Prosecution Insights
Last updated: September 17, 2026
Application No. 18/035,797

CRUCIAN CARP (CARASSIUS AURATUS) STRAIN WITHOUT INTERMUSCULAR BONES AND BREEDING METHOD THEREOF

Final Rejection §112
Filed
May 08, 2023
Priority
Apr 30, 2021 — CN 202110478410.7 +1 more
Examiner
WILSON, MICHAEL C
Art Unit
1638
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Heilongjiang River Fisheries Research Institute Of Chinese Academy Of Fishery Sciences
OA Round
2 (Final)
42%
Grant Probability
Moderate
3-4
OA Rounds
4m
Est. Remaining
59%
With Interview

Examiner Intelligence

Grants 42% of resolved cases
42%
Career Allowance Rate
389 granted / 937 resolved
-18.5% vs TC avg
Strong +18% interview lift
Without
With
+17.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
60 currently pending
Career history
1007
Total Applications
across all art units

Statute-Specific Performance

§101
4.4%
-35.6% vs TC avg
§103
29.6%
-10.4% vs TC avg
§102
15.8%
-24.2% vs TC avg
§112
39.2%
-0.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 937 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 8-11 have been canceled. Claims 1-7 remain pending. Applicant's arguments filed 4-15-26 have been fully considered but they are not persuasive. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Election/Restrictions Applicants elected Group I, claim 1-7, without traverse in the reply filed on 11-24-25. Claims 1-7 remain under consideration. Claim interpretations/objections Carassius auratus (goldfish) have two copies of a BMP6 gene because of a genome duplication event (Chen, Science Advances, 2019, Vol. 5, pg 1-12); they are called BMP6A and BMP6B. Each gene is made up of two alleles. The term “sgRNA” in claim 1 should be spelled out before being abbreviated, i.e. ---single-stranded guide RNA (sgRNA)---. It is unclear whether two sgRNAs are made in claim 1 – one for BMP6A and one for BMP6B - of if one sgRNA is made that targets both BMP6A and BMP6B. The phrase “to obtain a mixture”, “to perform…”, “to construct…” throughout claim 1 are intended uses and do not bear patentable weight because they do not necessarily have to occur. If applicants believe steps a)-c) add to the inventive concept because of how the sgRNAs were designs or where the sgRNAs target within the BMP6, then perhaps they are relevant (especially if the sgRNA must target certain specific within a BMP6 gene to obtain fish without intramuscular bones). Otherwise, these steps appear to be extraneous, and the active steps of claim 1 can be set forth more succinctly. The preamble can be written more clearly and should be the same as the last line of the body of the claim, e.g. ---A method of making a goldfish without intramuscular bone, the method comprising:---. The first essential step for performing the method can be written more clearly and appears to be ---microinjecting a single cell goldfish embryo with sgRNA that targets an endogenous BMP6A gene, and Cas9--- (currently step d)). Step d) never results obtaining fish from the microinjected embryos. The step is missing an incubation step after microinjection or obtaining Carassius auratus F0 from the microinjection. Step d) never results in Carassius auratus whose genome comprises a genetic modification. It is unclear whether the “F0 generation population” in step d) are the injected embryos of whether they are fish. The meaning of passive integrated transponder in claim 1 cannot be determined. The mutations sought after in the sequencing and selecting in steps h) and i) of claim 1 cannot be determined. It is unclear how any Carassius auratus with a mutation “rate of more than 95%” correlates to a lack of intramuscular bones as required at the end of claim 1. The meaning of “0-generation fertilized eggs” in step i) and k) of claim 1 cannot be determined. Claim 1 can be written more clearly and succinctly as ---A method of making a Carassius auratus that lacks intramuscular bones, the method comprising: a) injecting a mixture of a single strand RNA (sgRNA) that binds a Carassius auratus bone morphogenic protein 6A (BMP6A), an sgRNA that binds a Carassius auratus bone morphogenic protein 6B (BMP6B), and Cas9 into a Carassius auratus zygote;… …and ?) obtaining a Carassius auratus that lacks intramuscular bone and whose genome comprises inactivated BMP6A and BMP6B genes---. Claim 2 can be written more clearly as ---wherein the sgRNA that binds BMP6A has the nucleic acid sequence of SEQ ID NO: 1, 2, 3, 4, 5, or 6 and the sgRNA that binds BMP6B has the nucleic acid sequence of SEQ ID NO: 7, 8, 9, 10, 11, or 12---. It is unclear how the sgRNA primers in claim 3, 4 correlate to the sgRNA in claim 1 or 2. “Microinjection” in claim 5 “is” not mixing, incubating, and adding phenol red, so the claim does not make sense. Claim 6 can be written more clearly ---wherein the sgRNA has a concentration of 100-160 ng/μl---. Claim 7 can be written more clearly ---wherein the sgRNA has a concentration of 800-3000 ng/μl---. These suggestions are not meant to be allowable. They are merely suggestions to facilitate prosecution. Claim Rejections - 35 USC § 112 Written Description Claims 1-7 remain rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. A) Claim 1 lacks written description. The claim is drawn to a method for breeding Carassius auratus strains without intermuscular bones, wherein the breeding of the Carassius auratus strains with intermuscular bone-deficient according to following steps: a) identifying target sites for sgRNA within two copies of bmp6 gene in the Carassius auraus genome, b) synthesizing sgRNAs targeting the two copies of bmp6 gene in the Carassius auratus genome. respectively, the two copies of bmp6 gene are bmp6a and bin6b, c) mixing sgRNAs corresponding to bmp6a, bmp6b or a combination of bmp6a and bmp6b with Cas9 protein to obtain a mixture; d) and microinjecting the mixture obtained in step c) into Carassius auratus embryos in the single cell stage, to perform a first round of gene knockout to construct a FO generation population, e) culturing the FO generation population for 3 to 5 months; f) labeling with passive integrated transponder (PIT); g) extracting DNA from the F0 generation population; h) then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, i) selecting F0 generation individuals with a somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs; j) mixing the sgRNAs corresponding to bmp6a, bmp6b, or a combination of bmp6a and bmp6b with Cas9 protein; k) microinjecting the mixture obtained in step j) into the 0-generation fertilized eggs to perform a second round of gene knockout to construct a F 1 generation population, l) culturing the F 1 generation population for 3 to 5 months; m) labeling with PIT; n) extracting DNA from the F1 generation population; o) then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus; p) selecting F1 generation individuals from a somatic bmp6a and bmp6b double gene mutant line with a somatic mutation rate of more than 95% as parents for reproduction to construct F2 generation; q) then selecting F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation to form a new Carassus auratus strain without intermuscular bones. Carassius auratus (goldfish) have two copies of a BMP6 gene because of a genome duplication event (Chen, Science Advances, 2019, Vol. 5, pg 1-12); they are called BMP6A and BMP6B. Each gene is made up of two alleles. Para 49-50 describes mixing sgRNAs with Cas9 and microinjecting it into goldfish zygotes, the specification does not teach the structure of any target sites within goldfish BMP6A and BMP6B genes. Claim 2 describes sgRNAs that target goldfish BMP6A (SEQ ID NO: 1-6) and BMP6B (SEQ ID NO: 7-11) genes. It is unclear whether two sgRNAs are required to target the BMP6A and BMP6B genes – one for BMP6A and one for BMP6B - of if one sgRNA is made that targets both BMP6A and BMP6B. It is unclear whether the sgRNA must target mutation sites within BMP6A and BMP6B genes or if they can target anywhere in wild-type BMP6A and BMP6B genes. It is unclear whether two sgRNAs for each gene are used in order to achieve a lack of intramuscular bone. It is unclear whether both genes have to be inactivated or if they are merely mutated to obtain a lack of intramuscular bone. It is unclear whether a lack of intramuscular bone can be obtained by mutating only one of the two genes. The specification fails to teach the combination of target site/sgRNAs that bind goldfish BMP6A and BMP6B genes that are required to creating a goldfish without intramuscular bones. Accordingly, claim 1 lacks written description. The meaning of sgRNAs “corresponding” to bmp6a, bmp6b, or a combination thereof cannot be determined. It is unclear whether bmp6a and bmp6b ARE sgRNAs or not. If it unclear why there are [possibly] two sgRNAs made step c) while step d) encompasses using only one sgRNA. Step d) never requires obtaining offspring from the embryos, that the offspring are genetically modified, or set forth the structure/function of the genetic modification. The meaning of passive integrated transponder is not disclosed in the art or the specification. It is unclear whether the F0 generation population in step g) are embryos or if they are offspring obtained from the embryos. The meaning of sequencing to determine alleles and mutation rates of somatic mutations” in step h) cannot be determined. The meaning of “individuals with a somatic mutation rate of more than 95%” in step i) cannot be determined. The meaning of “prepar[ing] 0-generatin fertilization eggs” in step i) cannot be determined. See indefiniteness rejection. Claim 2 lacks written description. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear whether applicants are attempting to say any of the “sgRNAs Number” may be chosen in claim 2 or whether applicants are attempting to limit the claim to choosing one “sgRNAs Number” from “BMP6a” and one “sgRNAs Number” from “BMP6b” (i.e. two sgRNAs that bind two different target sites of a BMP6 gene). Claim 3 lacks written description because “sgRNA forward primers” mixes technology. sgRNA is used for CRISPR technology; forward primers are used with reverse primers for PCR. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear how the SEQ ID NO: 12-22 can further limit the structures/functions of “sgRNAs Numbers” SEQ ID NO: 1-11 in claim 2. It is unclear whether claim 3 is attempting to further limit the structure of the sgRNA or some other feature of claim, i.e. PCR primers used to identify whether the desired genetic modification occurred. The meaning of “wherein using a sgRNA forward primer and a sgRNA reverse primer with the sequence of 5'- GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTA ACTTGCTATTTCTAGCTCTAAAAC-3' (SEQ ID NO:31) to synthesis sgRNA in vitro; a sgRNA synthesis and amplification volume is: 2.5 pL of 10 pM sgRNA forward and reverse primers, 25 pL of 2xDream Taq Master mix, and supplementing the sgRNA synthesis andamplification volume to 50 pL with enzyme-free water; sgRNA synthesis procedure in vitro is: denaturation at 95°C for 3 min; then 30 cycles of 95°C for 30s, 58°C for 30s and 72°C for 30s, extension at 72°C for 5min;after synthesizing the sgRNA in vitro, purifying and recovering an obtained sgRNA PCR product, then using an RNA in vitro transcription kit to transcribe the sgRNA in vitro;establishing a 30 pL reaction volume for sgRNA in vitro transcription for each target site: 1 pg of sgRNA PCR recovered product, 10 pL of NTP Buffer Mix, and 2pL of T7 RNA Polymerase Mix, supplementing the sgRNA in vitro transcription reaction volume to 30 pL with enzyme-free water; transcribing at 37°C for 4h, adding 20pL of enzyme-free water after the reaction, mixing well, adding 2pL DNase I, digesting at 37°C for 15min to remove DNA” in claim 4 cannot be determined. The specification and the art at the time of filing do not teach using forward primers (SEQ ID NO: 12-22) and a reverse primer (SEQ ID NO: 31) to make sgRNA as claimed. This step appears to relate to a PCR process rather than a sgRNA synthesis as claimed. Moreover, the overall steps, reagents, and results for each step cannot be determined. The final product at the end of claim 4 cannot be determined, and it is unclear how it relates to the sgRNA obtained in claim 3, 2, or 1. The meaning of “mixing the sgRNA synthesized in vitro and Cas9 protein in a molar concentration ratio of 3:1, then incubating at room temperature for 10 minutes, adding 25% phenol red and injecting the obtained product into Carassius auratus embryos in a single cell stage; wherein, mixing target site sgRNAs on each exon in equal amounts before injection, and a final concentration of each sgRNA is no less than 5Ong/pL, an injection volume of each fertilized egg is 1 nL+0.02 nL” in claim 5 cannot be determined, and it is unclear how it further limits the microinjection in claim 1 used to obtain the F0 generation or the microinjection in claim 2 used to obtain the F1 generation. The meaning of “recovery concentration of the sgRNA PCR product” in claim 6 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “sgRNA PCR product” differs from the “recovery concentration of the transcribed sgRNA” in claim 7. Therefore, the concept lacks written description. The meaning of “recovery concentration of the transcribed sgRNA” in claim 7 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “recovery concentration of the transcribed sgRNA” in claim 7 differs from the “sgRNA PCR product” in claim 6. Therefore, the concept lacks written description. Response to arguments Applicants argue the fish have “undergone a fourth round of genome duplication even, which results in the presence of two or more homologous copies (paralogous copies) of a large number of genes in its genome. Applicants’ argument is persuasive. Applicants point to para 49-50. Applicants’ argument is not persuasive for reasons set forth above. Enablement Claims 1-7 remain rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. Claim 1 and its scope are discussed above. The state of the art is discussed on pg 1-3. Carassius auratus (goldfish) have two copies of a BMP6 gene because of a genome duplication event (Chen, Science Advances, 2019, Vol. 5, pg 1-12); they are called BMP6A and BMP6B. Each gene is made up of two alleles. Para 49-50 describes mixing sgRNAs with Cas9 and microinjecting it into goldfish zygotes, the specification does not teach the structure of any target sites within goldfish BMP6A and BMP6B genes. Claim 2 describes sgRNAs that target goldfish BMP6A (SEQ ID NO: 1-6) and BMP6B (SEQ ID NO: 7-11) genes. It is unclear whether two sgRNAs are required to target the BMP6A and BMP6B genes – one for BMP6A and one for BMP6B - of if one sgRNA is made that targets both BMP6A and BMP6B. It is unclear whether the sgRNA must target mutation sites within BMP6A and BMP6B genes or if they can target anywhere in wild-type BMP6A and BMP6B genes. It is unclear whether two sgRNAs for each gene are used in order to achieve a lack of intramuscular bone. It is unclear whether both genes have to be inactivated or if they are merely mutated to obtain a lack of intramuscular bone. It is unclear whether a lack of intramuscular bone can be obtained by mutating only one of the two genes. The specification fails to teach the combination of target site/sgRNAs that bind goldfish BMP6A and BMP6B genes that are required to creating a goldfish without intramuscular bones. Accordingly, claim 1 lacks written description. The meaning of “mixing the sgRNAs corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into the 0-generation fertilized eggs to perform a second round of gene knockout to construct a F 1 generation population, culturing the F 1 generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting F1 generation individuals from a somatic bmp6a and bmp6b double gene mutant line with a somatic mutation rate of more than 95% as parents for reproduction to construct F2 generation, then selecting F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation” in claim 1 cannot be determined. It is unclear why a second round of CRISPR microinjection is done on F0 generation fertilized eggs when they already have the desired genetic modification. This is not supported in the examples which are limited to performing the gRNA/Cas9 microinjections once to obtain the F0 generation (pg 12, para 49). The steps required for microinjection are unclear for reasons set forth in the paragraph above. The structure and phenotype of the genetic modification obtained in the F1 or F2 generations is missing from the example. Claim 2 is not enabled because the specification does not teach whether “BMP6a” and “BMP6b” are isoforms of the BMP6 gene or whether they are generic terms for two different BMP6 gene target sites. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear whether applicants are attempting to say any of the “sgRNAs Number” may be chosen in claim 2 or whether applicants are attempting to limit the claim to choosing one “sgRNAs Number” from “BMP6a” and one “sgRNAs Number” from “BMP6b” (i.e. two sgRNAs that bind two different target sites of a BMP6 gene). Claim 3 is not enabled because “sgRNA forward primers” mixes technology. sgRNA is used for CRISPR technology; forward primers are used with reverse primers for PCR. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear how the SEQ ID NO: 12-22 can further limit the structures/functions of “sgRNAs Numbers” SEQ ID NO: 1-11 in claim 2. It is unclear whether claim 3 is attempting to further limit the structure of the sgRNA or some other feature of claim, i.e. PCR primers used to identify whether the desired genetic modification occurred. The meaning of “wherein using a sgRNA forward primer and a sgRNA reverse primer with the sequence of 5'- GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTA ACTTGCTATTTCTAGCTCTAAAAC-3' (SEQ ID NO:31) to synthesis sgRNA in vitro; a sgRNA synthesis and amplification volume is: 2.5 pL of 10 pM sgRNA forward and reverse primers, 25 pL of 2xDream Taq Master mix, and supplementing the sgRNA synthesis andamplification volume to 50 pL with enzyme-free water; sgRNA synthesis procedure in vitro is: denaturation at 95°C for 3 min; then 30 cycles of 95°C for 30s, 58°C for 30s and 72°C for 30s, extension at 72°C for 5min;after synthesizing the sgRNA in vitro, purifying and recovering an obtained sgRNA PCR product, then using an RNA in vitro transcription kit to transcribe the sgRNA in vitro;establishing a 30 pL reaction volume for sgRNA in vitro transcription for each target site: 1 pg of sgRNA PCR recovered product, 10 pL of NTP Buffer Mix, and 2pL of T7 RNA Polymerase Mix, supplementing the sgRNA in vitro transcription reaction volume to 30 pL with enzyme-free water; transcribing at 37°C for 4h, adding 20pL of enzyme-free water after the reaction, mixing well, adding 2pL DNase I, digesting at 37°C for 15min to remove DNA” in claim 4 cannot be determined. The specification and the art at the time of filing do not teach using forward primers (SEQ ID NO: 12-22) and a reverse primer (SEQ ID NO: 31) to make sgRNA as claimed. This step appears to relate to a PCR process rather than a sgRNA synthesis as claimed. Moreover, the overall steps, reagents, and results for each step cannot be determined. The final product at the end of claim 4 cannot be determined, and it is unclear how it relates to the sgRNA obtained in claim 3, 2, or 1. The meaning of “mixing the sgRNA synthesized in vitro and Cas9 protein in a molar concentration ratio of 3:1, then incubating at room temperature for 10 minutes, adding 25% phenol red and injecting the obtained product into Carassius auratus embryos in a single cell stage; wherein, mixing target site sgRNAs on each exon in equal amounts before injection, and a final concentration of each sgRNA is no less than 5Ong/pL, an injection volume of each fertilized egg is 1 nL+0.02 nL” in claim 5 cannot be determined, and it is unclear how it further limits the microinjection in claim 1 used to obtain the F0 generation or the microinjection in claim 2 used to obtain the F1 generation. The meaning of “recovery concentration of the sgRNA PCR product” in claim 6 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “sgRNA PCR product” differs from the “recovery concentration of the transcribed sgRNA” in claim 7. The meaning of “recovery concentration of the transcribed sgRNA” in claim 7 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “recovery concentration of the transcribed sgRNA” in claim 7 differs from the “sgRNA PCR product” in claim 6. Given the lack of guidance in the specification taken with the art at the time of filing, it would have required those of skill undue experimentation to determine how to perform the method of claims 1-7. Response to arguments Applicants argue the fish have “undergone a fourth round of genome duplication even, which results in the presence of two or more homologous copies (paralogous copies) of a large number of genes in its genome. Applicants’ argument is persuasive. Applicants point to para 49-50. Applicants’ argument is not persuasive for reasons set forth above. Indefiniteness Claims 1-7 remain rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The meaning of “designing knockout target sites for two copies of bmp6 gene in the Carassius auratusn genome, bmp6a and bmp6b, respectively, and then obtaining F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation through two rounds of gene knockout and screening, and then using the F2 generation individuals from the homozygous line with bmp6a and bmp6b double gene mutation to propagate to form a new Carassius auratus strain without intermuscular bones” in claim 1 cannot be determined. There are not two copies of a BMP6 gene. As written, the active step is “designing knockout target sites” for a BMP6 gene; however, it is actually conflating two steps: ---a) identifying--- target sites for gRNA within a Carassius auratus BMP6 gene; and b) designing gRNA that bind two different target sites within the Carassius auratus BMP6 gene. While there are two alleles within the BMP6 gene, there is only one copy of the gene. The meaning of BMP6a and BMP6b cannot be determined. It is unclear whether they refer to BMP6 splice isoforms or if they refer to two different target sequences within the BMP6 gene that are generically referred to as BMP6a and BMP6b. If they are BMP6 splice isoforms, then the metes and bounds of BMP6a and BMP6b isoforms cannot be determined because they are not disclosed in the specification or the art at the time of filing. This section goes on to say “obtaining F2 generation” without doing anything the information gathered after designing gRNAs that bind two different target sequences in a Carassius auratus BMP6 gene. The phrase skips introducing the gRNAs into Carassius auratus cells, genetically modifying the BMP6 gene, obtaining a F0 genetically modified Carassius auratus whose germline genome comprises an inactivated BMP6 gene, and obtaining F1 genetically modified Carassius auratus whose genome comprises an inactivated BMP6 gene. Next, the structure and function of a “BMP6a and BMP6b double gene mutation” cannot be determined. It is unclear whether two mutations occur at two different places within the BMP6 gene or if a deletion from target site BMP6a to target site BMP6b. Next, it appears that multiple active steps are packed within this section, but each step should be delineated with ---a)---, ---b)---, ---c)---,… for ease of examination. The meaning of “wherein, mixing a sgRNA corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into Carassius auratus embryos in the single cell stage, to perform a first round of gene knockout to construct a FO generation population, culturing the FO generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting FO generation individuals with a somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs” in claim 1 cannot be determined. The meaning of BMP6a and BMP6b cannot be determined for reasons set forth above. Next, it appears that multiple active steps are packed within this section, but each step should be delineated with ---d)---, ---e)---, ---f)---… (as appropriate) for ease of examination. Next, use of parentheses makes the claim indefinite because it is unclear whether “(BMP6a), (BMP6b), or (BMP6a or BMP6b)” are part of the claim or optional. Next, the step of “microinjection a mixture obtained” does not clearly set forth microinjecting sgRNA and Cas9 into single cell Carassius auratus embryos; it encompasses injecting any “mixture obtained”. The step of obtaining an F0 generation in this section should come before obtaining F1 or F2 generations. The structure and phenotype of the F0 generation is missing. The meaning of PIT labeling cannot be determined. The active steps of “sequencing” and “determining alleles and mutation rates” and “selecting F0 generation with a somatic mutation rate of more than 95%” does not clearly set forth the structure or phenotype of the F0 generation obtained. The meaning of “somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs” cannot be determined, and it is unclear how it relates to obtaining the F0 generation. It is unclear how the phrase modifies anything that has been said already in this section. The meaning of “mixing the sgRNAs corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into the 0-generation fertilized eggs to perform a second round of gene knockout to construct a F 1 generation population, culturing the F 1 generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting F1 generation individuals from a somatic bmp6a and bmp6b double gene mutant line with a somatic mutation rate of more than 95% as parents for reproduction to construct F2 generation, then selecting F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation” in claim 1 cannot be determined. It is unclear why a second round of CRISPR microinjection is done on F0 generation fertilized eggs when they already have the desired genetic modification. This is not supported in the examples which are limited to performing the gRNA/Cas9 microinjections once to obtain the F0 generation (pg 12, para 49). The steps required for microinjection are unclear for reasons set forth in the paragraph above. The structure and phenotype of the genetic modification obtained in the F1 or F2 generations is missing from the example. Claim 2 is indefinite because it is unclear whether “BMP6a” and “BMP6b” are isoforms of the BMP6 gene or whether they are generic terms for two different BMP6 gene target sites. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear whether applicants are attempting to say any of the “sgRNAs Number” may be chosen in claim 2 or whether applicants are attempting to limit the claim to choosing one “sgRNAs Number” from “BMP6a” and one “sgRNAs Number” from “BMP6b” (i.e. two sgRNAs that bind two different target sites of a BMP6 gene). Claim 3 is indefinite because “sgRNA forward primers” mixes technology. sgRNA is used for CRISPR technology; forward primers are used with reverse primers for PCR. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear how the SEQ ID NO: 12-22 can further limit the structures/functions of “sgRNAs Numbers” SEQ ID NO: 1-11 in claim 2. It is unclear whether claim 3 is attempting to further limit the structure of the sgRNA or some other feature of claim, i.e. PCR primers used to identify whether the desired genetic modification occurred. The meaning of “wherein using a sgRNA forward primer and a sgRNA reverse primer with the sequence of 5'- GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTA ACTTGCTATTTCTAGCTCTAAAAC-3' (SEQ ID NO:31) to synthesis sgRNA in vitro; a sgRNA synthesis and amplification volume is: 2.5 pL of 10 pM sgRNA forward and reverse primers, 25 pL of 2xDream Taq Master mix, and supplementing the sgRNA synthesis andamplification volume to 50 pL with enzyme-free water; sgRNA synthesis procedure in vitro is: denaturation at 95°C for 3 min; then 30 cycles of 95°C for 30s, 58°C for 30s and 72°C for 30s, extension at 72°C for 5min;after synthesizing the sgRNA in vitro, purifying and recovering an obtained sgRNA PCR product, then using an RNA in vitro transcription kit to transcribe the sgRNA in vitro;establishing a 30 pL reaction volume for sgRNA in vitro transcription for each target site: 1 pg of sgRNA PCR recovered product, 10 pL of NTP Buffer Mix, and 2pL of T7 RNA Polymerase Mix, supplementing the sgRNA in vitro transcription reaction volume to 30 pL with enzyme-free water; transcribing at 37°C for 4h, adding 20pL of enzyme-free water after the reaction, mixing well, adding 2pL DNase I, digesting at 37°C for 15min to remove DNA” in claim 4 cannot be determined. The specification and the art at the time of filing do not teach using forward primers (SEQ ID NO: 12-22) and a reverse primer (SEQ ID NO: 31) to make sgRNA as claimed. This step appears to relate to a PCR process rather than a sgRNA synthesis as claimed. Moreover, the overall steps, reagents, and results for each step cannot be determined. The final product at the end of claim 4 cannot be determined, and it is unclear how it relates to the sgRNA obtained in claim 3, 2, or 1. The meaning of “mixing the sgRNA synthesized in vitro and Cas9 protein in a molar concentration ratio of 3:1, then incubating at room temperature for 10 minutes, adding 25% phenol red and injecting the obtained product into Carassius auratus embryos in a single cell stage; wherein, mixing target site sgRNAs on each exon in equal amounts before injection, and a final concentration of each sgRNA is no less than 5Ong/pL, an injection volume of each fertilized egg is 1 nL+0.02 nL” in claim 5 cannot be determined, and it is unclear how it further limits the microinjection in claim 1 used to obtain the F0 generation or the microinjection in claim 2 used to obtain the F1 generation. The meaning of “recovery concentration of the sgRNA PCR product” in claim 6 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “sgRNA PCR product” differs from the “recovery concentration of the transcribed sgRNA” in claim 7. The meaning of “recovery concentration of the transcribed sgRNA” in claim 7 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “recovery concentration of the transcribed sgRNA” in claim 7 differs from the “sgRNA PCR product” in claim 6. The art at the time of filing did not reasonably teach or suggest the method of claim 1. Conclusion The prior art made of record and not relied upon is considered pertinent to applicant's disclosure: CN 110684777 described introducing gRNA/Cas9 into zebrafish embryos to obtain genetically modified zebrafish with reduced intermuscular bones. It teaches using SEQ ID NO: 1 and 2 for mutant genes but does not teach the name of the gene, the target sequences within the gene, or the structure of the gRNAs used to bind those target sequences. It may be the SCXA gene PNG media_image1.png 272 794 media_image1.png Greyscale No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Inquiry concerning this communication or earlier communications from the examiner should be directed to Michael C. Wilson who can normally be reached at the office on Monday through Friday from 9:30 am to 6:00 pm at 571-272-0738. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199. If attempts to reach the examiner are unsuccessful, the examiner's supervisor, Tracy Vivlemore, can be reached on 571-272-2914. The official fax number for this Group is (571) 273-8300. Michael C. Wilson /MICHAEL C WILSON/ Primary Examiner, Art Unit 1638
Read full office action

Prosecution Timeline

May 08, 2023
Application Filed
Dec 16, 2025
Non-Final Rejection mailed — §112
Apr 15, 2026
Response Filed
Jul 01, 2026
Final Rejection mailed — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12677813
NON-HUMAN ANIMALS HAVING A HUMANIZED PROGRAMMED CELL DEATH 1 GENE
3y 2m to grant Granted Jul 14, 2026
Patent 12674177
AAV VECTORS FOR VASCULAR GENE THERAPY IN CORONARY HEART DISEASE AND PERIPHERAL ISCHEMIA
4y 2m to grant Granted Jul 07, 2026
Patent 12582105
GENETICALLY MODIFIED T CELL RECEPTOR MICE
5y 4m to grant Granted Mar 24, 2026
Patent 12577588
AAV CAPSIDS WITH INCREASED TROPISM TO BRAIN TISSUE
2y 4m to grant Granted Mar 17, 2026
Patent 12568940
TRANSGENIC CHICKEN HAVING AN ENDOGENOUS IMMUNOGLOBULIN HEAVY CHAIN GENE IN WHICH THE IGY CH1 CODING SEQUENCE IS FUNCTIONALLY DELETED
5y 3m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
42%
Grant Probability
59%
With Interview (+17.8%)
3y 8m (~4m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 937 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month