Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Election/Restrictions
Claims 1, 3, 4, 7, 8, 12, 14, 16, 18, 20-21, 23-25, 27, 33, 35, 40, 49-50 were pending.
Claims 21, 23, 33, and 35 were withdrawn.
Claims 2, 4-7, 9-11, 13, 15, 17, 19, 22, 26, 28-32, 34, 36-39, 41-48 are canceled.
Claims 1, 3, 8, 12, 14, 16, 18, 20, 24, 25, 27, 40, 49, 50 are under consideration.
Drawings
(previous objection; withdrawn) The drawings are objected to because the drawings are indicated by “Figure” rather than “FIG.” as required by 37 C.F.R § 1.84 (u)(1) (see also MPEP § 608.02 (V)). The different views must be numbered in consecutive Arabic numerals, starting with 1, independent of the numbering of the sheets and, if possible, in the order in which they appear on the drawing sheet(s). Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter. View numbers must be preceded by the abbreviation “FIG.” Where only a single view is used in an application to illustrate the claimed invention, it must not be numbered and the abbreviation “FIG.” must not appear.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Applicant contends: In compliance with 37 C.F.R. §§ 1.84 and 1.121(d), Applicant encloses Replacement Drawing Sheets to amend "Figure" to "FIG." These amendments do not add new matter. In view of these amendments, Applicant respectfully requests withdrawal of the objection.
Office response: Based on the applicant’s amendments made by the applicant, the objection is withdrawn.
Specification
(previous objection; withdrawn) The disclosure is objected to because of the following informalities:
The drawings are indicated by “Figure” rather than “FIG.” See objection to the drawings, above. Appropriate correction is required.
Applicant contends: Applicant submits a Substitute Specification in compliance with 37 C.F.R. §§ 1.52, 1.121(b)(3), and 1.125. The Substitute Specification is provided in both clean and marked versions, as set forth in 37 C.F.R. § 1.125(c). The Substitute Specification includes amendments throughout to amend "Figure" to "FIG." The Substitute Specification contains no new matter.
Office response: Based on the applicant’s amendment/substitution, the objection is withdrawn.
Claim Objections
(previous objection; withdrawn) Claims 1, 4, 8, 16, 18, 49, 50 are objected to because of the following informalities:
Claim 1: Change “a second nucleotide sequences” to “a second nucleotide sequence”.
Claims 4, 8, 16, 18, 49, 50 use (i) or (ii) whereas claims 1, 7, etc. use a) or b) for different options. Select one style and be consistent in the appropriate claims throughout.
Appropriate correction is required.
Applicant contends: Applicant has amended claim 1 without prejudice or disclaimer to recite "a second nucleotide sequence." Applicant respectfully requests withdrawal of the objection. Also, Applicant has amended the claims throughout to consistently use (i), (ii), etc., to label sub-clauses. Applicant respectfully requests withdrawal of the objection.
Office response: Based on the applicant’s amendment, the objection is withdrawn.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
(new; necessitated by amendment) Claims 1, 3, 8, 12, 14, 16, 18, 20, 24, 25, 27, 40, 49, 50 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
See claims 1, 3, 8, 12, 14, 16, 18, 20, 24, 25, 27, 40, 49, 50 as submitted 06/23/2026.
Claim 1: Claim 1 recites “by nucleotides occurring in a sequence encoding a non-structural protein 4” and “nucleotides occurring in the sequence encoding the nsp4”. It is unclear what the metes and bounds are for the number of nucleotides or their positions within the sequence. With too few nucleotides and without identification of the position of the nucleotides within a reference sequence, there is a loss of specificity for the sequence reading on the non-structural protein 4 (nsp4) of a Venezuelan equine encephalitis virus. It is also unclear if “100 nucleotides in length” refers the entire length of the extended SG promoter.
For compact prosecution, the claim is being interpreted as the extended SG promoter is no more than 100 nucleotides in length.
Claims 3, 8, 12, 14, 16, 18, 20, 24, 25, 27, 40, 49, 50 are rejected because they depend on rejected claim 1.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
(previous rejection; withdrawn) Claims 1, 3, 12, 14, and 40 are rejected under 35 U.S.C. 103 as being unpatentable over Geall et al. (US 2011/0300205A1, cited in the IDS submitted on 05/30/2023).
See claims 1, 3, 12, 14, and 40 as submitted 06/23/2026.
Applicant contends: Applicant respectfully disagrees; however, without acquiescing to the rejection, Applicant has amended claim 1 without prejudice or disclaimer to recite a "multicistronic self-replicating RNA having two different SG promoters in the recited order, including: (1) a first antigen operably linked to a SG promoter, and (2) a second antigen operably linked to an extended SG promoter, wherein the extended SG promoter comprises a minimal SG promoter comprising a sequence set forth in SEQ ID NO: 1 that is further
extended at the 5' end with nucleotides occurring in a sequence encoding a non- structural protein 4 (nsp4) of a Venezuelan equine encephalitis virus (VEE), and wherein the extended SG promoter is extended by no more than 51 nucleotides from the sequence encoding the nsp4 of the VEE virus and is no more than 100 nucleotides in length." Geall does not teach or suggest at least the element of a multicistronic self-replicating RNA comprising an antigen operably linked to an extended SG promoter comprising a sequence set forth in SEQ ID NO: 1 that is further extended at the 5' end with a sequence encoding an nsp4 of a VEE as claimed. Applicant therefore asserts that claim 1 and its dependent claims 3, 12, 14, and 40 are nonobvious over Geall, and requests withdrawal of the rejection.
Office response: Applicant’s disagreement regarding the rejection is acknowledged. Based on the applicant’s amendment to claim 1, the rejection of claims 1, 3, 12, 14, and 40 is withdrawn.
(previous rejection; withdrawn) Claims 4, 7 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Geall as applied to claim 1 above, and further in view of Weiss et al. (Weiss)(US 2020040338-A1)(See PTO-892 Notice of References Cited) and Powers et al. (Powers)(See PTO-892 Notice of References Cited).
See claims 4, 7 and 8 as submitted 06/23/2026.
Applicant contends: Applicant respectfully disagrees. However, without acquiescing to the rejection, Applicant has canceled claims 4 and 7 and amended claim 8. Applicant notes that canceled subject matter from claims 4, 7, and 8 is incorporated into amended claim 1. Applicant showed an alignment of Weiss' SEQ ID NO: 16 with SEQ ID NO: 2 of the present application ("SEQIDNO2"). Applicant contends Weiss' SEQ ID NO: 16 is not 100% identical to SEQ ID NO: 2 of the present application. Additionally, Weiss' SEQ ID NO: 16 is 128bp in length and comprises 68 nucleotides from the nsP4 encoding sequence. Thus, if the skilled person were to apply the teachings of Weiss to those of Geall and Powers to produce a multicistronic construct comprising an extended subgenomic promoter connected to the sequence encoding a second antigen, which Applicant does not concede, the skilled person would at best produce a self-amplifying RNA construct comprising a subgenomic promoter that is longer than what is defined by the present claims.
Applicant's specification clearly states that "no antigen expression was detected when an SG promoter extended at the 5' end by 52 nucleotides occurring in a sequence-15-
encoding a non-structural protein was used." See as-filed specification at 8. Thus, the present application shows that an extended SG promoter longer than is claimed did not produce expressed antigen. Weiss therefore teaches towards an alternative solution than what is claimed in the present application. Based on the teachings in the present application, this solution would not be expected to result in expressed antigen.
None of Geall or Powers, alone or together, cures the deficiencies of Weiss at least because neither reference teaches or suggests the claimed extended SG promoter that is extended by no more than 51 nucleotides from the sequence encoding the nsp4 of the VEE virus and is no more than 100 nucleotides in length.
Further, the present application includes data showing an enhanced effect of using an extended subgenomic promoter including nsp4 sequence from VEE on expression of antigens in multicistronic self-amplifying vaccines. For example, Figure 2 of the present application shows expression of the antigens (H5 - hemagglutinin; N1 - neuraminidase) from various constructs in which SGP is a minimal subgenomic promoter and SGPv2 and SGPv3 are extended subgenomic promoters:
NSP1-4.SGP.H5.SGP.N1 (F548); NSP1-4.SGP.N1.SGP.H5 (F549); NSP1-4.SGP.H5.SGPv2.N1 (F602); and NSP1-4.SGP.H5.SGPv3.N1 (F616).
The data presented in Figure 2 show increased expression of the antigens, especially the second antigen in the bicistronic constructs. Expression of all antigens is important for production of vaccines, e.g., against influenza. None of the cited art teaches or suggests the enhanced effect of the claimed multicistronic self-replicating RNA.
For at least the above reasons, Applicant respectfully asserts that the claims are nonobvious over Geall, Weiss, and Powers and requests withdrawal of the rejection.
Office response: Claim 1 was amended to include additional limitations. The applicant’s disagreement is acknowledged. Applicant's arguments, see pages 14-17, filed 06/23/2026, with respect to claims 4, 7, 8 have been fully considered and are persuasive. The rejection of claim 8 is withdrawn. Claims 4 and 7 are cancelled and so their rejection is moot.
(previous rejection; withdrawn) Claims 16, 18, 20 are rejected under 35 U.S.C. 103 as being unpatentable over Geall as applied to claims 1 and 14 above, and further in view of Perri et al. (Perri)(EP2848692B1)(See PTO-892 Notice of References Cited).
See claims 16, 18, 20 as submitted 06/23/2026.
Applicant contends: Applicant respectfully disagrees. As explained above, Geall does not teach or suggest at least the claimed multicistronic self-replicating RNA comprising an antigen operably linked to an extended SG promoter comprising a sequence set forth in SEQ ID NO: 1 that is further extended at the 5' end with a sequence encoding an nsp4 of a VEE. Perri, which the Office cites for describing alphavirus replicons, alphavirus vector constructs, and alphavirus replicon particles expressing one or more antigens derived from respiratory pathogens, fails to remedy this deficiency. Id. Perri fails to teach or suggest the specifically claimed multicistronic self-replicating RNA comprising an extended SG promoter that is extended by no more than 51 nucleotides occurring in the sequence encoding the nsp4 of the VEE virus and is no more than 100 nucleotides in length. A skilled artisan would therefore not arrive at the claimed multicistronic self-replicating RNA by combining the teachings of Geall and Perri.
For at least this reason, Applicant requests withdrawal of the rejection.
Office response: Claim 1 was amended to include additional limitations. The applicant’s disagreement is acknowledged. Based on the applicant’s amendment to claim 1, the rejection of claims 16, 18, 20 is withdrawn.
(previous rejection; withdrawn) Claims 25 and 27 are rejected under 35 U.S.C. 103 as being unpatentable over Geall as applied to claim 1 above, and further in view of Bertholet et al. (Bertholet)(See PTO-892 Notice of References Cited).
See claims 25 and 27 as submitted 06/23/2026.
Applicant contends: Applicant respectfully disagrees. As explained above, Geall does not teach or suggest at least the claimed multicistronic self-replicating RNA comprising an antigen operably linked to an extended SG promoter comprising a sequence set forth in SEQ ID NO: 1 that is further extended at the 5' end with a sequence encoding an nsp4 of a VEE. Bertholet, which the Office cites for describing a plurality of multicistronic self-replicating RNAs and compositions comprising lipid nanoparticles (LNPs), fails to remedy this deficiency. Id. Bertholet fails to teach or suggest the specifically claimed multicistronic self-replicating RNA comprising an extended SG promoter that is extended by no more than 51 nucleotides occurring in the sequence encoding the nsp4 of the VEE virus and is no more than 100 nucleotides in length. A skilled artisan would therefore not arrive at the claimed multicistronic self-replicating RNA by combining the teachings of Geall and Bertholet.
For at least this reason, Applicant requests withdrawal of the rejection.
Office response: Claim 1 was amended to include additional limitations. The applicant’s disagreement is acknowledged. Based on the applicant’s amendment to claim 1, the rejection of claims 25 and 27 is withdrawn.
(previous rejection; withdrawn) Claims 49 and 50 are rejected under 35 U.S.C. 103 as being unpatentable over Geall as applied to claim 1 above, and further in view of Perri and Bertholet (references cited above).
See claims 49 and 50 as submitted 06/23/2026.
Applicant contends: Applicant respectfully disagrees. As explained above, Geall does not teach or suggest at least the claimed multicistronic self-replicating RNA comprising an antigen operably linked to an extended SG promoter comprising a sequence set forth in SEQ ID NO: 1 that is further extended at the 5' end with a sequence encoding an nsp4 of a VEE. Perri, which the Office cites for describing alphavirus replicons, alphavirus vector constructs, and alphavirus replicon particles expressing one or more antigens derived from respiratory pathogens, and Bertholet, which the Office cites for describing a plurality of multicistronic self-replicating RNAs and compositions comprising LNPs, fail to remedy this deficiency. Id. Perri and Bertholet fail to teach or suggest the specifically claimed multicistronic self-replicating RNA comprising an extended SG promoter that is extended by no more than 51 nucleotides occurring in the sequence encoding the nsp4 of the VEE virus and is no more than 100 nucleotides in length. A skilled artisan would therefore not arrive at the claimed multicistronic self-replicating RNA by combining the teachings of Geall, Perri, and Bertholet.
For at least this reason, Applicant requests withdrawal of the rejection.
Office response: Claim 1 was amended to include additional limitations. The applicant’s disagreement is acknowledged. Based on the applicant’s amendment to claim 1, the rejection for claims 49 and 50 is withdrawn.
(new rejection; necessitated by amendment) Claims 1, 3, 8, 12, 14, 25, 27, 40 are rejected under 35 U.S.C. 103 as being unpatentable over Geall (as previously cited) in view of Bertholet (as previously cited).
See claims 1, 3, 8, 12, 14, 25, 27 and 40 as submitted 06/23/2026.
Regarding claims 1 (partial) and 3, Geall teaches that self-replicating RNA molecules, which replicate in host cells leading to an amplification of the amount of RNA encoding the desired gene product, can enhance efficiency of RNA delivery and expression of the encoded gene products [0006]. Preferably, the self-replicating RNA molecules contain a heterologous sequence encoding gene product, such as a target protein (e.g., an antigen) or an RNA (e.g., a small RNA). The self-replicating RNA generally contains at least one or more genes selected from the group consisting of viral replicase, viral proteases, viral helicases and other nonstructural viral proteins, and also comprise 5′- and 3′-end cis-active replication sequences, and if desired, a heterologous sequence that encode a desired amino acid sequences (e.g., a protein, an antigen). A subgenomic promoter that directs expression of the heterologous sequence can be included in the self-replicating RNA. If desired, the heterologous sequence may be fused in frame to other coding regions in the self-replicating RNA and/or may be under the control of an internal ribosome entry site (IRES) [0057]. Geall also teaches a self-replicating RNA molecule useful with the invention may have two open reading frames. The first (5′) open reading frame encodes a replicase; the second (3′) open reading frame encodes a desired gene product. In some embodiments the RNA may have additional (downstream or upstream) open reading frames e.g. that encode further desired gene products, which can be under the control of an IRES.
Thus, the embodiments as recited in claims 1 and 3 are obvious embodiments as claims 1 and 3 recite specifics like a multicistronic self-replicating RNA, a 5’ to 3’ order, a first and second antigen, subgenomic promotors and/or an IRES element as disclosed in Geall.
Regarding claim 12, Geall teaches “One suitable system for achieving self-replication is to use an alphavirus-based RNA replicon…Suitable alphavirus replicons can use a replicase from a sindbis virus, a semliki forest virus, an eastern equine encephalitis virus, a Venezuelan equine encephalitis virus, etc.” [0060].
Regarding claim 14, Geall teaches “Suitable antigens include proteins and peptides from a pathogen such as a virus, bacteria, fungus, protozoan, plant or from a tumor. Viral antigens that can be encoded by the self-replicating RNA molecule include, but are not limited to, proteins and peptides from a Orthomyxoviruses, such as Influenza A, B and C [0130]…Haemagglutinin from influenza virus; and the like [0076].
Regarding claim 27 (partial), Geall also teaches pharmaceutical compositions (e.g., immunogenic compositions and vaccines) that comprise a self-replicating RNA molecule as described herein, and a pharmaceutically acceptable carrier and/or a pharmaceutically acceptable vehicle” [0024] and the self-replicating RNA molecule being “encapsulated”[0025] on a cationic lipid, a liposome, a cochleate, a virosome, an immune-stimulating complex, a microparticle, a microsphere, a nanosphere, a unilamellar vesicle, a multilamellar vesicle, etc. [0025].
Regarding claim 40, Geall teaches under Examples, a “Plasmid DNA encoding an alphavirus replicon (VEE/SIN self-replicating RNA containing green fluorescent protein)” [0170 and “Plasmid DNA encoding alphavirus replicons served as a template for synthesis of RNA in vitro” [0198].
Geall does not teach an extended SG promoter, wherein “an extended SG promoter, wherein the extended SG promoter comprises a minimal SG promoter comprising a sequence set forth in SEQ ID NO: 1 that is further extended at the 5' end by nucleotides occurring in a sequence encoding a non- structural protein 4 (nsp4) of a Venezuelan equine encephalitis (VEE) virus, and wherein the extended SG promoter is extended by no more than 51 nucleotides occurring in the sequence encoding the nsp4 of the VEE virus and is no more than 100 nucleotides in length” (as recited in claim 1). Geall also does not teach a plurality of multicistronic self-replicating RNAs wherein each multicistronic self-replicating RNA encodes different polypeptide antigen sequences (as recited in claim 25) nor does Geall teach a lipid nanoparticle (LNP) encapsulated in a LNP (as recited in claim 27).
Regarding claims 1 and 8, Bertholet, however, teaches “immunogenic or pharmaceutical compositions comprising self-replicating RNA molecules that encode influenza virus antigens for treating and/or preventing influenza infections” (Abstract). Bertholet also teaches an alphavirus-based replicon with VEE as one of the embodiments as well as monocistronic and multicistronic self-replicating RNA molecules (p. 7). Bertholet further teaches “In some embodiments, the self-replicating RNA molecule comprises a sequence that encodes (i) a RNA-dependent RNA polymerase which can transcribe RNA from the self-replicating RNA molecule and (ii) a polypeptide comprising an antigen from influenza virus. The polymerase can be an alphavirus replicase e.g. comprising one or more of alphavirus proteins nsp1, nsp2, nsp3 and nsp4”(p. 5).
Bertholet teaches SEQ 11. SEQ 11 has a 100% match with the instant SEQ ID NO: 1 as shown in the alignment below (See Result #40, BHJ01574, us-18-037-226-1.align450rng, 03/05/2026, in supplemental contents tab).
PNG
media_image1.png
179
696
media_image1.png
Greyscale
Additionally, the nucleotide sequence of SEQ 11 from position 1-61 is as follows:
GGGCCCCTATAA | CTCTCTACGGCTAACCTGAATGGACTACGACATAGTCTAGTCCGCCAAG
This sequence is a 100% match to instant application SEQ ID NO: 2 (also see, Result #34, BHJ01574, us-18-037-226-2.align450rng, 03/05/2026, in supplemental contents tab)(as recited in instant claim 8). Based on the nucleotides upstream of the minimal SG promoter, this reads on the amended limitations of instant claim 1.
Regarding claim 25, Bertholet, teaches reference claim 28 which recites an immunogenic composition comprising multiple self-replicating RNA molecules, where each self-replicating RNA molecule encodes a polypeptide comprising an HA antigen from a different strain of the influenza H3N2 subtype and teaches reference claim 29 which recites the immunogenic composition of claim 28 comprising six self-replicating RNA molecules, wherein: (i) a first self-replicating RNA molecule encodes a polypeptide comprising a first antigen from A/Bilthoven/16398/1968, (ii) a second self-replicating RNA molecule encodes a polypeptide comprising a second antigen from A/Bangkok/1/79, (iii) a third self-replicating RNA molecule encodes a polypeptide comprising a third antigen from A/Beijing/32/92, (iv) a fourth self-replicating RNA molecule encodes a polypeptide comprising a fourth antigen from A/Fujian/411/2002, (v) a fifth self-replicating RNA molecule encodes a polypeptide comprising a fifth antigen from A/Brisbane/10/2007, and (vi) a sixth self-replicating RNA molecule encodes a polypeptide comprising a sixth antigen from A/Texas/50/2012.
Regarding claim 27, Bertholet, however, teaches reference claim 16 which recites the pharmaceutical composition of claim 15 wherein the self-replicating RNA molecules are encapsulated in, bound to or adsorbed on a cationic lipid, a liposome, a microparticle, viral replicon particles (VRPs), an oil-in-water emulsion or a cationic nanoemulsion); teaches reference claim 17 which recites the immunogenic composition of any one of claims 1 to 13 or the pharmaceutical composition of any one of claims 14 to 16 wherein the self-replicating RNA molecules are formulated in lipid nanoparticles (LNP) or in a cationic nanoemulsion (CNE); and finally, teaches a “method of preparing an immunogenic composition according to the invention wherein the self-replicating RNA molecules are encapsulated in a lipid nanoparticle (LNP), the method comprising: (i) providing at least one lipid which forms nanoparticles; (ii) providing an aqueous solution comprising the self-replicating RNA molecules; and (iii) combining the aqueous solution of (ii) and the at least one lipid of (i), thereby preparing the composition (p. 21).
One of ordinary skill in the art would have been motivated to combine the teachings of Geall (multicistronic, alphavirus (VEE) self-replicating RNA, other regulatory elements) and Bertholet (relf-replicating RNA; alphavirus replicon; extended SG promoter; lipid nanoparticle pharmaceutical composition; influenza antigens) to arrive at the invention for the benefit of developing a vaccine against influenza with improved/enhanced immunogenicity against several antigens, with potentially reduced side effects and with the ability for sustained protein expression and therapeutic effects (See MPEP2143 Rationale A. Combining prior art elements according to known methods to yield predictable results and Rationale G. Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention.
One of ordinary skill in the art would have had a reasonable expectation of success for combining the teachings of Geall and Bertholet to arrive at the invention. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated in the context of influenza immunology and therapeutics as well as alphavirus replicon vector fields, and commonly used as evidenced by the applied prior art.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
(new rejection; necessitated by amendment) Claims 16, 18, 20, 49, and 50 are rejected under 35 U.S.C. 103 as being unpatentable over Geall in view of Bertholet as applied to claims 1, 3, 8, 12, 14, 25, 27, 40 above, and further in view of Perri (previously cited).
See claims 16, 18, 20, 49, and 50 as submitted 06/23/2026.
Geall and Bertholet teach claim 1, including the inclusion of influenza antigens, and the minimal and extended SG promoter constructs but do not teach additional details about influenza subtypes and antigens or their combined expression in a multicistronic self-replicating RNA.
Regarding claims 16, 18, 20, 49, 50, Perri teaches alphavirus replicons, alphavirus vector constructs, alphavirus replicon particles expressing one or more antigens derived from respiratory pathogens. Perri also teaches reference claims 4 (said first heterologous nucleic acid is from an influenza virus having a subtype selected from the group consisting of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, and H15 subtypes), reference claim 6 (said second heterologous nucleic acid is from an influenza virus having a subtype selected from the group consisting of N1, N2, N3, N4, N5, N6, N7, N8, and N9 subtypes), and reference claim 7 (The immunogenic composition of any one of claims 1-6, wherein said first protein antigen is an influenza hemagglutinin or immunogenic fragment thereof, and said second protein antigen is an influenza neuraminidase or immunogenic fragment thereof)(also see Figure 2).
One of ordinary skill in the art would have been motivated to more specifically use different Influenza subtypes as the antigens as well as a combination, e.g., the first protein antigen is a hemagglutinin and the second protein is a neuraminidase as taught by Perri in order to stimulate an immune response to multiple antigens from a respiratory pathogen, such as influenza, which can be broken into different types as well as subtypes (See MPEP 2143, Rationale A. Combining prior art elements according to known methods to yield predictable results).
One of ordinary skill in the art would have had reasonable expectation of success for using more specific antigens, representing different influenza subtypes, especially related to the hemagglutinin (HA) and neuraminidase (NA) proteins as taught by Perri. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated in the context of influenza vaccinology, alphavirus replicon vector and/or immunity fields, and commonly used as evidenced by the applied prior art.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Allowable Subject Matter
(previous objection, withdrawn; rejected as indicated above as new, necessitated by amendment) Claim 24 is objected to as being dependent upon a rejected base claim. Prior art cannot be found for the SEQ ID NOs: 10-14.
Applicant contends: Applicant thanks the Office for acknowledging claim 24 to be allowable if rewritten in independent form including all the limitations of claim 1.
Office response: Applicant’s comment is acknowledged.
Conclusion
No claims allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Claire Cornelius whose telephone number is (571) 272-0860. The examiner can normally be reached M-F, 0930-1700.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone can be reached at (571) 270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.C./Examiner, Art Unit 1672
/M FRANCO G SALVOZA/Primary Examiner, Art Unit 1672
Prosecution Insights