the animal is a mammal, such as a human (e.g., an HBV infected patient).”, (col 88, lines 47-51 and 66-67).
Regarding claim 170, 823 discloses, “In one embodiment the compound or salt is administered subcutaneously.”, (col 127, lines 62-63; as well as describing subcutaneous administration of the compounds of the invention to mice in col 286, lines 5-9, table 2 figure legend, and col 308, lines 28-34).
Accordingly, claims 160, 162-170, and 173 are anticipated by 823.
Claim(s) 160, 162-170, and 173 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by 833 (US Patent 12,043,833 B2; published July 23rd, 2024; filed April 11th, 2017; #10 on IDS filed 09/03/2026).
The applied reference has a common Applicant/Inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement.
All SEQ ID NOs in the instant claim set are being interpreted as what is provided by the SEQ listing, i.e., sequences with no modifications. siRNA 2-9 (of claim 173) are being interpreted as consisting of the SEQ ID NOs from the SEQ listing.
PNG
media_image14.png
486
698
media_image14.png
Greyscale
Regarding claim(s) 160, 162-166, and 173, 833 discloses formula I in columns 75-76 (see below).
PNG
media_image15.png
196
634
media_image15.png
Greyscale
PNG
media_image16.png
192
634
media_image16.png
Greyscale
Wherein siRNA 25 consists of SEQ ID NOs: 49 and 50. SEQ ID NO: 49 of 833 reads on instant SEQ ID NO: 1, and SEQ ID NO: 50 of 833 reads on instant SEQ ID NOs: 2-8 (see alignment below).
Regarding claim 167, 833 discloses, “One aspect of this invention is pharmaceutical composition comprising a compound of formula I, and a pharmaceutically acceptable carrier.”, (col 88, lines 60-62).
Regarding claim 168, 833 discloses, “Another aspect of this invention is a method to deliver a double stranded siRNA to the liver of an animal comprising administering a compound of formula I or a pharmaceutically acceptable salt thereof, to the animal.”, (col 88, lines 64-66).
Regarding claim 169, 833 discloses, “Another aspect of this invention is a method to treat a disease or disorder (e.g., a liver disease or a viral infection, such as a hepatitis B viral infection) in an animal comprising administering a compound of formula I or a pharmaceutically acceptable salt thereof, to the animal. . . In certain embodiments, the animal is a mammal, such as a human (e.g., an HBV infected patient).”, (col 89, lines 1-5 and col 90, lines 1-2).
Regarding claim 170, 833 discloses, “In one embodiment the compound or salt is administered subcutaneously.”, (col 129, lines 34-35; as well as describing subcutaneous administration of the compounds of the invention to mice in col 294, lines 35-39, table 2 figure legend, and col 317, lines 59-65).
Accordingly, claims 160, 162-170, and 173 are anticipated by 833.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim(s) 160, 162-170, and 173 are rejected under 35 U.S.C. 103 as being unpatentable over Mendez et al (supra) in view of Laursen et al (Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo, Molecular BioSystems (MBS), Vol 6, Iss 5, pages 862-870, published May 1st, 2010).
PNG
media_image3.png
90
938
media_image3.png
Greyscale
PNG
media_image19.png
404
1130
media_image19.png
Greyscale
Of note: SEQ ID NO: 1 and 2-8 are being interpreted as sequences containing the modifications corresponding to table 1 on page 156 of the specification. Table 1 is inserted below for convenience of referencing.
Regarding claim 160, Mendez et al discloses on page 123, formula 236 with siRNA 125 which comprises SEQ ID NOs: 205 and 206 (see image below).
PNG
media_image6.png
254
688
media_image6.png
Greyscale
Wherein SEQ ID NO: 205 of Mendez et al is 100% identical to instant SEQ ID NO: 1 (including the modifications, see table 1 above). Wherein SEQ ID NO: 206 of Mendez et al is 100% identical to instant SEQ ID NO: 2 (including the modifications, see table 1 above).
Wherein SEQ ID NO: 206 of Mendez et al is the identical base sequence to SEQ ID NOs: 3-8, and contains identical positioning of phosphorothioate linkages, 2’O-Methyl modifications, and 2’Fluoro modifications for instant SEQ ID NOs: 4-8 (see above table 1).
PNG
media_image7.png
254
472
media_image7.png
Greyscale
Wherein formula for 236 is:
Regarding claim 162, Mendez et al discloses on page 123, formula 236 (see above) with siRNA 125 which comprises SEQ ID NOs: 205 and 206 (see image above).
Regarding claim 163 and 173, Mendez et al discloses on page 123, formula 26 (see above) with siRNA 125.
Regarding claim(s) 164-166, Mendez et al discloses on page 122, the phosphodiester bond linkage between the compound and the siRNA (see below).
Further, Mendez et al discloses on page 123, formula 236 with siRNA 125 which comprises SEQ ID NOs: 205 and 206 (see image above). SEQ ID NO: 205 of Mendez reads on instant SEQ ID NO: 1 (with modifications as described in table 1).
PNG
media_image8.png
260
400
media_image8.png
Greyscale
SEQ ID NO: 206 of Mendez et al is the identical base sequence to SEQ ID NOs: 3-8, and contains identical positioning of phosphorothioate linkages, 2’O-Methyl modifications, and 2’Fluoro modifications for instant SEQ ID NOs: 4-8 (see above table 1).
Mendez et al teaches, “The term "unlocked nucleobase analogue" (abbreviated as "UNA") refers to an acyclic nucleobase in which the C2' and C3' atoms of the ribose ring are not covalently linked.”, (p. 33, lines 10-11).
Mendez et al further teaches, “Examples of such analogs and/or modified residues include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral -methyl phosphonates, 2'-0- methyl ribonucleotides, and peptide-nucleic acids (PNAs). Additionally, nucleic acids can include one or more UNA moieties.”, (p. 31, lines 29-32).
Lastly, Mendez et al teaches, “In certain embodiments, the siRNA may comprise one or more modified ribonucleotides and/or one or more backbone modifications (e.g., one or more ribonucleotides with a 2 -0- methyl modification, one or more UNA moieties, one or more 2'-Fluoro nucleotides, and/or one or more phosphorothioate linkers).”, (p.16, lines 9-12).
Regarding claim 167, Mendez et al discloses, “The agents (i.e., conjugates and additional therapeutic agents) can be formulated for and administered using any acceptable route of administration depending on the agent selected. . . The agents may be administered in any convenient administrative form, e.g., tablets, powders, capsules, solutions, dispersions, suspensions, syrups, sprays, suppositories, gels, emulsions, patches, etc. Such compositions may contain components conventional in pharmaceutical preparations, e.g., diluents, carriers, pH modifiers, sweeteners, bulking agents, and further active agents.”, (p. 162, lines 5-6 and lines 28-31).
Regarding claim 168, Mendez et al discloses, “In some embodiments, one or more of the siRNA molecules described herein are formulated into nucleic acid-lipid particles, and the particles are administered to a mammal (e.g., a human) requiring such treatment. In certain instances, a therapeutically effective amount of the nucleic acid-lipid particle can be
administered to the mammal, (e.g., for treating HBV and/or HDV infection in a human being). The nucleic acid-lipid particles described herein are particularly useful for targeting liver cells in humans which is the site of most HBV gene expression.”, (p. 43, lines 23-29).
Regarding claim 169, Mendez et al discloses treating a patient with HBV infection with conjugates of the invention (i.e., oligonucleotide comprised of the compound of Formula 1 (see p. 11, lines 23-30) (p. 4, lines 4-7).
Regarding claim 170, Mendez et al discloses subcutaneous administration (p.43, lines 29-31).
Regarding claim 171, Mendez et al discloses, “In certain embodiments, methods of the invention further comprise administering at least one additional therapeutic agent. In certain embodiments, the at least one additional therapeutic agent is selected from the group consisting of: (A) an agent that controls viral replication; (B) an agent that reduces viral Ags; (C) an immune enhancer; and (D) an immune stimulant. These classes of additional therapeutic agents are further described below as Category I, II and III agents.”, (p.12, lines 11-19).
Despite teaching the identical base sequence to SEQ ID NOs: 2-8, with the identical positioning of the phosphorothioate linkages, 2’-O-ME modifications, and 2’F modifications, Mendez et al does not teach the placement of Unlocked Nucleic Acids in the antisense strand as claimed.
Regarding claim(s) 160, 162-166, and 173, Laursen et al teaches, “UNA monomers are acyclic derivatives of RNA lacking the C2’–C3’-bond of the RNA ribose ring, yet still structurally mimicking unmodified RNA upon incorporation into RNA duplexes. Incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex.”, (p. 862, col 2, para 1).
Moreover, Laursen et al teaches, “Here we extend our analysis of incorporating UNA into siRNA designs and show how UNA can be utilized to improve siRNA performance. We find that low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability. Yet, even low levels of UNA modification can be highly beneficial; especially the strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi. Interestingly, lightly UNA-modified siRNA has prolonged biostability in vivo, even compared to extensively LNA modified siRNA, and produces efficient gene KD in a mouse model bearing human pancreas tumour xenografts. Hereby, UNA constitutes an important type of siRNA modification that has several interesting properties for siRNA function both in vitro and in vivo.”, (p. 862, col 2, para 1).
“We therefore recommend not to incorporate more than two UNA modifications in total within the base-paring siRNA stem unless the siRNA is stabilized by other types of chemical modifications (see below).”, (p.863, col 2, para 1).
Laursen et al teaches, “Furthermore all investigated siRNAs modified exclusively by UNA within the stem had significantly reduced stability and were largely degraded after 5 min of incubation in 80%FCS (Fig. 4A). We therefore recommend the use of shielding delivery reagents when utilizing siRNA modified only by UNA within the base pairing stem. In contrast, insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability (compare JC10–W037 to JC10-NAC3168 and W209-ID1276 to W209–W207, respectively; Fig. 4B).”, (p. 866, col 1 para 2 to col 2 para 1).
Laursen et al teaches, “Notably, we observed a potent eGFP KD in a mice model bearing human eGFP-expressing pancreas tumor xenografts upon subcutaneous injection of the naked UNA modified siRNA, W127–W131, whereas no effect was observed using non-modified siRNA. This demonstrates that the UNA-modified siRNA duplex was indeed biological functional and superior to unmodified siRNA (Fig. 5C) and hereby establishes UNA as an important type of chemical modification with great potential in siRNA therapeutics.”, (p. 867, col 1, para 1).
Lastly, Laursen et al teaches, “We have previously reported that UNA-modification of the SS 3’ overhang can enhance siRNA potency and that UNA modification of ASs could enhance target cell viability. Recently we have also found that UNA-modification of the AS seed region can reduce off-target effects (Bramsen et al., in prep.). . . We find that single UNA modifications are well tolerated at most tested positions in the AS and SS; However, additional UNA-modifications, especially in the AS, lead to reduced silencing efficiency (Fig. 1A–C) likely by destabilizing the siRNA duplex or interactions with the target mRNA. . . Notably, introduction of UNA into the stem of extensively modified siRNA did not dramatically reduce serum stability in contrast to siRNAs modified exclusively with UNA (Fig. 4B). Thus, UNA can be used to improve the KD efficiency of heavily modified siRNA without necessarily hampering the stability of the duplex.”, (p. 269, col 1 para 1, to col 2 para 1, to page 870, col 1, para 1).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify SEQ ID NO: 206 of Mendez et al, with the teachings of Laursen et al, i.e., adding one UNA, to yield the predictable results of a “heavily” modified antisense strand with one unlocked nucleic acid in the stem-portion of the siRNA. One skill could look to the teaches of Mendez et al: (1) Mendez et al teaches an siRNA, i.e., SEQ ID NO: 206 that contains phosphorothioate linkages, 2’O-methy, and 2’F modifications; and (2) Mendez et al teaches that in certain embodiments, the siRNA may comprise one or more modified ribonucleotides and/or one or more backbone modifications (e.g., one or more ribonucleotides with a 2 -0- methyl modification, one or more UNA moieties, one or more 2'-Fluoro nucleotides, and/or one or more phosphorothioate linkers). With Mendez et al teaching modified siRNA sequences and that these siRNA comprise one or more UNA moieties, one would then be motivated to look to the teachings of the art for the optimal placement of one or more UNA. One of skill could find Laursen et al teaching that (1) low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability; (2) not to incorporate more than two UNA modifications in total within the base-paring siRNA stem; and (3) single UNA modifications are well tolerated at most tested positions in the AS and SS. Thus, Laursen suggests one UNA modification, and not more than two UNA modifications with the base-pairing stem region. One of skill would be motivated to modify SEQ ID NO: 206 of Mendez et al with the teachings of Laursen et al because Lausen et al teaches (1) lightly UNA-modified siRNA has prolonged biostability in vivo and produces efficient gene knockdown; (2) incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex for example strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi; (3) insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability; and (4) UNA-modification of the AS seed region can reduce off-target effects.
Therefore, it would have been obvious to try to one of skill in the art before the effective filing date of the claimed invention to systematically add one UNA (taught by Laursen et al) to SEQ ID NO: 206 of Mendez et al for routine optimization to arrive at the claimed siRNA 2-7, and more specifically, SEQ ID NOs: 3-8 (seed region underlined in the below alignment).
S Strand 5’ – gugcacuucgcuucaca – 3’ (SEQ ID NO: 1)
AS Strand 3’ – uggcacacgugaagcgaagugu – 5’ (SEQ ID NO: 2-8)
One would have been motivated to do so because Laursen et al teaches all of the above motivations, but specifically, that UNA-modification of the AS seed region can reduce off-target effects. Thus, there are only 17 possible locations for a single UNA monomer to be incorporated. One of skill could have looked to the teachings of both Mendez et al and Laursen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claims 160, 162-171, and 173 are unpatentable over Mendez et al in view of Laursen et al.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claim(s) 160, 162-171, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 56 of copending Application No. 19/370,211 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following.
All SEQ ID NOs in the instant claim set are being interpreted as what is provided by the SEQ listing, i.e., sequences with no modifications. siRNA 2-9 (of claim 173) are being interpreted as consisting of the SEQ ID NOs from the SEQ listing.
PNG
media_image21.png
298
698
media_image21.png
Greyscale
PNG
media_image22.png
690
700
media_image22.png
Greyscale
Claim 56 of ‘211 recites:
Despite claim 56 of ‘211 being a methods claim, the claim still requires the structure of the composition of “a GalNAc construct of formula V or a salt thereof . . .wherein siRNA is siRNA 1 or 2.” This requirement of the claim anticipates instant claims 160, 162, and 163 because formula V is a species of the instant GalNAc structure in claim(s) 160, 162, and 163. Also, SEQ ID NO: 76 of the sense strand of siRNA 2 is identical to SEQ ID NO: 1 of the instant application and SEQ ID NO: 78 of the antisense strand of siRNA 2 in claim 56 anticipates SEQ ID NOs: 2-8. Thus, claim 56 of ‘211 anticipates instant claim(s) 160, 162-166, and 173.
Claim 56 of 211 anticipates instant claim(s) 167-170, and 171.
Accordingly, claim(s) 160, 162-171, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending Application No. 19/370,211.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claim(s) 160, 162-171, and 173 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 56 of copending Application No. 19/370,211 in view of Laursen et al (supra).
Of note: SEQ ID NO: 1 and 2-8 are being interpreted as sequences containing the modifications corresponding to table 1 on page 156 of the specification. Table 1 can be found in the 35 U.S.C 103 rejection above for reference.
Claim 56 of 211 anticipates instant claim(s) 167-170, and 171.
Wherein SEQ ID NO: 76 of 211 is 100% identical to instant SEQ ID NO: 1 (including the modifications, see table 1 above). Wherein SEQ ID NO: 78 of 211 is 100% identical to instant SEQ ID NO: 2 (including the modifications, see table 1 above).
Wherein SEQ ID NO: 78 of 211 is the identical base sequence to SEQ ID NOs: 3-8, and contains identical positioning of phosphorothioate linkages, 2’O-Methyl modifications, and 2’Fluoro modifications for instant SEQ ID NOs: 4-8 (see above table 1).
Despite requiring the identical base sequence to SEQ ID NOs: 2-8, with the identical positioning of the phosphorothioate linkages, 2’-O-ME modifications, and 2’F modifications, 211 does not require the placement of Unlocked Nucleic Acids in the antisense strand as claimed.
Regarding instant claim(s) 160, 162-166, and 173, Laursen et al teaches, “UNA monomers are acyclic derivatives of RNA lacking the C2’–C3’-bond of the RNA ribose ring, yet still structurally mimicking unmodified RNA upon incorporation into RNA duplexes. Incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex.”, (p. 862, col 2, para 1).
Moreover, Laursen et al teaches, “Here we extend our analysis of incorporating UNA into siRNA designs and show how UNA can be utilized to improve siRNA performance. We find that low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability. Yet, even low levels of UNA modification can be highly beneficial; especially the strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi. Interestingly, lightly UNA-modified siRNA has prolonged biostability in vivo, even compared to extensively LNA modified siRNA, and produces efficient gene KD in a mouse model bearing human pancreas tumour xenografts. Hereby, UNA constitutes an important type of siRNA modification that has several interesting properties for siRNA function both in vitro and in vivo.”, (p. 862, col 2, para 1).
“We therefore recommend not to incorporate more than two UNA modifications in total within the base-paring siRNA stem unless the siRNA is stabilized by other types of chemical modifications (see below).”, (p.863, col 2, para 1).
Laursen et al teaches, “Furthermore all investigated siRNAs modified exclusively by UNA within the stem had significantly reduced stability and were largely degraded after 5 min of incubation in 80%FCS (Fig. 4A). We therefore recommend the use of shielding delivery reagents when utilizing siRNA modified only by UNA within the base pairing stem. In contrast, insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability (compare JC10–W037 to JC10-NAC3168 and W209-ID1276 to W209–W207, respectively; Fig. 4B).”, (p. 866, col 1 para 2 to col 2 para 1).
Laursen et al teaches, “Notably, we observed a potent eGFP KD in a mice model bearing human eGFP-expressing pancreas tumor xenografts upon subcutaneous injection of the naked UNA modified siRNA, W127–W131, whereas no effect was observed using non-modified siRNA. This demonstrates that the UNA-modified siRNA duplex was indeed biological functional and superior to unmodified siRNA (Fig. 5C) and hereby establishes UNA as an important type of chemical modification with great potential in siRNA therapeutics.”, (p. 867, col 1, para 1).
Lastly, Laursen et al teaches, “We have previously reported that UNA-modification of the SS 3’ overhang can enhance siRNA potency and that UNA modification of ASs could enhance target cell viability. Recently we have also found that UNA-modification of the AS seed region can reduce off-target effects (Bramsen et al., in prep.). . . We find that single UNA modifications are well tolerated at most tested positions in the AS and SS; However, additional UNA-modifications, especially in the AS, lead to reduced silencing efficiency (Fig. 1A–C) likely by destabilizing the siRNA duplex or interactions with the target mRNA. . . Notably, introduction of UNA into the stem of extensively modified siRNA did not dramatically reduce serum stability in contrast to siRNAs modified exclusively with UNA (Fig. 4B). Thus, UNA can be used to improve the KD efficiency of heavily modified siRNA without necessarily hampering the stability of the duplex.”, (p. 269, col 1 para 1, to col 2 para 1, to page 870, col 1, para 1).
Thus, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify SEQ ID NO: 78 of 211, with the teachings of Laursen et al, i.e., adding one UNA, to yield the predictable results of a “heavily” modified antisense strand with one unlocked nucleic acid in the stem-portion of the siRNA. One of skill would be motivated to do so because Laursen et al teaching that (1) low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability; (2) not to incorporate more than two UNA modifications in total within the base-paring siRNA stem; and (3) single UNA modifications are well tolerated at most tested positions in the AS and SS. Thus, Laursen suggests one UNA modification, and not more than two UNA modifications with the base-pairing stem region. One of skill would be motivated to modify SEQ ID NO: 78 of 211 with the teachings of Laursen et al because Lausen et al teaches (1) lightly UNA-modified siRNA has prolonged biostability in vivo and produces efficient gene knockdown; (2) incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex for example strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi; (3) insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability; and (4) UNA-modification of the AS seed region can reduce off-target effects.
Therefore, it would have been obvious to try to one of skill in the art before the effective filing date of the claimed invention to systematically add one UNA (taught by Laursen et al) to SEQ ID NO: 78 of 211 for routine optimization to arrive at the claimed siRNA 2-7, and more specifically, SEQ ID NOs: 3-8 (seed region underlined in the below alignment).
S Strand 5’ – gugcacuucgcuucaca – 3’ (SEQ ID NO: 1)
AS Strand 3’ – uggcacacgugaagcgaagugu – 5’ (SEQ ID NO: 2-8)
One would have been motivated to do so because Laursen et al teaches all of the above motivations, but specifically, that UNA-modification of the AS seed region can reduce off-target effects. Thus, there are only 17 possible locations for a single UNA monomer to be incorporated. One of skill could have looked to the teachings of both claim 56 of 211 and Laursen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim(s) 160, 162-171, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending Application No. 19/370,211 in view of Laursen et al.
This is a provisional nonstatutory double patenting rejection.
Claim(s) 160, 162-166, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 205 of copending Application No. 18/734,444 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following.
All SEQ ID NOs in the instant claim set are being interpreted as what is provided by the SEQ listing, i.e., sequences with no modifications. siRNA 2-9 (of claim 173) are being interpreted as consisting of the SEQ ID NOs from the SEQ listing.
PNG
media_image25.png
724
632
media_image25.png
Greyscale
Claim 205 of ‘444 recites:
PNG
media_image26.png
212
630
media_image26.png
Greyscale
PNG
media_image27.png
198
662
media_image27.png
Greyscale
Wherein the double stranded siRNA molecule of claim 196 comprises SEQ ID NOs: 49 and 50. SEQ ID NO: 49 of ‘444 is reads on instant SEQ ID NO: 1, and SEQ ID NO: 50 of ‘444 is reads on SEQ ID NOs: 2-8 (see alignments below).
Claim 205 of ‘444 anticipates instant claim(s) 160, 162-166, and 173.
Accordingly, claim(s) 160, 162-166, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable copending Application No. 18/734,444.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claim(s) 160, 162-171, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 205 of copending Application No. 18/734,444 in view of Mendez et al (supra) in further view of Laursen et al (supra).
Of note: SEQ ID NO: 1 and 2-8 are being interpreted as sequences containing the modifications corresponding to table 1 on page 156 of the specification. Table 1 can be found in the 35 U.S.C 103 rejection above for reference.
The recitation of claim 205 of 444 can be found in the above rejection.
Wherein the double stranded siRNA molecule of claim 196 comprises SEQ ID NOs: 49 and 50. SEQ ID NO: 49 of ‘444 is reads on instant SEQ ID NO: 1’s base sequence (i.e., with out modifications), and SEQ ID NO: 50 of 444 reads on instant SEQ ID NOs: 2-8’s base sequence.
Claim 205 of ‘444 does not require phosphorothioate linkages, 2’-O-ME modifications, 2’F modifications in the sense strand and antisense strand and Unlocked Nucleic Acids in the antisense strand as claimed.
Regarding instant claim 160, Mendez et al discloses on page 123, formula 236 with siRNA 125 which comprises SEQ ID NOs: 205 and 206 (see image below).
PNG
media_image6.png
254
688
media_image6.png
Greyscale
Wherein the base sequence of SEQ ID NO: 205 of Mendez et al is 100% identical to SEQ ID NO: 49 of claim 205 of 444. Wherein the base sequence of SEQ ID NO: 206 of Mendez et al is 100% identical to SEQ ID NO: 50 of claim 205 of 444.
Wherein SEQ ID NO: 205-206 of Mendez et al teach phosphorothioate linkages, 2’O-Methyl modifications, and 2’Fluoro modifications. Mendez et al teaches, “The term "unlocked nucleobase analogue" (abbreviated as "UNA") refers to an acyclic nucleobase in which the C2' and C3' atoms of the ribose ring are not covalently linked.”, (p. 33, lines 10-11).
Mendez et al further teaches, “Examples of such analogs and/or modified residues include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral -methyl phosphonates, 2'-0- methyl ribonucleotides, and peptide-nucleic acids (PNAs). Additionally, nucleic acids can include one or more UNA moieties.”, (p. 31, lines 29-32).
Lastly, Mendez et al teaches, “In certain embodiments, the siRNA may comprise one or more modified ribonucleotides and/or one or more backbone modifications (e.g., one or more ribonucleotides with a 2 -0- methyl modification, one or more UNA moieties, one or more 2'-Fluoro nucleotides, and/or one or more phosphorothioate linkers).”, (p.16, lines 9-12).
Regarding instant claim 167, Mendez et al discloses, “The agents (i.e., conjugates and additional therapeutic agents) can be formulated for and administered using any acceptable route of administration depending on the agent selected. . . The agents may be administered in any convenient administrative form, e.g., tablets, powders, capsules, solutions, dispersions, suspensions, syrups, sprays, suppositories, gels, emulsions, patches, etc. Such compositions may contain components conventional in pharmaceutical preparations, e.g., diluents, carriers, pH modifiers, sweeteners, bulking agents, and further active agents.”, (p. 162, lines 5-6 and lines 28-31).
Regarding instant claim 168, Mendez et al discloses, “In some embodiments, one or more of the siRNA molecules described herein are formulated into nucleic acid-lipid particles, and the particles are administered to a mammal (e.g., a human) requiring such treatment. In certain instances, a therapeutically effective amount of the nucleic acid-lipid particle can be
administered to the mammal, (e.g., for treating HBV and/or HDV infection in a human being). The nucleic acid-lipid particles described herein are particularly useful for targeting liver cells in humans which is the site of most HBV gene expression.”, (p. 43, lines 23-29).
Regarding instant claim 169, Mendez et al discloses treating a patient with HBV infection with conjugates of the invention (i.e., oligonucleotide comprised of the compound of Formula 1 (see p. 11, lines 23-30) (p. 4, lines 4-7).
Regarding instant claim 170, Mendez et al discloses subcutaneous administration (p.43, lines 29-31).
Regarding instant claim 171, Mendez et al discloses, “In certain embodiments, methods of the invention further comprise administering at least one additional therapeutic agent. In certain embodiments, the at least one additional therapeutic agent is selected from the group consisting of: (A) an agent that controls viral replication; (B) an agent that reduces viral Ags; (C) an immune enhancer; and (D) an immune stimulant. These classes of additional therapeutic agents are further described below as Category I, II and III agents.”, (p.12, lines 11-19).
Claim 205 of 444 and Mendez et al do not teach the placement of Unlocked Nucleic Acids in the antisense strand as claimed.
Regarding instant claim(s) 160, 162-166, and 173, Laursen et al teaches, “UNA monomers are acyclic derivatives of RNA lacking the C2’–C3’-bond of the RNA ribose ring, yet still structurally mimicking unmodified RNA upon incorporation into RNA duplexes. Incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex.”, (p. 862, col 2, para 1).
Moreover, Laursen et al teaches, “Here we extend our analysis of incorporating UNA into siRNA designs and show how UNA can be utilized to improve siRNA performance. We find that low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability. Yet, even low levels of UNA modification can be highly beneficial; especially the strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi. Interestingly, lightly UNA-modified siRNA has prolonged biostability in vivo, even compared to extensively LNA modified siRNA, and produces efficient gene KD in a mouse model bearing human pancreas tumour xenografts. Hereby, UNA constitutes an important type of siRNA modification that has several interesting properties for siRNA function both in vitro and in vivo.”, (p. 862, col 2, para 1).
“We therefore recommend not to incorporate more than two UNA modifications in total within the base-paring siRNA stem unless the siRNA is stabilized by other types of chemical modifications (see below).”, (p.863, col 2, para 1).
Laursen et al teaches, “Furthermore all investigated siRNAs modified exclusively by UNA within the stem had significantly reduced stability and were largely degraded after 5 min of incubation in 80%FCS (Fig. 4A). We therefore recommend the use of shielding delivery reagents when utilizing siRNA modified only by UNA within the base pairing stem. In contrast, insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability (compare JC10–W037 to JC10-NAC3168 and W209-ID1276 to W209–W207, respectively; Fig. 4B).”, (p. 866, col 1 para 2 to col 2 para 1).
Laursen et al teaches, “Notably, we observed a potent eGFP KD in a mice model bearing human eGFP-expressing pancreas tumor xenografts upon subcutaneous injection of the naked UNA modified siRNA, W127– W131, whereas no effect was observed using non-modified siRNA. This demonstrates that the UNA-modified siRNA duplex was indeed biological functional and superior to unmodified siRNA (Fig. 5C) and hereby establishes UNA as an important type of chemical modification with great potential in siRNA therapeutics.”, (p. 867, col 1, para 1).
Lastly, Laursen et al teaches, “We have previously reported that UNA-modification of the SS 3’ overhang can enhance siRNA potency and that UNA modification of ASs could enhance target cell viability. Recently we have also found that UNA-modification of the AS seed region can reduce off-target effects (Bramsen et al., in prep.). . . We find that single UNA modifications are well tolerated at most tested positions in the AS and SS; However, additional UNA-modifications, especially in the AS, lead to reduced silencing efficiency (Fig. 1A–C) likely by destabilizing the siRNA duplex or interactions with the target mRNA. . . Notably, introduction of UNA into the stem of extensively modified siRNA did not dramatically reduce serum stability in contrast to siRNAs modified exclusively with UNA (Fig. 4B). Thus, UNA can be used to improve the KD efficiency of heavily modified siRNA without necessarily hampering the stability of the duplex.”, (p. 269, col 1 para 1, to col 2 para 1, to page 870, col 1, para 1).
Accordingly, it would have been obvious to one of ordinary skill before the effective filing date of the claimed invention to substitute both SEQ ID NO: 49 and 50 of 444 with SEQ ID NOs: 205 and 206 of Mendez et al, to yield a compound containing SEQ ID NOs: 205 and 206 which contain 2’-O-ME, 2’F, and phosphorothioate modifications at specific positions. SEQ ID NO: 205 of Mendez et al and SEQ ID NO: 49 of 444 are the same base sequence. SEQ ID NO: 50 of 444 and SEQ ID NO: 206 of Mendez et al are the same base sequence. Both SEQ ID NOs: 205 and 206 of Mendez et al were known in the art before the effective filing date of the claimed invention and contain modifications at positions known in the art before effective filing date. One of skill in the art could look SEQ ID NOs: 49 and 50 of 444 and SEQ ID NOs: 205 and 206 of Mendez et al and arrive at instant SEQ ID NO: 1 and SEQ ID NOs: 2-8 (without the UNA) with a high likelihood of success.
Further, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify SEQ ID NO: 206 of Mendez et al, with the teachings of Laursen et al, i.e., adding one UNA, to yield the predictable results of a “heavily” modified antisense strand with one unlocked nucleic acid in the stem-portion of the siRNA. One skill could look to the teaches of Mendez et al: (1) Mendez et al teaches an siRNA, i.e., SEQ ID NO: 206 that contains phosphorothioate linkages, 2’O-methy, and 2’F modifications; and (2) Mendez et al teaches that in certain embodiments, the siRNA may comprise one or more modified ribonucleotides and/or one or more backbone modifications (e.g., one or more ribonucleotides with a 2 -0- methyl modification, one or more UNA moieties, one or more 2'-Fluoro nucleotides, and/or one or more phosphorothioate linkers). With Mendez et al teaching modified siRNA sequences and that these siRNA comprise one or more UNA moieties, one would then be motivated to look to the teachings of the art for the optimal placement of one or more UNA. One of skill could find Laursen et al teaching that (1) low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability; (2) not to incorporate more than two UNA modifications in total within the base-paring siRNA stem; and (3) single UNA modifications are well tolerated at most tested positions in the AS and SS. Thus, Laursen suggests one UNA modification, and not more than two UNA modifications with the base-pairing stem region. One of skill would be motivated to modify SEQ ID NO: 206 of Mendez et al with the teachings of Laursen et al because Lausen et al teaches (1) lightly UNA-modified siRNA has prolonged biostability in vivo and produces efficient gene knockdown; (2) incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex for example strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi; (3) insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability; and (4) UNA-modification of the AS seed region can reduce off-target effects.
Therefore, it would have been obvious to try to one of skill in the art before the effective filing date of the claimed invention to systematically add one UNA (taught by Laursen et al) to SEQ ID NO: 206 of Mendez et al for routine optimization to arrive at the claimed siRNA 2-7, and more specifically, SEQ ID NOs: 3-8 (seed region underlined in the below alignment).
S Strand 5’ – gugcacuucgcuucaca – 3’ (SEQ ID NO: 1)
AS Strand 3’ – uggcacacgugaagcgaagugu – 5’ (SEQ ID NO: 2-8)
One would have been motivated to do so because Laursen et al teaches all of the above motivations, but specifically, that UNA-modification of the AS seed region can reduce off-target effects. Thus, there are only 17 possible locations for a single UNA monomer to be incorporated. One of skill could have looked to the teachings of both Mendez et al and Laursen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim(s) 160, 162-171, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending Application No. 18/734,444 in view of Mendez et al (supra) in further view of Laursen et al (supra).
This is a provisional nonstatutory double patenting rejection.
Claim(s) 160, 162-167, and 173 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 7 and 15 of U.S. Patent No. US 11,427,823 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following:
All SEQ ID NOs in the instant claim set are being interpreted as what is provided by the SEQ listing, i.e., sequences with no modifications. siRNA 2-9 (of claim 173) are being interpreted as consisting of the SEQ ID NOs from the SEQ listing.
PNG
media_image30.png
630
630
media_image30.png
Greyscale
Claim 7, dependent on claim 2 and further dependent on claim 1 of 823 recite:
Wherein siRNA 25 consists of SEQ ID NOs: 49 and 50. SEQ ID NO: 49 of 823 reads on instant SEQ ID NO: 1, and SEQ ID NO: 50 of 823 reads on instant SEQ ID NOs: 2-8 (see alignment below).
PNG
media_image9.png
210
638
media_image9.png
Greyscale
PNG
media_image10.png
190
642
media_image10.png
Greyscale
Claim 7 of 823 anticipates instant claims 160, 162-166, and 173.
Claim 15 of 823 recites, “A pharmaceutical composition comprising the compound of claim 7 and a pharmaceutically acceptable carrier.”
Claim 15 of 823 anticipates instant claim 167.
Accordingly, claim(s) 160, 162-167, and 173 are rejected on the ground of nonstatutory double patenting as being unpatentable over U.S. Patent No. US 11,427,823 B2.
Claim(s) 160, 162-171, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 7 of U.S. Patent No. US 11,427,823 B2 in view of Mendez et al (supra) in further view of Laursen et al (surpa).
Of note: SEQ ID NO: 1 and 2-8 are being interpreted as sequences containing the modifications corresponding to table 1 on page 156 of the specification. Table 1 can be found in the 35 U.S.C 103 rejection above for reference.
The recitation of claim 7 of 823 can be found in the above rejection.
siRNA 25 comprises SEQ ID NOs: 49 and 50. SEQ ID NO: 49 of ‘823 is reads on instant SEQ ID NO: 1’s base sequence (i.e., without modifications), and SEQ ID NO: 50 of 823 reads on instant SEQ ID NOs: 2-8’s base sequence.
Claim 7 of 823 does not require phosphorothioate linkages, 2’-O-ME modifications, 2’F modifications in the sense strand and antisense strand and Unlocked Nucleic Acids in the antisense strand as claimed.
PNG
media_image6.png
254
688
media_image6.png
Greyscale
Regarding instant claim 160, Mendez et al discloses on page 123, formula 236 with siRNA 125 which comprises SEQ ID NOs: 205 and 206 (see image below).
Wherein the base sequence of SEQ ID NO: 205 of Mendez et al is 100% identical to SEQ ID NO: 49 of 823. Wherein the base sequence of SEQ ID NO: 206 of Mendez et al is 100% identical to SEQ ID NO: 50 of 823.
Wherein SEQ ID NO: 205-206 of Mendez et al teach phosphorothioate linkages, 2’O-Methyl modifications, and 2’Fluoro modifications. Mendez et al teaches, “The term "unlocked nucleobase analogue" (abbreviated as "UNA") refers to an acyclic nucleobase in which the C2' and C3' atoms of the ribose ring are not covalently linked.”, (p. 33, lines 10-11).
Mendez et al further teaches, “Examples of such analogs and/or modified residues include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral -methyl phosphonates, 2'-0- methyl ribonucleotides, and peptide-nucleic acids (PNAs). Additionally, nucleic acids can include one or more UNA moieties.”, (p. 31, lines 29-32).
Lastly, Mendez et al teaches, “In certain embodiments, the siRNA may comprise one or more modified ribonucleotides and/or one or more backbone modifications (e.g., one or more ribonucleotides with a 2 -0- methyl modification, one or more UNA moieties, one or more 2'-Fluoro nucleotides, and/or one or more phosphorothioate linkers).”, (p.16, lines 9-12).
Regarding instant claim 167, Mendez et al discloses, “The agents (i.e., conjugates and additional therapeutic agents) can be formulated for and administered using any acceptable route of administration depending on the agent selected. . . The agents may be administered in any convenient administrative form, e.g., tablets, powders, capsules, solutions, dispersions, suspensions, syrups, sprays, suppositories, gels, emulsions, patches, etc. Such compositions may contain components conventional in pharmaceutical preparations, e.g., diluents, carriers, pH modifiers, sweeteners, bulking agents, and further active agents.”, (p. 162, lines 5-6 and lines 28-31).
Regarding instant claim 168, Mendez et al discloses, “In some embodiments, one or more of the siRNA molecules described herein are formulated into nucleic acid-lipid particles, and the particles are administered to a mammal (e.g., a human) requiring such treatment. In certain instances, a therapeutically effective amount of the nucleic acid-lipid particle can be
administered to the mammal, (e.g., for treating HBV and/or HDV infection in a human being). The nucleic acid-lipid particles described herein are particularly useful for targeting liver cells in humans which is the site of most HBV gene expression.”, (p. 43, lines 23-29).
Regarding instant claim 169, Mendez et al discloses treating a patient with HBV infection with conjugates of the invention (i.e., oligonucleotide comprised of the compound of Formula 1 (see p. 11, lines 23-30) (p. 4, lines 4-7).
Regarding instant claim 170, Mendez et al discloses subcutaneous administration (p.43, lines 29-31).
Regarding instant claim 171, Mendez et al discloses, “In certain embodiments, methods of the invention further comprise administering at least one additional therapeutic agent. In certain embodiments, the at least one additional therapeutic agent is selected from the group consisting of: (A) an agent that controls viral replication; (B) an agent that reduces viral Ags; (C) an immune enhancer; and (D) an immune stimulant. These classes of additional therapeutic agents are further described below as Category I, II and III agents.”, (p.12, lines 11-19).
Claim 7 of 823 and Mendez et al do not teach the placement of Unlocked Nucleic Acids in the antisense strand as claimed.
Regarding instant claim(s) 160, 162-166, and 173, Laursen et al teaches, “UNA monomers are acyclic derivatives of RNA lacking the C2’–C3’-bond of the RNA ribose ring, yet still structurally mimicking unmodified RNA upon incorporation into RNA duplexes. Incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex.”, (p. 862, col 2, para 1).
Moreover, Laursen et al teaches, “Here we extend our analysis of incorporating UNA into siRNA designs and show how UNA can be utilized to improve siRNA performance. We find that low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability. Yet, even low levels of UNA modification can be highly beneficial; especially the strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi. Interestingly, lightly UNA-modified siRNA has prolonged biostability in vivo, even compared to extensively LNA modified siRNA, and produces efficient gene KD in a mouse model bearing human pancreas tumour xenografts. Hereby, UNA constitutes an important type of siRNA modification that has several interesting properties for siRNA function both in vitro and in vivo.”, (p. 862, col 2, para 1).
“We therefore recommend not to incorporate more than two UNA modifications in total within the base-paring siRNA stem unless the siRNA is stabilized by other types of chemical modifications (see below).”, (p.863, col 2, para 1).
Laursen et al teaches, “Furthermore all investigated siRNAs modified exclusively by UNA within the stem had significantly reduced stability and were largely degraded after 5 min of incubation in 80%FCS (Fig. 4A). We therefore recommend the use of shielding delivery reagents when utilizing siRNA modified only by UNA within the base pairing stem. In contrast, insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability (compare JC10–W037 to JC10-NAC3168 and W209-ID1276 to W209–W207, respectively; Fig. 4B).”, (p. 866, col 1 para 2 to col 2 para 1).
Laursen et al teaches, “Notably, we observed a potent eGFP KD in a mice model bearing human eGFP-expressing pancreas tumor xenografts upon subcutaneous injection of the naked UNA modified siRNA, W127– W131, whereas no effect was observed using non-modified siRNA. This demonstrates that the UNA-modified siRNA duplex was indeed biological functional and superior to unmodified siRNA (Fig. 5C) and hereby establishes UNA as an important type of chemical modification with great potential in siRNA therapeutics.”, (p. 867, col 1, para 1).
Lastly, Laursen et al teaches, “We have previously reported that UNA-modification of the SS 3’ overhang can enhance siRNA potency and that UNA modification of ASs could enhance target cell viability. Recently we have also found that UNA-modification of the AS seed region can reduce off-target effects (Bramsen et al., in prep.). . . We find that single UNA modifications are well tolerated at most tested positions in the AS and SS; However, additional UNA-modifications, especially in the AS, lead to reduced silencing efficiency (Fig. 1A–C) likely by destabilizing the siRNA duplex or interactions with the target mRNA. . . Notably, introduction of UNA into the stem of extensively modified siRNA did not dramatically reduce serum stability in contrast to siRNAs modified exclusively with UNA (Fig. 4B). Thus, UNA can be used to improve the KD efficiency of heavily modified siRNA without necessarily hampering the stability of the duplex.”, (p. 269, col 1 para 1, to col 2 para 1, to page 870, col 1, para 1).
Accordingly, it would have been obvious to one of ordinary skill before the effective filing date of the claimed invention to substitute both SEQ ID NO: 49 and 50 of 823 with SEQ ID NOs: 205 and 206 of Mendez et al, to yield a compound containing SEQ ID NOs: 205 and 206 which contain 2’-O-ME, 2’F, and phosphorothioate modifications at specific positions. SEQ ID NO: 205 of Mendez et al and SEQ ID NO: 49 of 823 are the same base sequence. SEQ ID NO: 50 of 823 and SEQ ID NO: 206 of Mendez et al are the same base sequence. Both SEQ ID NOs: 205 and 206 of Mendez et al and SEQ ID NOs: 49 and 50 of 823 were known in the art before the effective filing date of the claimed invention. One of skill in the art could look SEQ ID NOs: 49 and 50 of 823 and SEQ ID NOs: 205 and 206 of Mendez et al and arrive at instant SEQ ID NO: 1 and SEQ ID NOs: 2-8 (without the UNA) with a high likelihood of success.
Further, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify SEQ ID NO: 206 of Mendez et al, with the teachings of Laursen et al, i.e., adding one UNA, to yield the predictable results of a “heavily” modified antisense strand with one unlocked nucleic acid in the stem-portion of the siRNA. One skill could look to the teaches of Mendez et al: (1) Mendez et al teaches an siRNA, i.e., SEQ ID NO: 206 that contains phosphorothioate linkages, 2’O-methy, and 2’F modifications; and (2) Mendez et al teaches that in certain embodiments, the siRNA may comprise one or more modified ribonucleotides and/or one or more backbone modifications (e.g., one or more ribonucleotides with a 2 -0- methyl modification, one or more UNA moieties, one or more 2'-Fluoro nucleotides, and/or one or more phosphorothioate linkers). With Mendez et al teaching modified siRNA sequences and that these siRNA comprise one or more UNA moieties, one would then be motivated to look to the teachings of the art for the optimal placement of one or more UNA. One of skill could find Laursen et al teaching that (1) low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability; (2) not to incorporate more than two UNA modifications in total within the base-paring siRNA stem; and (3) single UNA modifications are well tolerated at most tested positions in the AS and SS. Thus, Laursen suggests one UNA modification, and not more than two UNA modifications with the base-pairing stem region. One of skill would be motivated to modify SEQ ID NO: 206 of Mendez et al with the teachings of Laursen et al because Lausen et al teaches (1) lightly UNA-modified siRNA has prolonged biostability in vivo and produces efficient gene knockdown; (2) incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex for example strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi; (3) insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability; and (4) UNA-modification of the AS seed region can reduce off-target effects.
Therefore, it would have been obvious to try to one of skill in the art before the effective filing date of the claimed invention to systematically add one UNA (taught by Laursen et al) to SEQ ID NO: 206 of Mendez et al for routine optimization to arrive at the claimed siRNA 2-7, and more specifically, SEQ ID NOs: 3-8 (seed region underlined in the below alignment).
S Strand 5’ – gugcacuucgcuucaca – 3’ (SEQ ID NO: 1)
AS Strand 3’ – uggcacacgugaagcgaagugu – 5’ (SEQ ID NO: 2-8)
One would have been motivated to do so because Laursen et al teaches all of the above motivations, but specifically, that UNA-modification of the AS seed region can reduce off-target effects. Thus, there are only 17 possible locations for a single UNA monomer to be incorporated. One of skill could have looked to the teachings of both Mendez et al and Laursen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim(s) 160, 162-171, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over U.S. Patent No. US 11,427,823 B2 in view of Mendez et al (supra) in further view of Laursen et al (surpa).
Claim(s) 160, 162-170, and 173 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 2, 4-5, and 12 of U.S. Patent No. US 12,043,833 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because of the following:
All SEQ ID NOs in the instant claim set are being interpreted as what is provided by the SEQ listing, i.e., sequences with no modifications. siRNA 2-9 (of claim 173) are being interpreted as consisting of the SEQ ID NOs from the SEQ listing.
Claim 2 of ‘833 recites:
PNG
media_image31.png
620
862
media_image31.png
Greyscale
PNG
media_image15.png
196
634
media_image15.png
Greyscale
PNG
media_image16.png
192
634
media_image16.png
Greyscale
Wherein siRNA 25 consists of SEQ ID NOs: 49 and 50. SEQ ID NO: 49 of 833 reads on instant SEQ ID NO: 1, and SEQ ID NO: 50 of 833 reads on instant SEQ ID NOs: 2-8 (see alignment below).
Claim 2 of 833 anticipates instant claims 160, 162-166, and 173.
Claim 12 of 833 recites, “A pharmaceutical composition comprising the compound of claim 2, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.”
Claim 12 of 833 anticipates instant claim 167.
Claim 4 of 833 recites, “A method to deliver a siRNA to the liver of a human comprising administering a compound as described in claim 1, or a pharmaceutically acceptable salt thereof, to the human.”
Claim 4 of 833 anticipates instant claim 168.
Claim 5 of 833 recites, “A method to treat a hepatitis B viral infection in a human comprising administering an effective amount of a compound as described in claim 1, or a pharmaceutically acceptable salt thereof, to the human.”
Claim 5 of 833 anticipates instant claim 169-170.
Accordingly, claim(s) 160, 162-170, and 173 are rejected on the ground of nonstatutory double patenting as being unpatentable over U.S. Patent No. US 12,043,833 B2.
Claim(s) 160, 162-171, and 173 rejected on the ground of nonstatutory double patenting as being unpatentable over claim 2 of U.S. Patent No. US 12,043,833 B2 in view of Mendez (supra) in further view of Laursen (supra).
Of note: SEQ ID NO: 1 and 2-8 are being interpreted as sequences containing the modifications corresponding to table 1 on page 156 of the specification. Table 1 can be found in the 35 U.S.C 103 rejection above for reference.
The recitation of claim 2 of 833 can be found in the above rejection.
siRNA 25 comprises SEQ ID NOs: 49 and 50. SEQ ID NO: 49 of ‘833 is reads on instant SEQ ID NO: 1’s base sequence (i.e., without modifications), and SEQ ID NO: 50 of 833 reads on instant SEQ ID NOs: 2-8’s base sequence.
Claim 2 of 833 does not require phosphorothioate linkages, 2’-O-ME modifications, 2’F modifications in the sense strand and antisense strand and Unlocked Nucleic Acids in the antisense strand as claimed.
Regarding instant claim 160, Mendez et al discloses on page 123, formula 236 with siRNA 125 which comprises SEQ ID NOs: 205 and 206 (see image below).
PNG
media_image6.png
254
688
media_image6.png
Greyscale
Wherein the base sequence of SEQ ID NO: 205 of Mendez et al is 100% identical to SEQ ID NO: 49 of 833. Wherein the base sequence of SEQ ID NO: 206 of Mendez et al is 100% identical to SEQ ID NO: 50 of 833.
Wherein SEQ ID NO: 205-206 of Mendez et al teach phosphorothioate linkages, 2’O-Methyl modifications, and 2’Fluoro modifications. Mendez et al teaches, “The term "unlocked nucleobase analogue" (abbreviated as "UNA") refers to an acyclic nucleobase in which the C2' and C3' atoms of the ribose ring are not covalently linked.”, (p. 33, lines 10-11).
Mendez et al further teaches, “Examples of such analogs and/or modified residues include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral -methyl phosphonates, 2'-0- methyl ribonucleotides, and peptide-nucleic acids (PNAs). Additionally, nucleic acids can include one or more UNA moieties.”, (p. 31, lines 29-32).
Lastly, Mendez et al teaches, “In certain embodiments, the siRNA may comprise one or more modified ribonucleotides and/or one or more backbone modifications (e.g., one or more ribonucleotides with a 2 -0- methyl modification, one or more UNA moieties, one or more 2'-Fluoro nucleotides, and/or one or more phosphorothioate linkers).”, (p.16, lines 9-12).
Regarding instant claim 167, Mendez et al discloses, “The agents (i.e., conjugates and additional therapeutic agents) can be formulated for and administered using any acceptable route of administration depending on the agent selected. . . The agents may be administered in any convenient administrative form, e.g., tablets, powders, capsules, solutions, dispersions, suspensions, syrups, sprays, suppositories, gels, emulsions, patches, etc. Such compositions may contain components conventional in pharmaceutical preparations, e.g., diluents, carriers, pH modifiers, sweeteners, bulking agents, and further active agents.”, (p. 162, lines 5-6 and lines 28-31).
Regarding instant claim 168, Mendez et al discloses, “In some embodiments, one or more of the siRNA molecules described herein are formulated into nucleic acid-lipid particles, and the particles are administered to a mammal (e.g., a human) requiring such treatment. In certain instances, a therapeutically effective amount of the nucleic acid-lipid particle can be
administered to the mammal, (e.g., for treating HBV and/or HDV infection in a human being). The nucleic acid-lipid particles described herein are particularly useful for targeting liver cells in humans which is the site of most HBV gene expression.”, (p. 43, lines 23-29).
Regarding instant claim 169, Mendez et al discloses treating a patient with HBV infection with conjugates of the invention (i.e., oligonucleotide comprised of the compound of Formula 1 (see p. 11, lines 23-30) (p. 4, lines 4-7).
Regarding instant claim 170, Mendez et al discloses subcutaneous administration (p.43, lines 29-31).
Regarding instant claim 171, Mendez et al discloses, “In certain embodiments, methods of the invention further comprise administering at least one additional therapeutic agent. In certain embodiments, the at least one additional therapeutic agent is selected from the group consisting of: (A) an agent that controls viral replication; (B) an agent that reduces viral Ags; (C) an immune enhancer; and (D) an immune stimulant. These classes of additional therapeutic agents are further described below as Category I, II and III agents.”, (p.12, lines 11-19).
Claim 2 of 833 and Mendez et al do not teach the placement of Unlocked Nucleic Acids in the antisense strand as claimed.
Regarding instant claim(s) 160, 162-166, and 173, Laursen et al teaches, “UNA monomers are acyclic derivatives of RNA lacking the C2’–C3’-bond of the RNA ribose ring, yet still structurally mimicking unmodified RNA upon incorporation into RNA duplexes. Incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex.”, (p. 862, col 2, para 1).
Moreover, Laursen et al teaches, “Here we extend our analysis of incorporating UNA into siRNA designs and show how UNA can be utilized to improve siRNA performance. We find that low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability. Yet, even low levels of UNA modification can be highly beneficial; especially the strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi. Interestingly, lightly UNA-modified siRNA has prolonged biostability in vivo, even compared to extensively LNA modified siRNA, and produces efficient gene KD in a mouse model bearing human pancreas tumour xenografts. Hereby, UNA constitutes an important type of siRNA modification that has several interesting properties for siRNA function both in vitro and in vivo.”, (p. 862, col 2, para 1).
“We therefore recommend not to incorporate more than two UNA modifications in total within the base-paring siRNA stem unless the siRNA is stabilized by other types of chemical modifications (see below).”, (p.863, col 2, para 1).
Laursen et al teaches, “Furthermore all investigated siRNAs modified exclusively by UNA within the stem had significantly reduced stability and were largely degraded after 5 min of incubation in 80%FCS (Fig. 4A). We therefore recommend the use of shielding delivery reagents when utilizing siRNA modified only by UNA within the base pairing stem. In contrast, insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability (compare JC10–W037 to JC10-NAC3168 and W209-ID1276 to W209–W207, respectively; Fig. 4B).”, (p. 866, col 1 para 2 to col 2 para 1).
Laursen et al teaches, “Notably, we observed a potent eGFP KD in a mice model bearing human eGFP-expressing pancreas tumor xenografts upon subcutaneous injection of the naked UNA modified siRNA, W127– W131, whereas no effect was observed using non-modified siRNA. This demonstrates that the UNA-modified siRNA duplex was indeed biological functional and superior to unmodified siRNA (Fig. 5C) and hereby establishes UNA as an important type of chemical modification with great potential in siRNA therapeutics.”, (p. 867, col 1, para 1).
Lastly, Laursen et al teaches, “We have previously reported that UNA-modification of the SS 3’ overhang can enhance siRNA potency and that UNA modification of ASs could enhance target cell viability. Recently we have also found that UNA-modification of the AS seed region can reduce off-target effects (Bramsen et al., in prep.). . . We find that single UNA modifications are well tolerated at most tested positions in the AS and SS; However, additional UNA-modifications, especially in the AS, lead to reduced silencing efficiency (Fig. 1A–C) likely by destabilizing the siRNA duplex or interactions with the target mRNA. . . Notably, introduction of UNA into the stem of extensively modified siRNA did not dramatically reduce serum stability in contrast to siRNAs modified exclusively with UNA (Fig. 4B). Thus, UNA can be used to improve the KD efficiency of heavily modified siRNA without necessarily hampering the stability of the duplex.”, (p. 269, col 1 para 1, to col 2 para 1, to page 870, col 1, para 1).
Accordingly, it would have been obvious to one of ordinary skill before the effective filing date of the claimed invention to substitute both SEQ ID NO: 49 and 50 of 833 with SEQ ID NOs: 205 and 206 of Mendez et al, to yield a compound containing SEQ ID NOs: 205 and 206 which contain 2’-O-ME, 2’F, and phosphorothioate modifications at specific positions. SEQ ID NO: 205 of Mendez et al and SEQ ID NO: 49 of 833 are the same base sequence. SEQ ID NO: 50 of 833 and SEQ ID NO: 206 of Mendez et al are the same base sequence. Both SEQ ID NOs: 205 and 206 of Mendez et al and SEQ ID NOs: 49 and 50 of 833 were known in the art before the effective filing date of the claimed invention. One of skill in the art could look SEQ ID NOs: 49 and 50 of 833 and SEQ ID NOs: 205 and 206 of Mendez et al and arrive at instant SEQ ID NO: 1 and SEQ ID NOs: 2-8 (without the UNA) with a high likelihood of success.
Further, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify SEQ ID NO: 206 of Mendez et al, with the teachings of Laursen et al, i.e., adding one UNA, to yield the predictable results of a “heavily” modified antisense strand with one unlocked nucleic acid in the stem-portion of the siRNA. One skill could look to the teaches of Mendez et al: (1) Mendez et al teaches an siRNA, i.e., SEQ ID NO: 206 that contains phosphorothioate linkages, 2’O-methy, and 2’F modifications; and (2) Mendez et al teaches that in certain embodiments, the siRNA may comprise one or more modified ribonucleotides and/or one or more backbone modifications (e.g., one or more ribonucleotides with a 2 -0- methyl modification, one or more UNA moieties, one or more 2'-Fluoro nucleotides, and/or one or more phosphorothioate linkers). With Mendez et al teaching modified siRNA sequences and that these siRNA comprise one or more UNA moieties, one would then be motivated to look to the teachings of the art for the optimal placement of one or more UNA. One of skill could find Laursen et al teaching that (1) low levels of UNA modifications in siRNAs are compatible with efficient RNAi whereas more extensive UNA modification lowers siRNA efficiency and serum stability; (2) not to incorporate more than two UNA modifications in total within the base-paring siRNA stem; and (3) single UNA modifications are well tolerated at most tested positions in the AS and SS. Thus, Laursen suggests one UNA modification, and not more than two UNA modifications with the base-pairing stem region. One of skill would be motivated to modify SEQ ID NO: 206 of Mendez et al with the teachings of Laursen et al because Lausen et al teaches (1) lightly UNA-modified siRNA has prolonged biostability in vivo and produces efficient gene knockdown; (2) incorporation of UNA monomers into siRNAs induces additive instability by 5–8 oC per UNA monomer thereby providing a unique possibility to locally destabilize the siRNA duplex for example strong destabilizing property of UNA can be strategically used both in the SS and AS to significantly improve the potency of extensively modified siRNAs that are otherwise too stable or rigid to support RNAi; (3) insertion of UNA into the stem of very extensively modified siRNA such as OMe/F/UNA-modified and LNA-modified duplexes did not significantly reduce serum stability; and (4) UNA-modification of the AS seed region can reduce off-target effects.
Therefore, it would have been obvious to try to one of skill in the art before the effective filing date of the claimed invention to systematically add one UNA (taught by Laursen et al) to SEQ ID NO: 206 of Mendez et al for routine optimization to arrive at the claimed siRNA 2-7, and more specifically, SEQ ID NOs: 3-8 (seed region underlined in the below alignment).
S Strand 5’ – gugcacuucgcuucaca – 3’ (SEQ ID NO: 1)
AS Strand 3’ – uggcacacgugaagcgaagugu – 5’ (SEQ ID NO: 2-8)
One would have been motivated to do so because Laursen et al teaches all of the above motivations, but specifically, that UNA-modification of the AS seed region can reduce off-target effects. Thus, there are only 17 possible locations for a single UNA monomer to be incorporated. One of skill could have looked to the teachings of both Mendez et al and Laursen et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim(s) 160, 162-171, and 173 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over U.S. Patent No. US 12,043,833 B2 in view of Mendez et al (supra) in further view of Laursen et al (surpa).
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./ Examiner, Art Unit 1637
/Jennifer Dunston/ Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights