DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
New submitted claim 16, drawn to the method of using a pair of primers according to claim 13, is withdrawn as belonging to unelected group II.
Status of Claims
Claims 1, 7-12, & 14-15 are under examination on the merits.
Claims 13 & 16 are withdrawn.
The rejection of claims 1, 7-12 & 15 under 35 U.S.C. 101 is withdrawn in light of Applicant’s amendments.
The rejection of claim 15 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, is withdrawn in light of Applicant’s amendments.
The rejection of claims 1, 9-10 & 14-15 under 35 U.S.C. 103 as being unpatentable over Yu et al (2005) Theor Appl Genet. 110: 969–979 (hereafter Yu) in view of Raman et al (2020) Scientific Reports. 10:4416 (hereafter Raman) and taken with the evidence of Ghanbarnia et al (2012) Theor Appl Genet. 124:505–513 (hereafter Ghanbarnia), is withdrawn in light of Applicant’s amendments.
The rejection of claims 1, 7-12 & 14-15 are rejected under 35 U.S.C. 103 as being unpatentable over Yu, Raman, and Ghanbarnia as applied to claims above, and further in view of Zhou et al (2003) Improvement of new and traditional industrial crops by induced mutations and related biotechnology, IAEA-TECDOC-1369. International Atomic Energy Agency, Vienna, pages 125-131 (published 8/2003, hereafter Zhou) is withdrawn in light of Applicant’s amendments.
Claim Rejections - 35 USC § 112
Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 7-12, & 14-15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in the rejections below.
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 3/20/2026 as applied to claim 15. Applicant' s arguments filed 6/17/2026 have been fully considered but they are not persuasive.
Claim 1 recites the limitation "the selected Brassica napus plant or a part thereof" in line 7. There is insufficient antecedent basis for this limitation in the claim, because there is no step wherein a Brassica napus plant is selected in the claim.
Claim 1 recites “the selected Brassica napus plant or regenerated Brassica napus plant having the at least one marker” in lines 10-11. Claim 15 recites the limitation “the selected Brassica napus plant having the at least one marker” in line 6. There is insufficient antecedent basis for this limitation in the claims, because there is no step wherein a Brassica napus plant having the at least one marker is selected.
Claim 1 recites “the Brassica napus plant” in line 24. Claim 15 recites “the Brassica napus plant” in line 9. There is insufficient antecedent basis for this limitation in the claims, because claims 1 & 15 recite two distinct Brassica napus plants: the selected plant (claim 1, line 10; claim 15, line 6) and the not-resistant plant (claim 1, line 11; claim 15, lines 5-6). It is indefinite which plant is the winter-type cultivar.
Claim 7 recites the limitation “said Brassica napus plant” in line 2. There is insufficient antecedent basis for this limitation in the claim, because claim 1 recites two Brassica napus plants, one having resistance to fungal pathogens (lines 1-2) and one that is not resistant to fungal pathogens (line 11). Because there are two Brassica napus plants in claim 1, step 7 can be interpreted as a further limitation of detecting the presence of markers in the resistant plant (claim 1, step a) or alternatively as an additional step in the method requiring detecting the absence of markers in the plant lacking resistance. The unclear interpretation regarding the required steps renders claim 7 indefinite. Claim 9 (line 1) also recites “the Brassica napus plant”, but since the plant in claim 9 has been obtained by a process of introgressing LepR1, it is interpreted as the plant having resistance to fungal pathogens in claim 1 (lines 1-2) rather than the plant lacking resistance.
Applicant urges that claim 15 is amended to delete reference to claim 13 and the claims are patentable under 35 U.S.C. 112(b) (Remarks, page 7, paragraphs 2-4).
The arguments are unpersuasive, because the amendments to the claims introduce new issues of indefiniteness regarding antecedent basis.
Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 7-12 & 14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
This rejection is modified from the rejection set forth in the Office action mailed 3/20/2026, as applied to claims 1, 7-12 & 14. Applicant' s arguments filed 6/17/2026 have been fully considered but they are not persuasive.
Claims 1, 7-12 & 14 require detecting the presence or absence of at least one marker on or within a chromosomal interval between ra24982s01 and ra25063s01, comprising detecting one or more alleles. Claim 7 further requires a second marker, and at least one marker is on or within a chromosomal interval between ra24982s01 and ra74601s01 and another marker is on or within a chromosomal interval between ra25063s01 and ra74589s02. Claim 8 requires the two markers be within even narrower intervals.
The claims broadly require detecting in a Brassica napus plant an allele of SEQ ID NOs: 1-10 by detecting the presence or absence of a marker within the specific regions, which range in size from 1,437,244bp (ra24982s01 and ra25063s01) to 102,851bp (ra74601s01 and ra7489s02). Because the alleles of SEQ ID NOs: 1-10, in linkage with the LepR1 locus, would be indirectly detected by a marker that detects the LepR1 locus, the claims are broadly require the detecting the presence or absence of any marker in the region associated with LepR1.
The instant specification has described only the ten SNP markers provided in table 1 (SEQ ID NOs: 1-10); however, the specification mentions 115 KASPAR and 33 XT-CHIP markers that were used for analysis of the target region. (page 32, paragraph 5) in lines generated from 09T11R1-13 plants backcrossed to KWS elite restorer lines (page 31, paragraph 8). The instant specification describes a single introgression line of elite breeding material based on BC2S1 09T11R1-13 crossed to KWS elite restorer lines (page 31, paragraph 5-7), although the specification describes 86 doubled haploid lines from this backcross lineage (table 2).
Molecular markers of Brassica napus are known in the art. Although Brassica napus has lower diversity that its progenitor species (Delourme et al (2013) BMC Genomics, 14:120, published 2/22/2013, hereafter Delourme; page 2, left column, paragraph 2), differences exist in polymorphism across fodder rape, spring oilseed rape, and winter oil seed rape varieties (Delourme page 6, left column, paragraph 2; table 4). In addition, Asiatic lines of B. napus that may be partly derived from crosses with B. rapa have more genetic diversity in the A genome (Delourme page 9, right column, paragraph 1-page 10, right column, paragraph 1). Only 60% of marker sequences developed for mapping disease resistance in B. napus mapped to the reference sequence, demonstrating that some genomic variation in B. napus is not represented in the reference Darmor genome (Raman et al (2020) Scientific Reports. 10:4416 published 3/10/2020; page 8, paragraph 3).
Although winter oilseed rape may have a lower polymorphism level than spring oilseed rape or fodder (Delourme page 5, left column), Gazave et al (2016) Frontiers in Plant Science. 7. 525. (published 4/21/2016, hereafter Gazave) found that less than a third of the SNPs they looked at were polymorphic across the subpopulations of spring, winter Europe, and winter Asia Brassica napus (page 3, right column, paragraph 3-page 5, left column, paragraph 1; figure 3). Minor alleles in Winter Europe Brassica napus tend to be present in only a few samples (Gazave page 5, right column, paragraph 1). The SNPs of Gazave had an average density of 1 per 27.5kb (page 8, right column, paragraph 2), shorter than the length of the regions encompassed by the instant claims.
Brassica rapa encompasses multiple subspecies (Bird et al (2017) Frontiers in Plant Science. 8:321. Published 3/13/2017, hereafter Bird; page 2, left column, paragraph 1) with considerable diversity of SNPs found within individuals and within populations (Bird table 2). Outcrossing rates between B. napus and B. rapa as high as 0.406% have been described (Xiao et al (2009) Transgenic Res. 18:733–746. Published 4/9/2009; abstract).
Given the diversity of B. rapa and the frequency of gene flow between B. rapa and B. napus, ten SNP markers between ra24982s01 and ra25063s01 do not describe the full scope of markers on or within the chromosomal interval. Even the 10 alleles of SEQ ID NO: 1-10 have not been described as present across a representative number of B. napus and B. rapa backgrounds.
Hence, Applicant has not, in fact, described markers detecting alleles SEQ ID NOs: 1-10 on or within a chromosomal interval between ra24982s01 and ra25063s01 in a B. napus plant over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Claim 15, which requires testing selected Brassica napus for the presence of SEQ ID NO: 1-10 is supported by Written Description and is not included in the rejection above.
Applicant urges that amended claims require additional steps in the method, recite that specific alleles are used in the detection step, and recite that the Brassica napus plant is a winter-type cultivar (Remarks, page 7, paragraphs 2-4).
This argument is unpersuasive, because the additional steps do not limit the breadth of the markers within Brassica napus broadly that could be within the recited chromosomal intervals and be associated with the alleles described by SEQ ID NOs: 1-10, which are not full described by the instant disclosure. The detection step in claim 1 encompasses detecting the presence or absence of alleles described by the degenerate sequences SEQ ID NOs: 1-10. The alleles, and in particular the non-resistant alleles, could be detected indirectly by a linked marker, and the instant specification has not described linked markers across the full scope of potentially linked markers across the diversity of Brassica napus. The claims do not specify whether the Brassica napus plant which is a winter-type cultivar is the resistant plant or the non-resistant plant, but even within winter-type cultivars there is a considerable amount of genetic diversity, which has not been described through structural features or provided examples such that one of ordinary skill in the art would conclude that Applicant was in possession of the full scope of Brassica napus plants having resistance to fungal pathogens and comprising a marker for detecting the presence of alleles of SEQ ID NOs: 1-10.
New Matter
Claims 1, 7-12 & 14-15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1, 7-12 & 14-15 are drawn to methods that require the steps of detecting the presence or absence of a marker, testing the selected plant for the presence of the marker, and crossing the selected plant with a plant that is not resistant. Claims 1, 7-12 & 14 comprise an additional optional step of regenerating a Brassica napus plant from the selected part (lines 8-9). Claims 1, 7-12 & 14-15 also require the Brassica napus plant is a winter-type cultivar.
The amended claims introduce three aspects not present in the originally filed claims:
A step of regenerating a Brassica napus plant from a selected plant part,
The Brassica napus plant is a winter-type cultivar, and
Testing and selecting a Brassica napus plant comprising a marker and crossing the selected plant with a not-resistant plant.
The full scope of the claimed material in these amendments are not supported in the originally filed disclosure.
1. The specification describes seeds as plant parts (page 1, paragraph 1) and describes a method of farming Brassica plants comprising planting and cultivating seed (page 26, paragraph 4-5), which could be interpreted as a method of regeneration of a plant part. However, the originally filed specification does not describe regeneration of any other plant part and therefore does not provide support for the full scope encompassed by the amendment.
2. The originally filed specification (page 27, paragraphs 1-8 & page 31, paragraph 4) describes winter-type and describes an embodiment wherein the recipient plant is a winter-type cultivar. The amended claims are indefinite as to whether the Brassica napus plant which is a winter-type cultivar is a donor plant or a recipient plant. Methods in which the donor Brassica napus plant is a winter-type cultivar are not described by the specification and constitute New Matter.
3. The original disclosure describes methods which comprise growing an identified plant (page 30, paragraph 8) and methods wherein a B. napus plant having resistance, which has been obtained by a process of introgressing LepR1, is selected or identified as having resistance (page 25, paragraphs 1-4). Example 1 (page 31, paragraph 2-page 32, paragraph 5) teaches a method of crossing and backcrossing to develop a line comprising the LepR1 gene, but the method described comprises selecting using a phenotypic assay of a cotyledon test. Once the line was established, Applicant describes mapping the resistance locus. In example 2 (page 32, paragraph 6-page 33, paragraph 5) Applicant describes a method of validating the markers; plants were genotyped for the locus and assayed for resistance, and Applicant describes applying a fixed effect approach in genomic predict to discover that LepR1 resistance lines had decreased PMR. Applicant does not describe detecting the presence or absence of at least one marker in a selected plant and crossing the selected plant with a marker with one that is not resistant to fungal pathogen in that order. Because the claims require crossing the selected plant, the steps must be performed in the recited order. This constitutes New Matter.
In response to this rejection, Applicant is required to point specifically to support for the concept in the specification or to cancel the new matter.
Applicant urges that support for amendments can be found throughout the Application as filed (Remarks, page 6, paragraph 1).
This argument is unpersuasive, because the Application as filed fails to support the full scope of the material encompassed by the amended claims.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 9-10 & 14 are rejected under 35 U.S.C. 103 as being unpatentable over Yu et al (2005) Theor Appl Genet. 110: 969–979 (published 1/27/2005, hereafter Yu) in view of Raman et al (2020) Scientific Reports. 10:4416 (published 3/10/2020, hereafter Raman), Yu et al (2012) Mol Breeding. 30:1495–1506 (published 5/5/2012, hereafter Yu 2012) and Pilet et al (1998) Theor Appl Genet. 96: 23-30 (published January 1998, hereafter Pilet) and taken with the evidence of Ghanbarnia et al (2012) Theor Appl Genet. 124:505–513 (published 10/30/2011, hereafter Ghanbarnia).
This is a new rejection necessitated by Applicant' s amendment of the claims. Applicant' s arguments filed 6/17/2026 have been fully considered below as they pertain to the new rejection, but they are not persuasive.
Claims 1, 9-10 & 14 are drawn to a method for selecting or identifying a Brassica napus plant having resistance to fungal pathogen Leptosphaeria maculans comprising detecting the presence or absence of at least one marker on or within a chromosomal interval between ra24982s01 and ra25063s01, selecting a Brassica napus plant, and crossing a selected plant having the at least one marker with a Brassica napus plant that is not resistant and a method of using a plant selected by the method comprising producing an oil.
Yu teaches a blackleg resistance loci from B. rapa subsp. sylvestris transferred to a resynthesized amphidiploid B. napus and introduced into B. napus cultivars and breeding lines (page 970, left column, paragraph 5-right column, paragraph 3). Yu teaches a method wherein resistant line 6270 was crossed with a susceptible B. napus cultivar “Springfield” to generate F1 plants from which doubled haploid lines were derived via microspore culture (page 970, right column, paragraph 3). Using a method of mapping the source of the resistance in backcrossed lines (page 970, right column, paragraph 3-page 971, left column, paragraph 1), Yu teaches that one resistance locus is LepR1 (page 972, right column, paragraph 1). Yu teaches 7 polymorphic Restriction Fragment Length Polymorphism markers on the N2 linkage group, 5 of which co-segregate with the LepR1 resistance gene (page 972, right column, paragraph 1; table 2). Yu teaches that the LepR1 resistance locus is a dominant allele (page 973, right column, paragraph 1).
Yu teaches that B. napus is an AACC amphidiploid resulting from hybridization between AA B. rapa and CC B. oleracea (page 969, right column, paragraph 1).
Yu teaches that B. napus is important for edible oil production (page 969, right column, paragraph 1). Yu teaches a motivation to select for the resistance gene, in that B. napus is susceptible to Leptosphaeria maculans infection, one of the most destructive diseases of oilseed rape crops in North America, Australia, and Europe (page 969, right column, paragraph 1) and furthermore teaches a motivation for using marker assisted breeding, because disease assessment can be conducted only once a year during the growing season and selection efficiency depends on the environment which can vary (page 977, right column, paragraph 2).
Yu does not teach the markers of SEQ ID NOs: 1-10 or detecting the presence or absence of at least one marker between ra24982s01 and ra25063s01 or a winter type Brassica napus.
Raman also teaches Leptosphaeria maculans as a major disease of Brassica napus (page 1 paragraph 2). Raman further teaches a method using DArTseq genotyping to discover segregating markers in Brassica napus lines that could be used to create a genetic linkage map for resistance (page 3, paragraph 5-page 4 paragraph 2). Raman teaches markers for QTL associated with resistance to L. maculans (table 3). Raman teaches putative candidate resistance genes as those mapped close to the physical position of markers with significant association to resistance loci (page 8, paragraph 3; table 4).
Yu 2012 teaches a method of reducing unnecessary B. rapa subsp. sylvestris background in a Brassica napus line carrying LepR1’, comprising selecting BC2 plants that were resistant to Leptosphaeria maculans and carried markers for crossing to make a BC3 generation; resistant plants of the BC3 generation were analyzed with microsatellite markers and recombinants were selected for crossing to make BC4 populations (page 1502, left column, paragraph 1). Yu 2012 teaches that N-o-1 was used as a recurrent female parent in backcrosses (page 1496, right column, paragraph 3).
Pilet teaches a method of identifying blackleg disease resistance loci in Darmor-bzh using RFLPs and RAPD markers (page 24, left column, paragraph 5-right column, paragraph 8). Pilet teaches that Darmor-bzh, a resistant parent derived from a Winter cultivar “Jet Neuf”, was crossed with a susceptible Spring inbred line “Yudal” (page 24, left column, paragraph 3). Pilet teaches different winter type B. napus cultivars with different levels of resistance to L. maculans, including the susceptible “Shogun” (page 24, right column, paragraph 1)
Ghanbarnia provides evidence that the N2 linkage group corresponds to chromosome A2 (page 506, left column, paragraph 4).
Although Yu does not teach the exact markers of ra24982s01 and ra25063s01 or SEQ ID NOs: 1-10, before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to search for and use markers that are more closely linked to the LepR1 resistance trait taught by Yu, such as using the method taught by Raman. One of ordinary skill in the art would have been motivated to map additional markers in order to identify near genes as putative resistance genes, as taught by Raman. ra24982s01 and ra25063s01 are located on chromosome A02 as is the LepR1 locus (instant specification, page 8, paragraph 1; figure 2). One of ordinary skill would have been motivated to use markers closely linked to the LepR1 locus in order to identify and select a Brassica napus plant with resistance to L. maculans even in an environment hindering disease development that would make traditional selection challenging. One of ordinary skill in the art would have had reasonable expectation of success, because sequencing, identifying markers, and mapping markers to loci was routine in the art prior to the effective filing date of the instant application.
Given the obviousness of identifying markers associated with the LepR1 resistance trait in Brassica napus, it would have been likewise obvious to use newly identified, closely associated markers to select or identify a B. napus plant with resistance to L. maculans, and to cross the selected or identified plant with a susceptible plant, as taught by Yu 2012. Although Yu and Raman do not teach the sequences of SEQ ID NOs: 1-10, the alleles themselves, in linkage with the LepR1 locus, would be indirectly detected by a marker that detects the LepR1 locus.
Finally, before the filing of the instant application, it would have been obvious for a Brassica napus plant used in the method to be a winter-type Brassia napus. One of ordinary skill in the art would have been motivated to cross a susceptible Brassica napus cultivar such as Shogun with a plant having fungal resistance in order to confer resistance to L. maculans. One of ordinary skill in the art would have had reasonable expectation of success, because crosses between winter type Brassica napus cultivars in order to confer blackleg disease resistance were taught in the art prior to the instant filing.
Thus, claim 1 is obvious in view of the known LepR1 locus and the obviousness of generating and detecting markers that would provide the allele state of loci tightly linked to LepR1. Yu’s method of mapping the LepR1 resistance gene in a line derived from a B. rapa introgression into a doubled haploid B. napus line also makes obvious the method of instant claims 9-10.
Regarding claim 14, before the time of filing of the instant application, it would have been obvious to use a plant selected by determining a marker in the region between ra24982s01 and ra25063s01 to produce and oilseed rape oil. One of ordinary skill in the art would have been motivated to use such a plant because B. napus is an important oil crop and a plant selected due to having a marker associated with blackleg resistance would be protected from one of the most destructive diseases of oilseed rape crops in North America, Australia, and Europe. One of ordinary skill in the art would have had reasonable expectation of success, because methods of using B. napus to produce oil were routine prior to the filing date of the instant application.
Claims 1, 9-10 & 14-15 are obvious over Yu, Raman, Yu 2012, and Pilet, taken with the evidence of Ghanbarnia.
Applicant urges that amended claims recite that the Brassica napus plant is a winter-type cultivar (Remarks, page 8, paragraph 2).
This argument is unpersuasive, because crossing of winter cultivars of Brassica napus, including crossing with spring varieties of Brassica napus, was routine in the art prior to the filing of the instant Application. It would have been obvious to cross a winter-type Brassica napus in order to confer resistance to blackleg disease.
Applicant urges that the LepR1 gene is one of few genes that has not been broken by the Blackleg pathogen. Applicant urges that it is unexpected that the LepR1 gene has not yet been broken and continues to convey stable resistance. Applicant urges that this result would not be expected given Alnajar’s recommendation to take steps to preserve the efficacy of LepR1 (Remarks, page 8, paragraph 3-page 9, paragraph 2).
This argument is unpersuasive, because the LepR1 gene was known to confer resistance prior to filing, making methods of breeding for plants with the LepR1 gene and resistance to Blackleg obvious.
Applicant urges that the alleles recited in SEQ ID NOs: 1-10 are the most efficacious in determining the presence of the gene with minimal linkage drag, and one of ordinary skill in the art would not have any reasonable expectation of success that the claimed alleles would be able to determine the presence of LepR1 given that the cited references do not teach, disclose, or suggest these alleles (Remarks, page 9, paragraph 2-page 10, paragraph 1).
This argument is unpersuasive, because searching for and identifying alleles in linkage with a resistance locus was a routine practice before the filing of the instant application. It would have been obvious to one of skill in the art to search for additional markers in order to breed resistant Brassica napus with reduced genetic contribution from Brassica rapa, as taught by the prior art. In order for the instantly claimed alleles to be non-obvious over the prior art, Applicant would need to provide evidence that one of ordinary skill in the art would have found linkage between the resistance locus and the recited alleles surprising, not merely that the prior art was silent with respect to these exact polymorphisms. Applicant is reminded that evidence presented after final will not be considered unless Applicant can provide sufficient justification for why such material could not have been earlier provided.
Claims 7-8 & 11-12 are rejected under 35 U.S.C. 103 as being unpatentable over Yu, Raman, Yu 2012, and Pilet taken with the evidence of Ghanbarnia as applied to claims 1, 9-10 & 14 above, and further in view of Zhou et al (2003) Improvement of new and traditional industrial crops by induced mutations and related biotechnology, IAEA-TECDOC-1369. International Atomic Energy Agency, Vienna, pages 125-131 (published 8/2003, hereafter Zhou).
This is a new rejection necessitated by Applicant’s amendments.
Claims 7-8 & 11-12 are drawn to a method of selecting for a recombination event in a Brassica plant obtained by introgressing LepR1 from a donor plant wherein the plant does not retain a second chromosomal interval derived from the donor plant, a method for selecting or identifying a Brassica napus plant, and a method comprising detecting at least two markers.
The teachings of Yu, Raman, Yu 2012, Pilet, and Ghanbarnia are presented above. Yu 2012 teaches a method to reduce unnecessary B. rapa subsp. sylvestris background in a Brassica napus line into which a resistance locus has been introgressed (page 1502, left column, paragraph 1). However, they do not teach selecting for a recombination event between ra24982s01 and ra25063s01 in a plant that does not retain a second chromosomal interval derived from the donor plant.
Zhou teaches that Brassica napus is the most important oil crop in China and desirable cultivars with low glucosinolate and low erucic acid need to be improved further with regards to yield potential and disease resistance (page 125, paragraph 2). Zhou teaches that novel breeding procedures for a backcross breeding program is one way to obtain yield capacity and disease resistance in these desirable cultivars (page 125, paragraph 2).
However, Zhou also teaches that it is difficult to remove chromosomal segments linked to target genes via backcrossing and a 10cM donor segment flanking a target gene can be expected even after 20 backcross generations (page 126, paragraph 1). Zhou teaches that linkage drag of undesirable genomic segments can prevent backcross projects’ products from reaching practical utilization (page 125, paragraph 1). Zhou teaches that using molecular markers to identify recombinants with minimum linkage drag can increase the probability of obtaining backcross products with minimum linkage drag (page 126, paragraph 2).
Before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of identifying a resistant plant with markers linked to the LepR1 region taught by Yu, Yu 2012, Pilet and Raman to further select a plant that does not exhibit any negative phenotypic properties associated with linkage drag (instant claim 12) or a second chromosomal interval derived from the donor plant (instant claim 11) that may be associated with a negative phenotypic property. One of ordinary skill would have been motivated to select a plant such a plant because linkage drag can prevent backcross lines from reaching practical utilization.
Additionally, one would have been motivated to select for a recombination event on or within the chromosomal interval between ra24982s01 and ra25063s01 (claim 11) because Yu teaches that introgression of a LepR1 locus from B. rapa in a region that encompasses these markers confers resistance. One of ordinary skill in the art would have had reasonable expectation of success in modifying the method, because identifying and using molecular markers in breeding methods was routine in the art before the effective filing of the instant application.
Finally, claims 7 and 8, drawn to the method comprising detecting at least two markers within the specific intervals, are obvious, because mapping closer markers to the LepR1 locus is obvious, as presented above, and detecting markers flanking the target locus would enable selection of plants with reduced linkage drag on both sides of the target locus.
Thus, claims 1, 7-12 & 14 are obvious over Yu, Raman, Yu 2012, Pilet, Zhou, and Ghanbarnia.
Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over Yu, Raman, Yu 2012, Pilet and Ghanbarnia as applied to claims 1, 9-10 & 14 above, and further in view of NCBI Reference Sequence XM_013851230.2 (available 10/4/2017).
Claim 15 is drawn to a method of using at least one marker of SEQ ID NO: 1-10 comprising selecting a Brassica napus plant having resistance to L. maculans, testing the plant for the presence of the at least one marker, crossing the plant with a plant that is not resistant, wherein the plant is a winter-type cultivar.
The teachings of Yu, Raman, Yu 2012, Pilet and Ghanbarnia are presented above. They do not teach detecting a marker selected from SEQ ID NOs: 1-10.
NCBI Reference Sequence XM_013851230.2 teaches a Brassica napus disease resistance protein RPS6 mRNA comprising a sequence that is 95% identical to instant SEQ ID NO: 4. See alignment below. The degenerate bases of instant SEQ ID NO: 4 encompass the sequence of comprised within NCBI Reference Sequence XM_013851230.2. NCBI Reference Sequence XM_013851230.2 teaches that this resistance protein is located on chromosome A2.
Alignment statistics for match #1
Score
Expect
Identities
Gaps
Strand
169 bits(91)
3e-46
96/101(95%)
0/101(0%)
Plus/Plus
Query 1 TCYACATTTSGGCAAGACTATCCACCTGAATGTTTTAGAGAGCTTGCTTTYGAAGTGGTA 60
|| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct 1221 TCCACATTTCGGCAAGACTATCCACCTGAATGTTTTAGAGAGCTTGCTTTCGAAGTGGTA 1280
Query 61 ACTWACCATACTCCTTTTAGTCTTAATKTTTTGGGTTGGTG 101
||| ||||||||||||||||||||||| |||||||||||||
Sbjct 1281 ACTAACCATACTCCTTTTAGTCTTAATTTTTTGGGTTGGTG 1321
Before the filing of the instant application, it would have been obvious to one of ordinary skill in the art to search for and use markers that are more closely linked to the LepR1 resistance trait taught by Yu 2005, such as using the method taught by Raman. One of ordinary skill in the art would have been motivated to map additional markers in order to identify near genes as putative resistance genes, as taught by Raman. ra24982s01 and ra25063s01 are located on chromosome A02 as is the LepR1 locus and the Brassica napus disease resistance protein RPS6. Because the sequence of the marker SEQ ID NO: 4 is found in the genomes of B. napus and/or B. rapa plants, the sequences would have been obvious to one of ordinary skill in the art who was sequencing and generating markers in this region in order to perform marker assisted selection on the LepR1 trait. One of ordinary skill would have been motivated to use markers closely linked to the LepR1 resistance locus, including a marker that is the sequence of an RPS6 gene, in order to identify and select a Brassica napus plant with resistance to L. maculans even in an environment hindering disease development that would make traditional selection challenging. One of ordinary skill in the art would have had reasonable expectation of success in using such a sequence as a marker, because the mRNA sequence of the RPS6 gene was known prior to the filing of the instant application, and sequencing, identifying markers, and mapping markers to loci was routine in the art.
Thus, a method comprising selecting a plant with resistance to L. maculans, testing for the presence of a marker that is in an RPS6 gene, and crossing the selected plant with a plant that is not resistant would have been obvious to one of ordinary skill in the art. Additionally, the Brassica napus plant being a winter-type cultivar would have been obvious as presented above.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-4pm EDT.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/VICTORIA L DELEO/Examiner, Art Unit 1662
/Anne Kubelik/Primary Examiner, Art Unit 1663
Prosecution Insights