DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the claims: Applicant’s amendment to the claims filed 06/29/2026 are as follows: (a) claim(s) 17-20, 29, 30, 33, and 36 are amended; (b) claim(s) 21, 23-28, 31, 32, 34, and 35 are cancelled; (c) applicant alleges that claims 38-50 are newly added (p. 13 line 4 of the remarks), however, claim 37 is new, and claims 48-50 were not added, thus claim(s) 37-47 were newly added.
Accordingly, claim(s) 17-20, 22, 29-30, 33, and 36-47 are pending.
Applicant’s arguments filed 06/29/2026 have been thoroughly reviewed, but are not persuasive for the reasons that follow. Any rejections and objections not reiterated in this action have been withdrawn. This action is FINAL.
Election/Restrictions
Applicant’s election without traverse of Group I in the reply filed on 02/12/2026 is acknowledged. Group I is being considered to the extent that the claims are drawn to an isolated mutant polypeptide and not to the extent that they read on a nucleotide sequence encoding a polypeptide.
Claim(s) 20, 22, and 36 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected groups II-VII, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 02/12/2026.
Newly added claim(s) 37-47 of the current claim set filed 06/29/2026, reads on Group I.
Claim(s) 17-19, 29-30, 33, and 37-47 are under consideration.
Priority
Acknowledgement is made that this application is a 371 of PCT/CN2021/131279 filed 11/17/2021 and claims priority based on foreign application filed as CN202110912085.0 on 08/10/2021.
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency #1 - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing or incomplete. See item 1) a) or 1) b) above.
The statement recite “xml format” and “xml copy”, however, the SEQ LISTING is ST.25 and a TXT file.
The size of the file is recited in kilobytes, not bytes. The statement should recite, “159,387 bytes”.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Response to Arguments – Nucleotide and/or Amino Acid Sequence Disclosure
The lack of compliance with ST.25 for the Nucleotide and/or Amino Acid Sequence Disclosure, i.e., sequences in figures 19, 22, and 24 without corresponding SEQ ID NOs has been remedied through Applicant supplying a replacement specification with the corresponding SEQ ID NOs for insertion into the brief description of the drawings filed 06/29/2026.
Acknowledgement is made of Applicant submitting a Sequence listing(s), filed 06/29/2026, 07/31/2026, and 09/18/2026.
Regarding the 06/29/2026 submission, Applicant submitted a corresponding SEQUENCE LISTING statement reciting the following:
The instant application contains a Sequence Listing which has been filed electronically in xml format and is hereby incorporated by reference in its entirety. Said xml file, created on June 23, 2026, is named Q284424 Substitute sequence listing as filed.txt and is 258 KB in size.
This amendment has been entered and subsequently replaced by the 07/31/2026 submission. This application is being examined as an ST.25 application, which requires TXT filing and not XML. A CRFD was mailed 07/08/2026 stating the defective reason.
Regarding the 07/31/2026 submission, Applicant submitted a corresponding SEQUENCE LISTING statement reciting the following:
The instant application contains a Sequence Listing which has been filed electronically in xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on July 23, 2026, is named Q284424 Substitute sl.xml and is 156 KB in size.
This amendment has been entered and subsequently replaced by the 09/18/2026 submission. This application is being examined as an ST.25 application, which requires TXT filing and not XML. The SEQ LISTING also contained insufficient response for numeric identifier <223> for SEQ ID NOs: 179-186. A CRFD was mailed 08/03/2026 stating the defective reason.
Regarding the 09/18/2026 submission, Applicant submitted a corresponding SEQUENCE LISTING statement reciting the following:
The instant application contains a Sequence Listing which has been filed electronically in xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on September 7, 2026, is named Q284424 SQLDOC.txt and is 156 KB in size.
This amendment has been entered and is non-compliant for the reasons listed above (see Nucleotide and/or Amino Acid Sequence Disclosure above).
Specification – New
Minor Informalities
The disclosure is objected to because of the following informalities: The amendments to the specification filed 06/29/2026 are objected to because of the following:
Under the amended brief description of drawings Fig. 22, “SEQ ID NO: 168 . . . (sg5)” should include sg7 as well. It would be remedial to have this section recite “SEQ ID NO: 168 . . . (sg5,sg7)”.
Under the amended brief description of drawings Fig. 24, the SEQ ID NOs do not have descriptors relating to where in the figure they are position. It would be remedial to amend this description to be consistent with the description of Fig. 22.
Appropriate correction is required.
Response to Arguments – Specification
The previous objection to abstract for minor informalities, has been withdrawn in view of Applicant’s amendments filed 06/29/2026.
Claim Objections – New
Claim 19 is objected to because of the following informalities: recites “A isolated fused protein”. It would be remedial to amend the claim to recite “An isolated fused protein”.
Claim 29 is objected to because of the following informalities: recites “. . . comprising an effective amount of at least one of a mutant polypeptides according to claim 17.”. It would be remedial to amend the claim to recite “. . . comprising an effective amount of at least one mutant polypeptide according to claim 17.”, to improve grammar.
Claim(s) 39, 40, 41, 42 44, 45, and 46 are objected to because of the following informalities: the claims listed have an additional indent in line 2 that is not consistent with the other claims. It would be remedial to remove the indentation of line 2.
Claim 37 is objected to because of the following informalities: for consistency between claims “and wherein” should be inserted after “. . . used for gene editing,” before “an editing window”.
Claim 39 is objected to because of the following informalities: “also” should be replaced with “further” for consistency between claims.
Claim 40 is objected to because of the following informalities: “. . . or at least 99.9% or 100% sequence identity with an amino acid sequence shown as SEQ ID NO: 7.”, should be amended to recite “with the amino acid sequence of SEQ ID NO: 7.” It is of note that this is a claim objection instead of a 35 U.S.C. 112(a) written description rejection because one of skill in the art would understand that a linker can be as short as a dipeptide or even one amino acid.
Claim 41 is objected to because of the following informalities: “. . . or at least 99.9% or 100% sequence identity with a sequence shown as SEQ ID NO: 13.”, should be amended to recite “with the sequence of SEQ ID NO: 13.” It is of note that this is a claim objection instead of a 35 U.S.C. 112(a) written description rejection because claim 17 sets forth the breadth of the sequence to include the three fragments (N-terminal, TadA8e and C-terminal). One of skill would understand that each fragment could not be less than a defined number of amino acids to have at least 90% sequence identity to the sequences corresponding to said fragments (e.g., SEQ ID NOs: 1, 3, and 5) (see claim 17 interpretation below).
Appropriate correction is required
Response to Arguments – Claim Objections
The previous objections of claim(s) 17, 29, and 30 has been withdrawn in view of Applicant’s amendments to the claims filed 06/29/2026.
Claim Rejections - 35 USC § 112(b) – Indefiniteness - New
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim(s) 17-19, 29-30, 33, and 37-47 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 17, the metes and bounds of the limitation “wherein the SpRY(D10A) polypeptide consists of a deletion of residues located at 1048th site to the 1063rd site in SpRY(D10A). . .” are unclear.
The specification does not provide an amino acid sequence of the “full” SpRY(D10A) protein/polypeptide for one of skill to properly interpret (1) what is covered by a “fragment” of the polypeptide of SpRY(D10A), and consequently (2) the structure of the claim regarding “a deletion of residues located at the 1048th site to the 1063rd site”. The specification provides SEQ ID NO: 1 which relates to the N-terminal fragment of SpRY(D10A), however this sequence is only 1046 amino acids. The specification provides SEQ ID NO: 13 which is defined as the mutant polypeptide, however the “TadA8e” domain starts at amino acid site 1079 (see alignment below).
PNG
media_image1.png
328
646
media_image1.png
Greyscale
Accordingly, the metes and bounds of claim 17 are unclear.
To obviate this rejection, claim 17 can be amended to recite the following:
“An isolated mutant polypeptide, comprising: an N-terminal fragment of a SpRY(D10A) protein, a TadA8e fragment, and a C-terminal fragment of the SpRY(D10A) protein in sequence from the N-terminus to the C-terminus; wherein
the mutant polypeptide comprises an amino acid sequence that has at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 13.”
Of note: If this language is used, it would be remedial to amend claim 41 to remove “at least 90%” since this is now a limitation of claim 17, and to cancel or amend claim(s) 39-40 (see the 35 U.S.C. 112(d) rejection below) since the suggested claim language contains the linker of claims 39 and 40 within SEQ ID NO: 13.
Accordingly, claim(s) 18-19, 29-30, 33, and 37-47 are rejected for being dependent upon claim 17.
Regarding claim(s) 37, 38, 46, and 47, the term “about” is a relative term which renders the claim indefinite. The term “about” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The lower limit of the editing window is unclear because the term “about” does not have an associated definition of either (a) ± a number of positions or (b) ± a percentage relative to the number “about” is modifying.
Response to Arguments – Claim Rejections - 35 USC § 112(b) – Indefiniteness
The previous rejection of claim(s) 18-19, 29-30, and 33 under 35 U.S.C 112(b) for reciting (a) the phrase “preferably” in claims 18-19, 29-30, and 33; and (b) insufficient antecedent basis in claims 29-30 has been withdrawn in view of Applicant’s amendments to the claims filed 06/29/2026.
Claim Rejections - 35 USC § 112(a) – Written Description - New
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim(s) 42-43 and 45 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, Applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117.
Claim 42 and 43 is drawn to a genus of “a sequence of the RNA comprises a sequence that is at least 90% . . . sequence identity with a sequence shown as SEQ ID NO: 18 to SEQ ID NO: 65” for guiding the mutant polypeptide of claim 17. The rejected claims thus comprise a genus of “a sequence” and are defined as belonging to the broad class of “a sequence” and as having the function of guiding the mutant polypeptide of claim 1.
Claim 45 is drawn to a genus of “a sequence of the RNA comprising a sequence that is at least 90% . . . sequence identity with a sequence shown as SEQ ID NO: 18 to SEQ ID NO: 65” for a base editing system. The rejected claims thus comprise a genus of “a sequence” and are defined as belonging to the broad class of “a sequence” and as having the function of being included in a base editing system (i.e., guiding the mutant polypeptide of claim 1 to base edit).
To satisfy the written description requirement, MPEP §2163 states, in part “… a patent
specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention.” Moreover, the written description requirement for a genus may be satisfied through sufficient description of a representative number of species by “… disclosure of relevant, identifying characteristics, i.e.,
structure or other physical and/or chemical properties, by functional characteristics coupled with
a known or disclosed correlation between functional and structure, or by a combination of such
identifying characteristics, sufficient to show the applicant was in possession of the claimed genus.”
The specification envisions the “a sequence of the RNA comprises a sequence that is at least 90% . . . sequence identity with a sequence shown as SEQ ID NO: 18 to SEQ ID NO: 65” as the following:
“The CRISPR/Cas9 system is composed of two parts, i.e., Cas9 nuclease and sgRNA that recognizes a target sequence. The complementary pairing between the sgRNA and the target sequence mediates the directional cleavage of the genome by Cas9 nuclease to cause double-strand break (DSB) of DNA, and homologous recombination (with a template) and non-homologous end joining (without a template) are performed by the correction mechanism in cells, thereby achieving editing of target sites[1, 2].”, (p.1, para 1).
“In some embodiments, a sequence of the sgRNA comprises the sequence shown in SEQ IDNO: 18 to SEQ IDNO: 65.”, (p. 10, last two lines).
“In some embodiments, the sequence of the sgRNA comprises the sequence shown as any one of SEQ ID NO: 18 to SEQ IDNO: 65.”,(p. 11, lines 17-18).
“48 types of sgRNA were designed according to the PAM characteristics of SpRY nuclease with reference to the human genome sequence, which covered 16 different PAM sequences. sgRNA sequences are shown as SEQ ID NO: 18 to SEQ ID NO: 65.”, (p. 20, under example 2).
“The cells in each well were transfected with 600 ng of base editor plasmids and 300 ng of sgRNA plasmids (sequences of sgRNAl to sgRNA48 are shown as SEQ ID NO: 18 to SEQID NO: 65). . .”, (p. 21, under section 2.2).
Also see Table 1.
Even if one accepts that the examples described in the specification meet the claim limitations of the rejected claims in regard to structure and function, the examples are only representative of the fully enumerated sequences of SEQ ID NO: 18-65, and/or sequences that comprise SEQ ID NOs: 18-65, used for guiding the mutant polypeptide. These results are not necessarily predictive of all “sequence of the RNA comprises a sequence that is at least 90% . . . sequence identity with a sequence shown as SEQ ID NO: 18 to SEQ ID NO: 65” capable of guiding the mutant polypeptide. Thus, it is impossible for one to extrapolate from the provided examples of fully enumerated sequences of SEQ ID NO: 18-65, and/or sequences that comprise SEQ ID NOs: 18-65 described herein that the genus of “a sequence” would necessarily meet the structural/functional characteristics of the rejected claims.
The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of “a sequence” capable of guiding a mutant polypeptide.
It is well-understood by one in the art that “Sequence” in molecular biology refers broadly to the ordered arrangement of nucleotides in a DNA or RNA molecule, without an
inherent lower or upper numerical limit on length. BOC Sciences (Nucleotide Sequence: Definition, Classification, and Detection – Boc Sciences, Pages 1-8; Accessed May 27th, 2026) defines a nucleotide sequence as “[T]he order of the bases in DNA or RNA.”, (see page 1) and similarly defines bases (nucleotides), as “Nucleotide sequences include the sequence of A, T, G, and C in DNA. . .” Because these definitions are based on ordered arrangement, of ATGC, rather than length, even very short arrangements of nucleotides constitute “a sequence”.
For example, the National Human Genome Research Institute (Definition of Codon, www.genome.gov/genetics-glossary/Codon; Accessed May 27th, 2026) defines a codon as “[A] DNA or RNA sequence of three nucleotides (a trinucleotide) that forms a unit of genomic information encoding a particular amino acid or signaling the termination of protein synthesis (stop signals). There are 64 different codons: 61 specify amino acids and 3 are used as stop signals.”, (see page 2). Hence, a sequence may consist of as few as three nucleotides.
Thus, “a sequence of the RNA compris-es/ing a sequence that has at least 90% . . . sequence identity with a sequence shown as SEQ ID NO: 18 to SEQ ID NO: 65.”, broadly encompasses “. . . a sequence of three or more RNA nucleotides compris-es/ing a sequence of three or more RNA nucleotides that has at least 90% . . . sequence identity with a sequence of three or more RNA nucleotides shown as SEQ ID NO: 18 to SEQ ID NO: 65.”
Jiawei Jv et al (The length of guide RNA and target DNA heteroduplex effects on CRISPR/Cas9 mediated genome editing efficiency in porcine cells, J Vet Sci, vol 20, issue 3, pages 1-9, published May 3rd, 2019) teaches “To illustrate this issue, guide RNAs of different lengths targeting the EGFP gene were designed. Specifically, guide RNAs of 17 nt or longer were sufficient to direct the Cas9 protein to cleave target DNA sequences, while 15 nt or shorter guide RNAs had loss-of-function.”, (abstract, fig. 1a and fig. 2a-f).
Accordingly, the art does not teach 3 to 14 nucleotides capable of guiding a mutant polypeptide.
Therefore, the art does not appear to offset the deficiencies of the specification. Merely describing a “a sequence of the RNA comprises a sequence that is at least 90% . . . sequence identity with a sequence shown as SEQ ID NO: 18 to SEQ ID NO: 65” capable of guiding the mutant polypeptide without sufficient detail relating to the genus of “a sequence” in guiding the mutant polypeptide does not allow the skilled artesian to reasonably conclude that the Applicants were in possession of the claimed invention in claim(s) 42-43 and 45.
One way to obviate the rejection of claim 42 is to amend the claim to recite:
“The composition according to claim 29, wherein the composition further comprises a RNA, wherein the RNA comprises a sequence that has at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity with a sequence from the group consisting of SEQ ID NO: 18 to SEQ ID NO: 65.”
One way to obviate the rejection of claim 45 is to amend the claim to recite:
“The base editing system according to claim 44, wherein the RNA comprises a sequence that has at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity with a sequence selected from the group consisting of SEQ ID NO: 18 to SEQ ID NO: 65.”
Claim Rejections - 35 USC § 112(d) – Improper Claim Dependency - New
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim(s) 39-40 and 43 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 39 is dependent upon claim 17, which recites “. . . wherein the SpRY(D10A) polypeptide consists of a deletion of residues located at 1048th site to the 1063rd site in SpRY(D10A) and the TadA8e fragment is the substitute fragment of such deleted residue region of SpRY(D10A).” If a linker peptide was substituted between the N-terminal fragment, the TadA8e would no longer be located at the “1048th” position. Thus, claim 39 does not properly further limit claim 17. Claim 40 is rejected for being dependent upon claim 39.
Claim 43 is dependent upon claim 42 which sets forth “RNA” with sequences shown as SEQ ID NOs: 18-65. SEQ ID NOs: 18-65 are guide RNAs as defined in their sequence listing. Thus, claim 43 does not further limit the RNA that is set forth in claim 42.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Interpretation – New
(1) Since the metes and bounds of claim 17 are unclear (see above 35 USC 112(b) rejection), claim 17 is being interpreted as “An isolated mutant polypeptide, comprising: an N-terminal fragment of a SpRY(D10A) protein, a TadA8e fragment, and a C-terminal fragment of the SpRY(D10A) protein in sequence from the N-terminus to the C-terminus; wherein
the mutant polypeptide comprises an amino acid sequence that has at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 13.”
(2) SpRY (D10A) N- and C- terminal “fragments” as well as the TadA8e “fragment” are not defined by the claim, thus, looking to the specification, the breadth of claim 17 includes embodiments wherein the amino acid sequence of the N-terminal fragment of SpRY (D10A) protein has at least 90% sequence identity with an amino acid sequence show as SEQ ID NO: 1; wherein the amino acid sequence of TadA8e fragment has at least 90% sequence identity with an amino acid sequence shown as SEQ ID NO: 3; and embodiments wherein the amino acid sequence of the C-Terminal fragment of SpRY (D10A) protein has at least 90% sequence identity with an amino acid sequence show as SEQ ID NO: 5, (see page 3, first paragraph of the instant specification).
(3) Claims 42 and 45 “a sequence of the RNA compris-es/ing a sequence that has at least 90% or at least 91% or at least 92% or at least 93% or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or at least 99.5% or at least 99.8% or at least 99.9% or 100% sequence identity with a sequence shown as SEQ ID NO: 18 to SEQ ID NO: 65.”
It is well-understood by one in the art that “Sequence” in molecular biology refers broadly to the ordered arrangement of nucleotides in a DNA or RNA molecule, without an
inherent lower or upper numerical limit on length. BOC Sciences (supra) defines a nucleotide sequence as “[T]he order of the bases in DNA or RNA.”, (see page 1) and similarly defines bases (nucleotides), as “Nucleotide sequences include the sequence of A, T, G, and C in DNA. . .” Because these definitions are based on ordered arrangement, of ATGC, rather than length, even very short arrangements of nucleotides constitute “a sequence”.
For example, the National Human Genome Research Institute (supra) defines a codon as “[A] DNA or RNA sequence of three nucleotides (a trinucleotide) that forms a unit of genomic information encoding a particular amino acid or signaling the termination of protein synthesis (stop signals). There are 64 different codons: 61 specify amino acids and 3 are used as stop signals.”, (see page 2). Hence, a sequence may consist of as few as three nucleotides. Thus, “a sequence of the RNA compris-es/ing a sequence that has at least 90% . . . sequence identity with a sequence shown as SEQ ID NO: 18 to SEQ ID NO: 65.”, is interpreted as, “. . . a sequence of three or more RNA nucleotides compris-es/ing a sequence of three or more RNA nucleotides that has at least 90% . . . sequence identity with a sequence of three or more RNA nucleotides shown as SEQ ID NO: 18 to SEQ ID NO: 65.”
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 17-19, 29-30, 33, and 37-47 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Gaudelli et al (US 2021/0130805 A1, published May 6th, 2021, Filed December 18th, 2020; listed under US Patent Documents on the 892 form from 12/29/2025). This rejection was made in the Office Action mailed 04/02/2026 and has been rewritten to include the amendments and new claims from the reply filed 06/29/2026.
Of note:
claim 17 is being interpreted as the following:
“An isolated mutant polypeptide, comprising: an N-terminal fragment of a SpRY(D10A) protein, a TadA8e fragment, and a C-terminal fragment of the SpRY(D10A) protein in sequence from the N-terminus to the C-terminus; wherein
the mutant polypeptide comprises an amino acid sequence that has at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 13.”
SpRY (D10A) N- and C- terminal “fragments” as well as the TadA8e “fragment” are
not defined by the claim, thus, looking to the specification, the breadth of claim 17 includes embodiments wherein the amino acid sequence of the N-terminal fragment of SpRY (D10A) protein has at least 90% sequence identity with an amino acid sequence show as SEQ ID NO: 1; wherein the amino acid sequence of TadA8e fragment has at least 90% sequence identity with an amino acid sequence shown as SEQ ID NO: 3; and embodiments wherein the amino acid sequence of the C-Terminal fragment of SpRY (D10A) protein has at least 90% sequence identity with an amino acid sequence show as SEQ ID NO: 5, (see page 3, first paragraph of the instant specification).
Regarding claim(s) 42 and 45, “a sequence of the RNA comprising(or comprises) a
sequence” is broadly interpreted as any sequence of 3 nucleotides or more.
Regarding claim 40, “a sequence of the linker has at least . . . sequence identity with
an amino acid sequence shown as SEQ ID NO: 7.”, is broadly interpreted as any dipeptide or longer.
Regarding claim 17-19 and 39-41, Gaudelli et al teaches, “In various embodiments of the above aspects, the polynucleotide programmable DNA binding domain is a nuclease inactive or nickase variant. In various embodiments of the above aspects, the nickase variant comprises an amino acid substitution D10A or a corresponding amino acid substitution thereof… In various embodiments, the adenosine deaminase variant is a TadA deaminase. In various embodiments of the above aspects, the TadA deaminase is TadA*7.10. In various embodiments, the TadA deaminase is a TadA*8 variant. adenosine deaminase variant is capable of deaminating adenine in deoxyribonucleic acid (DNA)…”, (see paragraphs [0011] and [0012]).
Gaudelli et al further teaches, “A fusion protein comprising: an adenosine deaminase variant domain, wherein the adenosine deaminase variant domain comprises the amino acid sequence of: … , wherein the amino acid sequence comprises at least one alteration, and a Cas9 or a Cas12 polypeptide, wherein the adenosine deaminase variant domain is inserted within the Cas9 or the Cas12 polypeptide... In some embodiments, the adenosine deaminase variant domain is flanked by a N-terminal fragment and a C-terminal fragment of the Cas9 polypeptide. In some embodiments, the fusion protein comprises the structure: NH.sub.2—[N-terminal fragment of a Cas9]-[adenosine deaminase variant]-[C-terminal fragment of a Cas9]-COOH, wherein each instance of “]-[” is an optional linker. In some embodiments, the N-terminal fragment or the C-terminal fragment of the Cas9 or Cas12 polypeptide binds a target polynucleotide sequence.”, (see paragraphs [0015] to [0017]).
PNG
media_image2.png
310
782
media_image2.png
Greyscale
Gaudelli et al teaches SEQ ID NO: 215 which is 96.1% similar to SEQ ID NO: 13 of the instant application (see below).
PNG
media_image3.png
236
786
media_image3.png
Greyscale
PNG
media_image4.png
312
801
media_image4.png
Greyscale
PNG
media_image5.png
230
795
media_image5.png
Greyscale
PNG
media_image6.png
164
634
media_image6.png
Greyscale
Further, SEQ ID NO: 215 of Gaudelli et al comprises SEQ ID NOs: 1, 3, 5, and 7 with sequence similarities above 90%. See the alignments below.
Regarding claim 29, Gaudelli et al teaches composition comprising an effect amount of the mutant polypeptides (see paragraphs [0804] and [0808]).
Regarding claim 30 and 44, Gaudelli et al teaches, a base editing system, “In one aspect, the invention provides a base editor comprising any of the fusion polypeptides provided herein in a complex with one or more guide polynucleotides.”, (see paragraph [0031]).
Wherein Gaudelli et al teaches that a guide polynucleotide is also known as a gRNA (see paragraph [0036]).
Regarding claim 33, Gaudelli et al teaches a gene editing method characterized in the gene editing is performed with the base editing system discloses, “ In one aspect, the invention provides a method of treating a genetic defect in a subject, the method comprising administering to the subject a base editor comprising or consisting essentially of any of the fusion proteins provided herein, or a polynucleotide encoding said base editor and one or more guide polynucleotides that direct the base editor to deaminate a target nucleobase in a target nucleotide sequence of the subject, thereby treating the genetic defect.”, (see paragraph [0035]).
Regarding claim(s) 37-38 and 46-47, Gaudelli et al teaches, “In some embodiments, the target region comprises a target window, wherein the target window comprises the target nucleobase pair. In some embodiments, the target window comprises 1-10 nucleotides.”, (para [0538]).
Regarding claim(s) 42 and 43, Gaudelli et al teaches, “In some embodiments, the guide polynucleotide comprises a nucleic acid sequence selected from the group consisting of: a) GACCUAGGCGAGGCAGUAGG; b) CCAGUAUGGACACUGUCCAAA;. . . In various embodiments, the guide RNA comprises a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA).”, (see para [0036]). Wherein a) above reads on nucleotides 1-4 of SEQ ID NO: 25
PNG
media_image11.png
166
670
media_image11.png
Greyscale
(see alignment below).
Regarding claim 45, Gaudelli et al teaches, “In one aspect, the invention provides a method of treating a genetic defect in a subject, the method comprising administering to the subject a base editor comprising or consisting essentially of any of the fusion proteins provided herein, or a polynucleotide encoding said base editor and one or more guide polynucleotides that direct the base editor to deaminate a target nucleobase in a target nucleotide sequence of the subject, thereby treating the genetic defect. In some embodiments, the guide polynucleotide comprises a nucleic acid sequence selected from the group consisting of: a) GACCUAGGCGAGGCAGUAGG; . . .”, (para [0035] to [0036]). Sequence a) reads on SEQ ID NO: 25 (see alignment above).
Accordingly, claim(s) 17-19, 29-30, 33, and 37-47 are anticipated by Gaudelli et al.
Response to Arguments - Claim Rejections - 35 USC § 102
The previous rejection of claim(s) 17-19, 29-30, and 33 under 35 U.S.C. 102 (a)(1) as being anticipated by Gaudelli et al (supra) is maintained in view of Applicant’s amendments filed on 06/29/2026.
Applicant's arguments starting on page 16 of the reply filed 06/29/2026 have been fully considered but they are not persuasive.
Applicant contends that (1) there are unique mutations in the TadA8e domain and that Gaudelli et al does not disclose, teach, nor suggest the specific TadA deaminase variant having said unique combination of mutations, namely: A109S, T111R, D119N, H122N, Y147D, F149Y, T166I, and D167N.
In response to Applicant’s first contention that the reference fails to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., a TadA8e mutant having the following mutations A109S, T111R, D119N, H122N, Y147D, F149Y, T166I, and D167N ) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Claim 17 recites a TadA8e “fragment”. A fragment (i.e., a shorter version) of a protein can be a mutant. Also, a reasonable interpretation of a fragment could be a dipeptide, to which then such fragment would not structurally be limited by the mutations recited in Applicant’s arguments.
A way to ensure the unique combination of the TadA8e mutations are included in the scope of the claim would be to define the TadA8e fragment by its corresponding SEQ ID NO.
Further, Applicant contends that (2) the present invention employs an SpRY variant of Cas9 (D10A) that contains an engineered relaxed PAM recognition sequence which specifically incorporates the following mutations: D10A, A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, and T1337R, and that SpRY variant lacks amino acids from positions 1048 to 1063, which is not disclosed in Gaudelli et al.
In response to Applicant’s second contention that the reference fails to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., a SpRY(D10A) variant having the following mutations : D10A, A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, and T1337R, and that SpRY variant lacks amino acids from positions 1048 to 1063) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Claim 17 recites a SpRY(D10A) polypeptide “fragment” (N- or C-terminal). A fragment (i.e., a shorter version) of a protein can be a mutant. Also, a reasonable interpretation of a fragment could be a dipeptide, to which then such fragment would not structurally be limited by the mutations recited in Applicant’s arguments.
A way to ensure the unique combination of the SpRY(D10A) mutations are included in the scope of the claim would be to define the N- and C- terminal fragments by their corresponding SEQ ID NO.
Lastly, Applicant contends that (3) the amended claims expressly require that the TadA8e fragment is positioned as a substitute for the deleted region of SpRY (D10A) polypeptide and that Gaudelli et al broadly lists potential insertion sites for the deaminase but Gaudelli et al does not teach nor suggest the precise deletion of the SpRY residues at 1048-1063 and the substitution of that exact region with a TadA8e fragment.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the metes and bounds of the newly added claim limitation, i.e., insertion of the TadA8e fragment at residue 1048-1063 of the SpRY(D10A) polypeptide, are unclear.
PNG
media_image1.png
328
646
media_image1.png
Greyscale
The specification does not provide an amino acid sequence of the “full” SpRY(D10A) protein/polypeptide for one of skill to properly interpret (1) what is covered by a “fragment” of the polypeptide of SpRY(D10A), and consequently (2) the structure of the claim regarding “a deletion of residues located at the 1048th site to the 1063rd site”. The specification provides SEQ ID NO: 1 which relates to the N-terminal fragment of SpRY(D10A), however this sequence is only 1046 amino acids. The specification provides SEQ ID NO: 13 which is defined as the mutant polypeptide, however the “TadA8e” domain starts at amino acid site 1079 (see alignment below).
Accordingly, since the metes and bounds of this newly added limitation are unclear, the rejection of claim 17 is rejected based on its broadest reasonable interpretation in light of the specification. As such, Gaudelli et al is maintained as prior art because Gaudelli et al does teach the insertion of a TadA8e fragment into a Cas protein. Gaudelli et al teaches each fragment individually with over 90% sequence similarity as well as above in the newly rewritten rejection, Gaudelli et al teaches SEQ ID NO: 215 which is 96.1% sequence similar to SEQ ID NO: 13 of the instant application. In SEQ ID NO: 215 of Gaudelli et al, the Tad fragment is inserted at amino acid 1075 and in the instant SEQ ID NO: 13, the Tad fragment is inserted at amino acid 1079. Accordingly, the previous rejection of claim(s) 17-19, 29-30, and 33 under 35 U.S.C. 102 (a)(1) as being anticipated by Gaudelli et al (supra) is maintained in view of Applicant’s arguments filed on 06/29/2026.
Conclusion
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Liu et al (A Cas-embedding strategy for minimizing off-target effects of DNA base editors, nature communications, vol 11, issue 6073, pages 1-9, published November 27th, 2020) teaches, “Here, we report that the off-target effects of both A > G and C > T editors can be dramatically reduced without compromising the on-target editing simply by inserting the editing enzymes into the middle of nCas9 at tolerant sites identified using a transposon-based genetic screen.”, (abstract).
Figure 1 teaches a genetic screen for sites in nCas9 that would tolerate TadA insertion (see below), Figure 2 and 3 teaches a 1048-1063 deletion that the TadA was inserted into and how said insertion is comparable to ABEMax with less off targets (see below figure 2 below).
PNG
media_image12.png
678
1186
media_image12.png
Greyscale
PNG
media_image13.png
902
1220
media_image13.png
Greyscale
Slaymarker et al (WO 2020/160514A1, published 08/06/2020, filed 01/31/2029; pages 1-66 and 375) teaches “FIG. 20B-Q show base editing activity of exemplary internal fusion base editors in percentage A to G deamination on the targeting strand within the range of the R-loop with target sequences GA AC AC A A AGC AT AGAC T GC (HEK2) and GGACAGCTTTTCCTAGACAG (T39)”, (p. 63, lines 16-18).
PNG
media_image14.png
540
694
media_image14.png
Greyscale
Where Figure 20p teaches ISLAY028 teaches substitution of TadA at a deletion of 1017-1069 of a Cas9 (see figure 20p below).
No claims allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
