Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Election/Restrictions
Applicant’s election without traverse of Group I and species in the reply filed on 02/17/2026 is acknowledged.
Claims 21, 23, 33, and 35 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 02/17/2026.
Claims 1, 3, 4, 7, 8, 12, 14, 16, 18, 20, 24, 25, 27, 40, 49, 50 are under consideration.
Priority
Priority to provisional application 63/120,362 and filing date of 12/02/2020 is acknowledged for examination purposes.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 05/30/2023 and 05/09/2025 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Drawings
The drawings are objected to because the drawings are indicated by “Figure” rather than “FIG.” as required by 37 C.F.R § 1.84 (u)(1) (see also MPEP § 608.02 (V)). The different views must be numbered in consecutive Arabic numerals, starting with 1, independent of the numbering of the sheets and, if possible, in the order in which they appear on the drawing sheet(s). Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter. View numbers must be preceded by the abbreviation “FIG.” Where only a single view is used in an application to illustrate the claimed invention, it must not be numbered and the abbreviation “FIG.” must not appear.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because of the following informalities:
The drawings are indicated by “Figure” rather than “FIG.” See objection to the drawings, above. Appropriate correction is required.
Claim Objections
Claims 1, 4, 8, 16, 18, 49, 50 are objected to because of the following informalities:
Claim 1: Change “a second nucleotide sequences” to “a second nucleotide sequence”.
Claims 4, 8, 16, 18, 49, 50 use (i) or (ii) whereas claims 1, 7, etc. use a) or b) for different options. Select one style and be consistent in the appropriate claims throughout.
Appropriate correction is required.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 3, 12, 14, and 40 are rejected under 35 U.S.C. 103 as being unpatentable over Geall et al. (US 2011/0300205A1, cited in the IDS submitted on 05/30/2023).
See claims 1, 3, 12, 14, and 40 as submitted 05/16/2023.
Regarding claims 1 and 3, Geall teaches that self-replicating RNA molecules, which replicate in host cells leading to an amplification of the amount of RNA encoding the desired gene product, can enhance efficiency of RNA delivery and expression of the encoded gene products [0006]. Preferably, the self-replicating RNA molecules contain a heterologous sequence encoding gene product, such as a target protein (e.g., an antigen) or an RNA (e.g., a small RNA). The self-replicating RNA generally contains at least one or more genes selected from the group consisting of viral replicase, viral proteases, viral helicases and other nonstructural viral proteins, and also comprise 5′- and 3′-end cis-active replication sequences, and if desired, a heterologous sequence that encode a desired amino acid sequences (e.g., a protein, an antigen). A subgenomic promoter that directs expression of the heterologous sequence can be included in the self-replicating RNA. If desired, the heterologous sequence may be fused in frame to other coding regions in the self-replicating RNA and/or may be under the control of an internal ribosome entry site (IRES) [0057]. Geall also teaches a self-replicating RNA molecule useful with the invention may have two open reading frames. The first (5′) open reading frame encodes a replicase; the second (3′) open reading frame encodes a desired gene product. In some embodiments the RNA may have additional (downstream or upstream) open reading frames e.g. that encode further desired gene products, which can be under the control of an IRES.
Thus, the embodiments as recited in claims 1 and 3 are obvious embodiments as claims 1 and 3 recite specifics like a multicistronic self-replicating RNA, a 5’ to 3’ order, a first and second antigen, subgenomic promotors and/or an IRES element as disclosed in Geall.
Regarding claim 12, Geall teaches “One suitable system for achieving self-replication is to use an alphavirus-based RNA replicon…Suitable alphavirus replicons can use a replicase from a sindbis virus, a semliki forest virus, an eastern equine encephalitis virus, a venezuelan equine encephalitis virus, etc.” [0060].
Regarding claim 14, Geall teaches “Suitable antigens include proteins and peptides from a pathogen such as a virus, bacteria, fungus, protozoan, plant or from a tumor. Viral antigens that can be encoded by the self-replicating RNA molecule include, but are not limited to, proteins and peptides from a Orthomyxoviruses, such as Influenza A, B and C [0130]…Haemagglutinin from influenza virus; and the like [0076].
Regarding claim 40, Geall teaches under Examples, a “Plasmid DNA encoding an alphavirus replicon (VEE/SIN self-replicating RNA containing green fluorescent protein)” [0170 and “Plasmid DNA encoding alphavirus replicons served as a template for synthesis of RNA in vitro” [0198].
Claims 4, 7 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Geall as applied to claim 1 above, and further in view of Weiss et al. (Weiss)(US 2020040338-A1)(See PTO-892 Notice of References Cited) and Powers et al. (Powers)(See PTO-892 Notice of References Cited).
See claims 4, 7 and 8 as submitted 05/16/2023.
Geall teaches claim 1.
Regarding claim 8, Weiss teaches a self-amplifying RNA, derived from an alphavirus such as Venezuelan equine encephalitis virus and the subgenomic promoter SGP30 identified by SEQ ID 16 which has a 100% similarity to the instant application’s SEQ ID NO: 2 (See Result 9, BHH38764, us-18-037-226-2.align450rng, 03/05/2026, in supplemental contents tab) which is an extended SG promoter.
Regarding claim 4 and 7, Weiss’ SEQ ID 16 is as follows:
ACTTCCATCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAG CTACCTGAGAG|GGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACTACGACA TAGTCTAGTCCGCCAAG
The vertical line separates a portion of the Venezuelan equine encephalitis nonstructural polyprotein sequence (NSP4) (Powers teaches Accession Sequence ID: AF004470.1 that Blast aligns with SEQ ID 16) from the extended SGP30 promotor sequence which actually makes up only a fragment of SEQ ID 16. The fragment has 100% sequence identity to that of SEQ ID NO: 2 of the instant application .
One of ordinary skill in the art would have been motivated to substitute the subgenomic promoter as taught by Weiss because it is similar in identity and has been used in a self-amplifying RNA, derived from an alphavirus like Venezuelan equine encephalitis virus which suggests compatibility in use (See MPEP2143, Rationale B. Simple substitution of one known element for another to obtain predictable results).
One of ordinary skill in the art would have had a reasonable expectation of success for using the subgenomic promoter SGP30 in a self-amplifying RNA construct. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated in the context of alphavirus replicon vector fields, and commonly used as evidenced by the applied prior art.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Claims 16, 18, 20 are rejected under 35 U.S.C. 103 as being unpatentable over Geall as applied to claims 1 and 14 above, and further in view of Perri et al. (Perri)(EP2848692B1)(See PTO-892 Notice of References Cited).
See claims 16, 18, 20 as submitted 05/16/2023.
Geall teaches claim 1 but does not teach additional details about influenza subtypes and antigens.
Regarding claims 16, 18, 20, Perri teaches alphavirus replicons, alphavirus vector constructs, alphavirus replicon particles expressing one or more antigens derived from respiratory pathogens. Perri also teaches reference claims 4 (said first heterologous nucleic acid is from an influenza virus having a subtype selected from the group consisting of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, and H15 subtypes), reference claim 6 (said second heterologous nucleic acid is from an influenza virus having a subtype selected from the group consisting of N1, N2, N3, N4, N5, N6, N7, N8, and N9 subtypes), and reference claim 7 (The immunogenic composition of any one of claims 1-6, wherein said first protein antigen is an influenza hemagglutinin or immunogenic fragment thereof, and said second protein antigen is an influenza neuraminidase or immunogenic fragment thereof)(also see Figure 2).
One of ordinary skill in the art would have been motivated to more specifically use different Influenza subtypes as the antigens as well as a combination, e.g., the first protein antigen is a hemagglutinin and the second protein is a neuraminidase as taught by Perri in order to stimulate an immune response to multiple antigens from a respiratory pathogen, such as influenza, which can be broken into different types as well as subtypes (See MPEP 2143, Rationale A. Combining prior art elements according to known methods to yield predictable results).
One of ordinary skill in the art would have had reasonable expectation of success for using more specific antigens, representing different influenza subtypes, especially related to the hemagglutinin (HA) and neuraminidase (NA) proteins as taught by Perri. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated in the context of influenza vaccinology, alphavirus replicon vector and/or immunity fields, and commonly used as evidenced by the applied prior art.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Claims 25 and 27 are rejected under 35 U.S.C. 103 as being unpatentable over Geall as applied to claim 1 above, and further in view of Bertholet et al. (Bertholet)(See PTO-892 Notice of References Cited).
See claims 25 and 27 as submitted 05/16/2023.
Geall teaches claim 1. Geall also teaches pharmaceutical compositions (e.g., immunogenic compositions and vaccines) that comprise a self-replicating RNA molecule as described herein, and a pharmaceutically acceptable carrier and/or a pharmaceutically acceptable vehicle” [0024] and the self-replicating RNA molecule being “encapsulated”[0025] on a cationic lipid, a liposome, a cochleate, a virosome, an immune-stimulating complex, a microparticle, a microsphere, a nanosphere, a unilamellar vesicle, a multilamellar vesicle, etc. [0025].
Geall does not teach a plurality of multicistronic self-replicating RNAs wherein each multicistronic self-replicating RNA encodes different polypeptide antigen sequences. Geall also does not teach a lipid nanoparticle (LNP) encapsulated in a LNP.
Regarding claim 25, Bertholet, however, teaches reference claim 28 which recites an immunogenic composition comprising multiple self-replicating RNA molecules, where each self-replicating RNA molecule encodes a polypeptide comprising an HA antigen from a different strain of the influenza H3N2 subtype and teaches reference claim 29 which recites the immunogenic composition of claim 28 comprising six self-replicating RNA molecules, wherein: (i) a first self-replicating RNA molecule encodes a polypeptide comprising a first antigen from A/Bilthoven/16398/1968, (ii) a second self-replicating RNA molecule encodes a polypeptide comprising a second antigen from A/Bangkok/1/79, (iii) a third self-replicating RNA molecule encodes a polypeptide comprising a third antigen from A/Beijing/32/92, (iv) a fourth self-replicating RNA molecule encodes a polypeptide comprising a fourth antigen from A/Fujian/411/2002, (v) a fifth self-replicating RNA molecule encodes a polypeptide comprising a fifth antigen from A/Brisbane/10/2007, and (vi) a sixth self-replicating RNA molecule encodes a polypeptide comprising a sixth antigen from A/Texas/50/2012.
Regarding claim 27, Bertholet, however, teaches reference claim 16 which recites the pharmaceutical composition of claim 15 wherein the self-replicating RNA molecules are encapsulated in, bound to or adsorbed on a cationic lipid, a liposome, a microparticle, viral replicon particles (VRPs), an oil-in-water emulsion or a cationic nanoemulsion); teaches reference claim 17 which recites the immunogenic composition of any one of claims 1 to 13 or the pharmaceutical composition of any one of claims 14 to 16 wherein the self-replicating RNA molecules are formulated in lipid nanoparticles (LNP) or in a cationic nanoemulsion (CNE); and finally, teaches a “method of preparing an immunogenic composition according to the invention wherein the self-replicating RNA molecules are encapsulated in a lipid nanoparticle (LNP), the method comprising: (i) providing at least one lipid which forms nanoparticles; (ii) providing an aqueous solution comprising the self-replicating RNA molecules; and (iii) combining the aqueous solution of (ii) and the at least one lipid of (i), thereby preparing the composition (p. 21).
One of ordinary skill in the art would have been motivated to substitute the lipid nanoparticle as taught by Bertholet for enhanced delivery, improved immunogenicity, potentially reduced side effects and for sustained protein expression and therapeutic effects (See MPEP2143 Rationale B. Simple substitution of one known element for another to obtain predictable results).
Similarly, since Geall also speaks to influenza antigen constructs, one of ordinary skill in the art would have been motivated to construct a plurality of multicistronic self-replicating RNAs wherein each multicistronic self-replicating RNA encodes different polypeptide antigen sequences as taught by Bertholet for enhanced immunogenic effect against a variety of antigens, representing different subtypes or strains (See MPEP 2143 Rationale G. Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or combine prior art reference teachings to arrive at the claimed invention).
One of ordinary skill in the art would have had a reasonable expectation of success for substituting the LNP as a delivery system and constructing a plurality of multicistronic self-replicating RNAs wherein each multicistronic self-replicating RNA encodes different polypeptide antigen sequences as taught by Bertholet. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated in the context of influenza immunology and therapeutics as well as alphavirus replicon vector fields, and commonly used as evidenced by the applied prior art.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Claims 49 and 50 are rejected under 35 U.S.C. 103 as being unpatentable over Geall as applied to claim 1 above, and further in view of Perri and Bertholet (references cited above).
See claims 49 and 50 as submitted 05/16/2023.
Geall teaches claim 1 but do not specifics about the SG promotor (e.g., minimal vs. extended distinctions or nucleotides occurring in either in a sequence encoding a non-structural protein ). And as previously mentioned, Perri teaches reference claims 4 (said first heterologous nucleic acid is from an influenza virus having a subtype selected from the group consisting of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, and H15 subtypes), reference claim 6 (said second heterologous nucleic acid is from an influenza virus having a subtype selected from the group consisting of N1, N2, N3, N4, N5, N6, N7, N8, and N9 subtypes), and reference claim 7 (The immunogenic composition of any one of claims 1-6, wherein said first protein antigen is an influenza hemagglutinin or immunogenic fragment thereof, and said second protein antigen is an influenza neuraminidase or immunogenic fragment thereof)(also see Figure 2).
Bertholet, however, teaches SEQ 11, Influenza virus hemagglutinin cDNA with a 100% match to SEQ ID NO: 1 (See result #40, us-18-037-226-1, BHJ01574, 03/06/2026, , in supplemental contents tab) and a 100% match to SEQ ID NO: 2 (See result #34, us-18-037-226-1, BHJ01574, 03/06/2026, in supplemental contents tab). SEQ ID NO:2 is an example of an extended SG promoter as recited in claim 50. Claim 50 is a more specific (limiting) version of claim 49.
One of ordinary skill in the art would have been motivated to substitute the two SG promotors as taught by Bertholet. Bertholet, like Geall and Perri teaches self-replicating molecules encoding influenza antigens. But unlike Perri (who included both the hemagglutinin and neuraminidase antigens), Bertholet’s invention included a first self-replicating RNA molecule encoding a polypeptide comprising an antigen from a different influenza strain from that used for a second self-replicating RNA and exclusively focused on the hemagglutinin antigen (See MPEP 2143 Rationale B. Simple substitution of one known element for another to obtain predictable results).
One of ordinary skill in the art would have had a reasonable expectation of success for substituting the SG promoters as taught by Bertholet. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated in influenza immunology and therapeutics as well as alphavirus replicon vector fields, and commonly used as evidenced by the applied prior art.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Allowable Subject Matter
Claim 24 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Prior art cannot be found for the SEQ ID NOs: 10-14.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Claire Cornelius whose telephone number is (571) 272-0860. The examiner can normally be reached M-F, 0930-1700.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone can be reached at (571) 270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.C./Examiner, Art Unit 1672
/M FRANCO G SALVOZA/Primary Examiner, Art Unit 1672