Prosecution Insights
Last updated: April 19, 2026
Application No. 18/035,797

CRUCIAN CARP (CARASSIUS AURATUS) STRAIN WITHOUT INTERMUSCULAR BONES AND BREEDING METHOD THEREOF

Non-Final OA §112
Filed
May 08, 2023
Examiner
WILSON, MICHAEL C
Art Unit
1638
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Heilongjiang River Fisheries Research Institute Of Chinese Academy Of Fishery Sciences
OA Round
1 (Non-Final)
42%
Grant Probability
Moderate
1-2
OA Rounds
3y 9m
To Grant
59%
With Interview

Examiner Intelligence

Grants 42% of resolved cases
42%
Career Allow Rate
384 granted / 921 resolved
-18.3% vs TC avg
Strong +18% interview lift
Without
With
+17.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
76 currently pending
Career history
997
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
25.3%
-14.7% vs TC avg
§102
20.7%
-19.3% vs TC avg
§112
36.5%
-3.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 921 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 1-11 are pending. Election/Restrictions Applicant’s election without traverse of Group I, claim 1-7, in the reply filed on 11-24-25 is acknowledged. Claims 8-11 have been withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11-24-25. Claims 1-7 are under consideration. Claim objections Please delineate the steps of claim 1 using ---a)---, ---b)---, ---c)---,… for ease of examination and discussion. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Written Description Claims 1-7 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 1 is drawn to A method for breeding Carassius auratus strains without intermuscular bones, wherein the breeding of the Carassius auratus strains with intermuscular bone-deficient according to following steps: designing knockout target sites for two copies of bmp6 gene in the Carassius auratusn genome, bmp6a and bmp6b, respectively, and then obtaining F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation through two rounds of gene knockout and screening, and then using the F2 generation individuals from the homozygous line with bmp6a and bmp6b double gene mutation to propagate to form a new Carassius auratus strain without intermuscular bones; wherein, mixing a sgRNA corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into Carassius auratus embryos in the single cell stage, to perform a first round of gene knockout to construct a FO generation population, culturing the FO generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting FO generation individuals with a somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs; mixing the sgRNAs corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into the 0-generation fertilized eggs to perform a second round of gene knockout to construct a F 1 generation population, culturing the F 1 generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting F1 generation individuals from a somatic bmp6a and bmp6b double gene mutant line with a somatic mutation rate of more than 95% as parents for reproduction to construct F2 generation, then selecting F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation. The meaning of “designing knockout target sites for two copies of bmp6 gene in the Carassius auratusn genome, bmp6a and bmp6b, respectively, and then obtaining F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation through two rounds of gene knockout and screening, and then using the F2 generation individuals from the homozygous line with bmp6a and bmp6b double gene mutation to propagate to form a new Carassius auratus strain without intermuscular bones” in claim 1 cannot be determined. There are a number of issues in this section. There are not two copies of a BMP6 gene. As written, the active step is “designing knockout target sites” for a BMP6 gene; however, it is actually conflating two steps: ---a) identifying--- target sites for gRNA within a Carassius auratus BMP6 gene; and b) designing gRNA that bind two different target sites within the Carassius auratus BMP6 gene. While there are two alleles within the BMP6 gene, there is only one copy of the gene. The meaning of BMP6a and BMP6b cannot be determined. It is unclear whether they refer to BMP6 splice isoforms or if they refer to two different target sequences within the BMP6 gene that are generically referred to as BMP6a and BMP6b. If they are BMP6 splice isoforms, then the metes and bounds of BMP6a and BMP6b isoforms cannot be determined because they are not disclosed in the specification or the art at the time of filing. This section goes on to say “obtaining F2 generation” without doing anything with the information gathered after designing gRNAs that bind two different target sequences in a Carassius auratus BMP6 gene. The phrase skips introducing the gRNAs into Carassius auratus cells, genetically modifying the BMP6 gene, obtaining a F0 genetically modified Carassius auratus whose germline genome comprises an inactivated BMP6 gene, and obtaining F1 genetically modified Carassius auratus whose genome comprises an inactivated BMP6 gene. Next, the structure and function of a “BMP6a and BMP6b double gene mutation” cannot be determined. It is unclear whether two mutations occur at two different places within the BMP6 gene or if a deletion from target site BMP6a to target site BMP6b. Next, it appears that multiple active steps are packed within this section, but each step should be delineated with ---a)---, ---b)---, ---c)---,… for ease of examination. The meaning of “wherein, mixing a sgRNA corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into Carassius auratus embryos in the single cell stage, to perform a first round of gene knockout to construct a FO generation population, culturing the FO generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting FO generation individuals with a somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs” in claim 1 cannot be determined. The meaning of BMP6a and BMP6b cannot be determined for reasons set forth above. Next, it appears that multiple active steps are packed within this section, but each step should be delineated with ---d)---, ---e)---, ---f)---… (as appropriate) for ease of examination. Next, use of parentheses makes the claim indefinite because it is unclear whether “(BMP6a), (BMP6b), or (BMP6a or BMP6b)” are part of the claim or optional. Next, the step of “microinjection a mixture obtained” does not clearly set forth microinjecting sgRNA and Cas9 into single cell Carassius auratus embryos; it encompasses injecting any “mixture obtained”. The step of obtaining an F0 generation in this section should come before obtaining F1 or F2 generations. The structure and phenotype of the F0 generation is missing. The meaning of PIT labeling cannot be determined. The active steps of “sequencing” and “determining alleles and mutation rates” and “selecting F0 generation with a somatic mutation rate of more than 95%” does not clearly set forth the structure or phenotype of the F0 generation obtained. The meaning of “somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs” cannot be determined, and it is unclear how it relates to obtaining the F0 generation. It is unclear how the phrase modifies anything that has been said already in this section. The meaning of “mixing the sgRNAs corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into the 0-generation fertilized eggs to perform a second round of gene knockout to construct a F 1 generation population, culturing the F 1 generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting F1 generation individuals from a somatic bmp6a and bmp6b double gene mutant line with a somatic mutation rate of more than 95% as parents for reproduction to construct F2 generation, then selecting F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation” in claim 1 cannot be determined. It is unclear why a second round of CRISPR microinjection is done on F0 generation fertilized eggs when they already have the desired genetic modification. This is not supported in the examples which are limited to performing the gRNA/Cas9 microinjections once to obtain the F0 generation (pg 12, para 49). The steps required for microinjection are unclear for reasons set forth in the paragraph above. The structure and phenotype of the genetic modification obtained in the F1 or F2 generations is missing. The section packs multiple steps that should be delineated as needed using ---h)---, ---i)---,…. Claim 2 lacks written description because it is unclear whether “BMP6a” and “BMP6b” are isoforms of the BMP6 gene or whether they are generic terms for two different BMP6 gene target sites. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear whether applicants are attempting to say any of the “sgRNAs Number” may be chosen in claim 2 or whether applicants are attempting to limit the claim to choosing one “sgRNAs Number” from “BMP6a” and one “sgRNAs Number” from “BMP6b” (i.e. two sgRNAs that bind two different target sites of a BMP6 gene). Claim 3 lacks written description because “sgRNA forward primers” mixes technology. sgRNA is used for CRISPR technology; forward primers are used with reverse primers for PCR. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear how the SEQ ID NO: 12-22 can further limit the structures/functions of “sgRNAs Numbers” SEQ ID NO: 1-11 in claim 2. It is unclear whether claim 3 is attempting to further limit the structure of the sgRNA or some other feature of claim, i.e. PCR primers used to identify whether the desired genetic modification occurred. The meaning of “wherein using a sgRNA forward primer and a sgRNA reverse primer with the sequence of 5'- GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTA ACTTGCTATTTCTAGCTCTAAAAC-3' (SEQ ID NO:31) to synthesis sgRNA in vitro; a sgRNA synthesis and amplification volume is: 2.5 pL of 10 pM sgRNA forward and reverse primers, 25 pL of 2xDream Taq Master mix, and supplementing the sgRNA synthesis andamplification volume to 50 pL with enzyme-free water; sgRNA synthesis procedure in vitro is: denaturation at 95°C for 3 min; then 30 cycles of 95°C for 30s, 58°C for 30s and 72°C for 30s, extension at 72°C for 5min;after synthesizing the sgRNA in vitro, purifying and recovering an obtained sgRNA PCR product, then using an RNA in vitro transcription kit to transcribe the sgRNA in vitro;establishing a 30 pL reaction volume for sgRNA in vitro transcription for each target site: 1 pg of sgRNA PCR recovered product, 10 pL of NTP Buffer Mix, and 2pL of T7 RNA Polymerase Mix, supplementing the sgRNA in vitro transcription reaction volume to 30 pL with enzyme-free water; transcribing at 37°C for 4h, adding 20pL of enzyme-free water after the reaction, mixing well, adding 2pL DNase I, digesting at 37°C for 15min to remove DNA” in claim 4 cannot be determined. The specification and the art at the time of filing do not teach using forward primers (SEQ ID NO: 12-22) and a reverse primer (SEQ ID NO: 31) to make sgRNA as claimed. This step appears to relate to a PCR process rather than a sgRNA synthesis as claimed. Moreover, the overall steps, reagents, and results for each step cannot be determined. The final product at the end of claim 4 cannot be determined, and it is unclear how it relates to the sgRNA obtained in claim 3, 2, or 1. The meaning of “mixing the sgRNA synthesized in vitro and Cas9 protein in a molar concentration ratio of 3:1, then incubating at room temperature for 10 minutes, adding 25% phenol red and injecting the obtained product into Carassius auratus embryos in a single cell stage; wherein, mixing target site sgRNAs on each exon in equal amounts before injection, and a final concentration of each sgRNA is no less than 5Ong/pL, an injection volume of each fertilized egg is 1 nL+0.02 nL” in claim 5 cannot be determined, and it is unclear how it further limits the microinjection in claim 1 used to obtain the F0 generation or the microinjection in claim 2 used to obtain the F1 generation. The meaning of “recovery concentration of the sgRNA PCR product” in claim 6 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “sgRNA PCR product” differs from the “recovery concentration of the transcribed sgRNA” in claim 7. Therefore, the concept lacks written description. The meaning of “recovery concentration of the transcribed sgRNA” in claim 7 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “recovery concentration of the transcribed sgRNA” in claim 7 differs from the “sgRNA PCR product” in claim 6. Therefore, the concept lacks written description. Enablement Claims 1-7 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. Claim 1 and its scope are discussed above. The state of the art is discussed on pg 1-3. The example (pg 12, para 47-49) uses the same language as claim 1 to describe the invention. However, the meaning of “designing knockout target sites for two copies of bmp6 gene in the Carassius auratusn genome, bmp6a and bmp6b, respectively, and then obtaining F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation through two rounds of gene knockout and screening, and then using the F2 generation individuals from the homozygous line with bmp6a and bmp6b double gene mutation to propagate to form a new Carassius auratus strain without intermuscular bones” in claim 1 cannot be determined. There are a number of issues in this section. There are not two copies of a BMP6 gene. As written, the active step is “designing knockout target sites” for a BMP6 gene; however, it is actually conflating two steps: ---a) identifying--- target sites for gRNA within a Carassius auratus BMP6 gene; and b) designing gRNA that bind two different target sites within the Carassius auratus BMP6 gene. While there are two alleles within the BMP6 gene, there is only one copy of the gene. The meaning of BMP6a and BMP6b cannot be determined. It is unclear whether they refer to BMP6 splice isoforms or if they refer to two different target sequences within the BMP6 gene that are generically referred to as BMP6a and BMP6b. If they are BMP6 splice isoforms, then the metes and bounds of BMP6a and BMP6b isoforms cannot be determined because they are not disclosed in the specification or the art at the time of filing. This section goes on to say “obtaining F2 generation” without doing anything the information gathered after designing gRNAs that bind two different target sequences in a Carassius auratus BMP6 gene. The phrase skips introducing the gRNAs into Carassius auratus cells, genetically modifying the BMP6 gene, obtaining a F0 genetically modified Carassius auratus whose germline genome comprises an inactivated BMP6 gene, and obtaining F1 genetically modified Carassius auratus whose genome comprises an inactivated BMP6 gene. Next, the structure and function of a “BMP6a and BMP6b double gene mutation” cannot be determined. It is unclear whether two mutations occur at two different places within the BMP6 gene or if a deletion from target site BMP6a to target site BMP6b. Next, it appears that multiple active steps are packed within this section, but each step should be delineated with ---a)---, ---b)---, ---c)---,… for ease of examination. The meaning of “wherein, mixing a sgRNA corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into Carassius auratus embryos in the single cell stage, to perform a first round of gene knockout to construct a FO generation population, culturing the FO generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting FO generation individuals with a somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs” in claim 1 cannot be determined. The meaning of BMP6a and BMP6b cannot be determined for reasons set forth above. Next, it appears that multiple active steps are packed within this section, but each step should be delineated with ---d)---, ---e)---, ---f)---… (as appropriate) for ease of examination. Next, use of parentheses makes the claim indefinite because it is unclear whether “(BMP6a), (BMP6b), or (BMP6a or BMP6b)” are part of the claim or optional. Next, the step of “microinjection a mixture obtained” does not clearly set forth microinjecting sgRNA and Cas9 into single cell Carassius auratus embryos; it encompasses injecting any “mixture obtained”. The step of obtaining an F0 generation in this section should come before obtaining F1 or F2 generations. The structure and phenotype of the F0 generation is missing. The meaning of PIT labeling cannot be determined. The active steps of “sequencing” and “determining alleles and mutation rates” and “selecting F0 generation with a somatic mutation rate of more than 95%” does not clearly set forth the structure or phenotype of the F0 generation obtained. The meaning of “somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs” cannot be determined, and it is unclear how it relates to obtaining the F0 generation. It is unclear how the phrase modifies anything that has been said already in this section. The meaning of “mixing the sgRNAs corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into the 0-generation fertilized eggs to perform a second round of gene knockout to construct a F 1 generation population, culturing the F 1 generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting F1 generation individuals from a somatic bmp6a and bmp6b double gene mutant line with a somatic mutation rate of more than 95% as parents for reproduction to construct F2 generation, then selecting F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation” in claim 1 cannot be determined. It is unclear why a second round of CRISPR microinjection is done on F0 generation fertilized eggs when they already have the desired genetic modification. This is not supported in the examples which are limited to performing the gRNA/Cas9 microinjections once to obtain the F0 generation (pg 12, para 49). The steps required for microinjection are unclear for reasons set forth in the paragraph above. The structure and phenotype of the genetic modification obtained in the F1 or F2 generations is missing from the example. Claim 2 is not enabled because the specification does not teach whether “BMP6a” and “BMP6b” are isoforms of the BMP6 gene or whether they are generic terms for two different BMP6 gene target sites. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear whether applicants are attempting to say any of the “sgRNAs Number” may be chosen in claim 2 or whether applicants are attempting to limit the claim to choosing one “sgRNAs Number” from “BMP6a” and one “sgRNAs Number” from “BMP6b” (i.e. two sgRNAs that bind two different target sites of a BMP6 gene). Claim 3 is not enabled because “sgRNA forward primers” mixes technology. sgRNA is used for CRISPR technology; forward primers are used with reverse primers for PCR. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear how the SEQ ID NO: 12-22 can further limit the structures/functions of “sgRNAs Numbers” SEQ ID NO: 1-11 in claim 2. It is unclear whether claim 3 is attempting to further limit the structure of the sgRNA or some other feature of claim, i.e. PCR primers used to identify whether the desired genetic modification occurred. The meaning of “wherein using a sgRNA forward primer and a sgRNA reverse primer with the sequence of 5'- GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTA ACTTGCTATTTCTAGCTCTAAAAC-3' (SEQ ID NO:31) to synthesis sgRNA in vitro; a sgRNA synthesis and amplification volume is: 2.5 pL of 10 pM sgRNA forward and reverse primers, 25 pL of 2xDream Taq Master mix, and supplementing the sgRNA synthesis andamplification volume to 50 pL with enzyme-free water; sgRNA synthesis procedure in vitro is: denaturation at 95°C for 3 min; then 30 cycles of 95°C for 30s, 58°C for 30s and 72°C for 30s, extension at 72°C for 5min;after synthesizing the sgRNA in vitro, purifying and recovering an obtained sgRNA PCR product, then using an RNA in vitro transcription kit to transcribe the sgRNA in vitro;establishing a 30 pL reaction volume for sgRNA in vitro transcription for each target site: 1 pg of sgRNA PCR recovered product, 10 pL of NTP Buffer Mix, and 2pL of T7 RNA Polymerase Mix, supplementing the sgRNA in vitro transcription reaction volume to 30 pL with enzyme-free water; transcribing at 37°C for 4h, adding 20pL of enzyme-free water after the reaction, mixing well, adding 2pL DNase I, digesting at 37°C for 15min to remove DNA” in claim 4 cannot be determined. The specification and the art at the time of filing do not teach using forward primers (SEQ ID NO: 12-22) and a reverse primer (SEQ ID NO: 31) to make sgRNA as claimed. This step appears to relate to a PCR process rather than a sgRNA synthesis as claimed. Moreover, the overall steps, reagents, and results for each step cannot be determined. The final product at the end of claim 4 cannot be determined, and it is unclear how it relates to the sgRNA obtained in claim 3, 2, or 1. The meaning of “mixing the sgRNA synthesized in vitro and Cas9 protein in a molar concentration ratio of 3:1, then incubating at room temperature for 10 minutes, adding 25% phenol red and injecting the obtained product into Carassius auratus embryos in a single cell stage; wherein, mixing target site sgRNAs on each exon in equal amounts before injection, and a final concentration of each sgRNA is no less than 5Ong/pL, an injection volume of each fertilized egg is 1 nL+0.02 nL” in claim 5 cannot be determined, and it is unclear how it further limits the microinjection in claim 1 used to obtain the F0 generation or the microinjection in claim 2 used to obtain the F1 generation. The meaning of “recovery concentration of the sgRNA PCR product” in claim 6 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “sgRNA PCR product” differs from the “recovery concentration of the transcribed sgRNA” in claim 7. The meaning of “recovery concentration of the transcribed sgRNA” in claim 7 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “recovery concentration of the transcribed sgRNA” in claim 7 differs from the “sgRNA PCR product” in claim 6. Given the lack of guidance in the specification taken with the art at the time of filing, it would have required those of skill undue experimentation to determine how to perform the method of claims 1-7. Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-7 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The meaning of “designing knockout target sites for two copies of bmp6 gene in the Carassius auratusn genome, bmp6a and bmp6b, respectively, and then obtaining F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation through two rounds of gene knockout and screening, and then using the F2 generation individuals from the homozygous line with bmp6a and bmp6b double gene mutation to propagate to form a new Carassius auratus strain without intermuscular bones” in claim 1 cannot be determined. There are not two copies of a BMP6 gene. As written, the active step is “designing knockout target sites” for a BMP6 gene; however, it is actually conflating two steps: ---a) identifying--- target sites for gRNA within a Carassius auratus BMP6 gene; and b) designing gRNA that bind two different target sites within the Carassius auratus BMP6 gene. While there are two alleles within the BMP6 gene, there is only one copy of the gene. The meaning of BMP6a and BMP6b cannot be determined. It is unclear whether they refer to BMP6 splice isoforms or if they refer to two different target sequences within the BMP6 gene that are generically referred to as BMP6a and BMP6b. If they are BMP6 splice isoforms, then the metes and bounds of BMP6a and BMP6b isoforms cannot be determined because they are not disclosed in the specification or the art at the time of filing. This section goes on to say “obtaining F2 generation” without doing anything the information gathered after designing gRNAs that bind two different target sequences in a Carassius auratus BMP6 gene. The phrase skips introducing the gRNAs into Carassius auratus cells, genetically modifying the BMP6 gene, obtaining a F0 genetically modified Carassius auratus whose germline genome comprises an inactivated BMP6 gene, and obtaining F1 genetically modified Carassius auratus whose genome comprises an inactivated BMP6 gene. Next, the structure and function of a “BMP6a and BMP6b double gene mutation” cannot be determined. It is unclear whether two mutations occur at two different places within the BMP6 gene or if a deletion from target site BMP6a to target site BMP6b. Next, it appears that multiple active steps are packed within this section, but each step should be delineated with ---a)---, ---b)---, ---c)---,… for ease of examination. The meaning of “wherein, mixing a sgRNA corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into Carassius auratus embryos in the single cell stage, to perform a first round of gene knockout to construct a FO generation population, culturing the FO generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting FO generation individuals with a somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs” in claim 1 cannot be determined. The meaning of BMP6a and BMP6b cannot be determined for reasons set forth above. Next, it appears that multiple active steps are packed within this section, but each step should be delineated with ---d)---, ---e)---, ---f)---… (as appropriate) for ease of examination. Next, use of parentheses makes the claim indefinite because it is unclear whether “(BMP6a), (BMP6b), or (BMP6a or BMP6b)” are part of the claim or optional. Next, the step of “microinjection a mixture obtained” does not clearly set forth microinjecting sgRNA and Cas9 into single cell Carassius auratus embryos; it encompasses injecting any “mixture obtained”. The step of obtaining an F0 generation in this section should come before obtaining F1 or F2 generations. The structure and phenotype of the F0 generation is missing. The meaning of PIT labeling cannot be determined. The active steps of “sequencing” and “determining alleles and mutation rates” and “selecting F0 generation with a somatic mutation rate of more than 95%” does not clearly set forth the structure or phenotype of the F0 generation obtained. The meaning of “somatic mutation rate of more than 95% as parents to prepare 0-generation fertilized eggs” cannot be determined, and it is unclear how it relates to obtaining the F0 generation. It is unclear how the phrase modifies anything that has been said already in this section. The meaning of “mixing the sgRNAs corresponding to (bmp6a), (bmp6b) or (bmp6a and bmp6b) with Cas9 protein and microinjecting a mixture obtained into the 0-generation fertilized eggs to perform a second round of gene knockout to construct a F 1 generation population, culturing the F 1 generation population for 3 to 5 months followed by PIT labeling and DNA extraction, then sequencing to determine alleles and mutation rates of somatic mutations of Carassius auratus, selecting F1 generation individuals from a somatic bmp6a and bmp6b double gene mutant line with a somatic mutation rate of more than 95% as parents for reproduction to construct F2 generation, then selecting F2 generation individuals from a homozygous line with bmp6a and bmp6b double gene mutation” in claim 1 cannot be determined. It is unclear why a second round of CRISPR microinjection is done on F0 generation fertilized eggs when they already have the desired genetic modification. This is not supported in the examples which are limited to performing the gRNA/Cas9 microinjections once to obtain the F0 generation (pg 12, para 49). The steps required for microinjection are unclear for reasons set forth in the paragraph above. The structure and phenotype of the genetic modification obtained in the F1 or F2 generations is missing from the example. Claim 2 is indefinite because it is unclear whether “BMP6a” and “BMP6b” are isoforms of the BMP6 gene or whether they are generic terms for two different BMP6 gene target sites. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear whether applicants are attempting to say any of the “sgRNAs Number” may be chosen in claim 2 or whether applicants are attempting to limit the claim to choosing one “sgRNAs Number” from “BMP6a” and one “sgRNAs Number” from “BMP6b” (i.e. two sgRNAs that bind two different target sites of a BMP6 gene). Claim 3 is indefinite because “sgRNA forward primers” mixes technology. sgRNA is used for CRISPR technology; forward primers are used with reverse primers for PCR. The column labeled “sgRNAs Number” is a misnomer because they are target sites within the BMP6 gene; sgRNAs do not have the same nucleic acid sequence as the BMP6 gene target sites. It is unclear how the SEQ ID NO: 12-22 can further limit the structures/functions of “sgRNAs Numbers” SEQ ID NO: 1-11 in claim 2. It is unclear whether claim 3 is attempting to further limit the structure of the sgRNA or some other feature of claim, i.e. PCR primers used to identify whether the desired genetic modification occurred. The meaning of “wherein using a sgRNA forward primer and a sgRNA reverse primer with the sequence of 5'- GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTA ACTTGCTATTTCTAGCTCTAAAAC-3' (SEQ ID NO:31) to synthesis sgRNA in vitro; a sgRNA synthesis and amplification volume is: 2.5 pL of 10 pM sgRNA forward and reverse primers, 25 pL of 2xDream Taq Master mix, and supplementing the sgRNA synthesis andamplification volume to 50 pL with enzyme-free water; sgRNA synthesis procedure in vitro is: denaturation at 95°C for 3 min; then 30 cycles of 95°C for 30s, 58°C for 30s and 72°C for 30s, extension at 72°C for 5min;after synthesizing the sgRNA in vitro, purifying and recovering an obtained sgRNA PCR product, then using an RNA in vitro transcription kit to transcribe the sgRNA in vitro;establishing a 30 pL reaction volume for sgRNA in vitro transcription for each target site: 1 pg of sgRNA PCR recovered product, 10 pL of NTP Buffer Mix, and 2pL of T7 RNA Polymerase Mix, supplementing the sgRNA in vitro transcription reaction volume to 30 pL with enzyme-free water; transcribing at 37°C for 4h, adding 20pL of enzyme-free water after the reaction, mixing well, adding 2pL DNase I, digesting at 37°C for 15min to remove DNA” in claim 4 cannot be determined. The specification and the art at the time of filing do not teach using forward primers (SEQ ID NO: 12-22) and a reverse primer (SEQ ID NO: 31) to make sgRNA as claimed. This step appears to relate to a PCR process rather than a sgRNA synthesis as claimed. Moreover, the overall steps, reagents, and results for each step cannot be determined. The final product at the end of claim 4 cannot be determined, and it is unclear how it relates to the sgRNA obtained in claim 3, 2, or 1. The meaning of “mixing the sgRNA synthesized in vitro and Cas9 protein in a molar concentration ratio of 3:1, then incubating at room temperature for 10 minutes, adding 25% phenol red and injecting the obtained product into Carassius auratus embryos in a single cell stage; wherein, mixing target site sgRNAs on each exon in equal amounts before injection, and a final concentration of each sgRNA is no less than 5Ong/pL, an injection volume of each fertilized egg is 1 nL+0.02 nL” in claim 5 cannot be determined, and it is unclear how it further limits the microinjection in claim 1 used to obtain the F0 generation or the microinjection in claim 2 used to obtain the F1 generation. The meaning of “recovery concentration of the sgRNA PCR product” in claim 6 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “sgRNA PCR product” differs from the “recovery concentration of the transcribed sgRNA” in claim 7. The meaning of “recovery concentration of the transcribed sgRNA” in claim 7 cannot be determined. The specification does not define when a “concentration” of sgRNA is a “recovery” concentration. It is unclear how this further limits the sgRNA in claim 4, 3, 2, or 1. It is unclear how the “recovery concentration of the transcribed sgRNA” in claim 7 differs from the “sgRNA PCR product” in claim 6. The art at the time of filing did not reasonably teach or suggest the method of claim 1. Conclusion The prior art made of record and not relied upon is considered pertinent to applicant's disclosure: CN 110684777 described introducing gRNA/Cas9 into zebrafish embryos to obtain genetically modified zebrafish with reduced intermuscular bones. It teaches using SEQ ID NO: 1 and 2 for mutant genes but does not teach the name of the gene, the target sequences within the gene, or the structure of the gRNAs used to bind those target sequences. It may be the SCXA gene PNG media_image1.png 272 794 media_image1.png Greyscale No claim is allowed. Inquiry concerning this communication or earlier communications from the examiner should be directed to Michael C. Wilson who can normally be reached at the office on Monday through Friday from 9:30 am to 6:00 pm at 571-272-0738. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199. If attempts to reach the examiner are unsuccessful, the examiner's supervisor, Tracy Vivlemore, can be reached on 571-272-2914. The official fax number for this Group is (571) 273-8300. Michael C. Wilson /MICHAEL C WILSON/ Primary Examiner, Art Unit 1638
Read full office action

Prosecution Timeline

May 08, 2023
Application Filed
Dec 10, 2025
Non-Final Rejection — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12582105
GENETICALLY MODIFIED T CELL RECEPTOR MICE
2y 5m to grant Granted Mar 24, 2026
Patent 12577588
AAV CAPSIDS WITH INCREASED TROPISM TO BRAIN TISSUE
2y 5m to grant Granted Mar 17, 2026
Patent 12568940
TRANSGENIC CHICKEN HAVING AN ENDOGENOUS IMMUNOGLOBULIN HEAVY CHAIN GENE IN WHICH THE IGY CH1 CODING SEQUENCE IS FUNCTIONALLY DELETED
2y 5m to grant Granted Mar 10, 2026
Patent 12570981
COMPOSITIONS AND METHODS FOR REGULATING MYELINATION
2y 5m to grant Granted Mar 10, 2026
Patent 12565638
METHOD OF DIFFERENTIATING PLURIPOTENT OR EPIBLAST CELLS INTO IMMATURE OOCYTES
2y 5m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
42%
Grant Probability
59%
With Interview (+17.7%)
3y 9m
Median Time to Grant
Low
PTA Risk
Based on 921 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month