Prosecution Insights
Last updated: September 17, 2026
Application No. 18/037,752

USE OF FATTY ACID ELONGASE GENE AND ESTERASE GENE IN SYNTHESIS OF NERVONIC ACID AND GREASE IN YEAST

Non-Final OA §102§103§112§DP
Filed
Nov 17, 2023
Priority
Nov 19, 2020 — CN 202011302605.8 +1 more
Examiner
HUTSON, RICHARD G
Art Unit
1652
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Zhejiang Zhenyuan Biotech Co. Ltd.
OA Round
1 (Non-Final)
65%
Grant Probability
Favorable
1-2
OA Rounds
8m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 65% — above average
65%
Career Allowance Rate
588 granted / 905 resolved
+5.0% vs TC avg
Strong +53% interview lift
Without
With
+53.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
55 currently pending
Career history
957
Total Applications
across all art units

Statute-Specific Performance

§101
3.4%
-36.6% vs TC avg
§103
22.2%
-17.8% vs TC avg
§102
23.2%
-16.8% vs TC avg
§112
39.3%
-0.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 905 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s cancellation of claim 12, amendment of claims 1-11 and the addition of new claim 13-14, in the paper of 5/12/2026, is acknowledged. Claims 1-11, 13-14 are still at issue and are present for examination. Election/Restrictions Applicant's election without traverse of the invention of Group 1, claims 1-9, to engineered strain comprising a gene encoding a fatty acid synthase and/or esterase, in the paper of 5/12/2026, is acknowledged. Applicant's election without traverse of the following species: SEQ ID NO:2, Yarrowia lipolytica, Yarrowia lipolytica YL-88-B1, GPAT and SEQ ID NO: 50, in the paper of 5/12/2026, is acknowledged. Claims 10, 11, 13 and 14 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Information Disclosure Statement The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609 A(1) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Applicants filing of information disclosure statements on 5/12/2026 are acknowledged and have been considered. Claim Objections Claims 2-5, 7-9, are objected to because of the following informalities: Claim 2 (claims 3-5, 7-9 dependent on) recites “wherein the gene expression cassette further expressesing a protein encoded by an esterase gene”. This recitation contains a misspelling and is awkward and should be “wherein the gene expression cassette further expresses a protein encoded by an esterase gene”. Claim 3 (claims 4, 5 dependent on) recites a number of microbiological strains which should be italicized and the first letter of the genus capatilized (i.e. Yarrowia lipolytica, Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Kluyveromyces, candida, Cryptococcus magnus, Issatchenkia orientalis, Rhodotorula). Claim 4 recites Yarrowia lipolytica which should be italicized (i.e. Yarrowia lipolytica). Appropriate correction and/or comment is required. Specification The disclosure is objected to because of the following informalities: Applicants specification is objected to because applicants specification comprises Nucleotide and/or Amino Acids Disclosures Requiring a "Sequence Listing". Applicants attention is directed to 37 CFR 1.821(a) which presents a definition for "nucleotide and/or amino acid sequences." This definition sets forth limits, in terms of numbers of amino acids and/or numbers of nucleotides, at or above which compliance with the sequence rules is required. Nucleotide and/or amino acid sequences as used in 37 CFR 1.821 through 37 CFR 1.825 are interpreted to mean an unbranched sequence of four or more amino acids or an unbranched sequence of ten or more nucleotides. Specifically applicants specification in Figure 2 lists amino acid sequences which require a sequence identifier and are to be included in applicants sequence listing as per 37 CFR 1.821 through 37 CFR 1.825. Additionally the Description of Fig 2 comprises additional amino acid sequences which require a sequence identifier (i.e. “FGNTSSSS”, “GSGFKCNSAVW” and “GMGCSA”). Further sequence that occur within a Figure must have an accompanying sequence identifier either in the figure itself or in its Description. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 3 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 3 is indefinite in the recitation “or a combination thereof” in referencing the “engineered strain”. How can the claimed strain be a combination thereof the listed strains? Claim 8 is indefinite in the recitation “or a combination thereof” in referencing the “the esterase gene”. How can the esterase gene be a combination thereof the listed esterase genes? Appropriate correction and/or comment is required. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim(s) 1-9 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim(s) 1-9 are directed to all possible engineered strains for the production of nervonic acid and/or oils, the engineered strain having a gene expression cassette integrated in the genome, the gene expression cassette expressing a protein encoded by a 3-ketoacyl-CoA synthase (KCS) gene, wherein the KCS gene has a sequence as shown in SEQ ID NO. 2. The specification, however, only provides the representative species of that engineered strains for the production of nervonic acid and/or oils, the engineered strain having a gene expression cassette integrated in the genome, the gene expression cassette expressing a protein encoded by a 3-ketoacyl-CoA synthase (KCS) gene, wherein the KCS gene has the sequence of SEQ ID NO. 2, encompassed by these claims. There is no disclosure of any particular structure to function/activity relationship in the disclosed species. The specification also fails to describe additional representative species of these 3-ketoacyl-CoA synthase (KCS) genes by any identifying structural characteristics or properties, for which no predictability of structure is apparent. Regarding the level of skill and knowledge in the art of amino acid mutation, the reference of Singh et al. (Curr. Protein Pept. Sci. 18:1-11, 2017; cited on the attached Form PTO-892) reviews various protein engineering methods and discloses that despite the availability of an ever-growing database of protein structures and highly sophisticated computational algorithms, protein engineering is still limited by the incomplete understanding of protein functions, folding, flexibility, and conformational changes (see p. 7, column 1, top). Also, the unpredictability associated with amino acid mutations is exemplified by the reference of Zhang et al. (Structure 26:1474-1485, 2018; cited on the attached Form PTO-892), which discloses that even a mutation of a surface residue that was predicted to be benign caused significant structural changes and unexpected effects on the function of a polypeptide (p. 1475, column 1). Given this lack of additional representative species as encompassed by the claims, Applicants have failed to sufficiently describe the claimed invention, in such full, clear, concise, and exact terms that a skilled artisan would recognize Applicants were in possession of the claimed invention. Applicant is referred to the revised guidelines concerning compliance with the written description requirement of U.S.C. 112, first paragraph, published in the Official Gazette and also available at www.uspto.gov. Claim 5 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. The invention appears to employ novel genetically engineered Yarrowia lipolytica strains Po1g-G3-MaileKCS and YL-99-B1. Since the Yarrowia lipolytica strains Po1g-G3-MaileKCS and YL-99-B1 are essential to the claimed invention, they must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public. The Yarrowia lipolytica strains Po1g-G3-MaileKCS and YL-99-B1 are not fully disclosed, nor have all the sequences required for their construction been shown to be publicly known and freely available. The enablement requirements of 35 U.S.C. 112 may be satisfied by a deposit of the Yarrowia lipolytica strains Po1g-G3-MaileKCS and YL-99-B1. Accordingly, it is deemed that a deposit of the Yarrowia lipolytica strains Po1g-G3-MaileKCS and YL-99-B1 should have been made in accordance with 37 CFR 1.801-1.809. If a deposit was made under the terms of the Budapest Treaty, then an affidavit or declaration by applicants, or a statement by an attorney of record over his or her signature and registration number, stating that the specific strain has been deposited under the Budapest Treaty and that the strain will be available to the public under the conditions specified in 37 CFR 1.808, would satisfy the deposit requirement made herein. If the deposit has not been made under the Budapest treaty, then in order to certify that the deposit meets the criteria set forth in 37 CFR 1.801-1.809, applicants may provide assurance or compliance by an affidavit or declaration, or by a statement by an attorney of record over his or her signature and registration number, showing that: 1. during the pendency of this application , access to the invention will be afforded to the Commissioner upon request; 2. upon granting of the patent the strain will be available to the public under the conditions specified in 37 CFR 1.808; 3. the deposit will be maintained in a public repository for a period of 30 years or 5 years after the last request or for the effective life of the patent, whichever is longer; and 4. the deposit will be replaced if it should ever become inviable. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1-4 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Franklin et al. (US Patent No. 8,945,908). Franklin et al. (US Patent No. 9,945,908) teach a high oil producing strain of Prototheca moriformis (Strain Z) transformed with a plasmid pSZ3067 (TmFAE SEQ ID NO:105) which encodes a Tropaeolum majus fatty acid elongase. While the sequence of SEQ ID NO:105 has a query match of 49.4% to instant SEQ ID NO:2, it “has a sequence as shown in instant SEQ ID NO:2. Franklin et al. further teach the high oil producing strain can also be transformed with an acyl-ACP-thioesterase gene. Franklin et al. further teach that the transformed strains can be Yarrowia lipoolytica (see Example 31). Alignment: Query Match 49.4%; Score 826.4; Length 1524; Best Local Similarity 73.0%; Matches 1077; Conservative 0; Mismatches 396; Indels 3; Gaps 1; SEQ 2: 178 TCTGCCACCCTGCCCAACTTCAAGCTGTCTGTGAAGCTGAAGTACGTGAAGCTGGGCTAC 237 || | |||||||| ||||||||| ||| ||||| |||||||||||||||||||||||| SEQ 105: 34 TCCGTGCCCCTGCCCGACTTCAAGCAGTCCGTGAACCTGAAGTACGTGAAGCTGGGCTAC 93 Qy 238 CACTACCTGATCTCTAAGGCCATGTACGTGTTCCTGATCCCCCTGCTGGCCTCTTTCTCT 297 |||||| ||| | | ||||||||| ||||||||| |||||||||| | || Db 94 CACTACTCCATCACCCACGCCATGTACCTGTTCCTGACCCCCCTGCTGCTGATCATGTCC 153 Qy 298 CTGCACTTCTACACCTTCACCGTGGACGACCTGTCTCGAGTGTGGACCCATC---ACAAG 354 || ||| ||||||| || | | ||| | | ||| | ||| | | | Db 154 GCCCAGATCTCCACCTTCTCCATCCAGGACTTCCACCACCTGTACAACCACCTGATCCTG 213 Qy 355 TTCGACGTGTCTACCGTGATCATCTGCTCTGGCCTGTCTATCTTCCTGGCCACCGTGTAC 414 | || |||| || ||||| | ||| | |||| | ||| || ||| ||||| Db 214 CACAACCTGTCCTCCCTGATCCTGTGCATCGCCCTGCTGCTGTTCGTGCTGACCCTGTAC 273 Qy 415 TTCACCACCCGACCCAGAAAAGTGTACCTGCTGAACTTCTCTTGCTTCAAGCCCGAGCCC 474 ||| ||||| |||| |||||||||||||||||||| |||| ||||||||| || Db 274 TTCCTGACCCGCCCCACCCCCGTGTACCTGCTGAACTTCTCCTGCTACAAGCCCGACGCC 333 Qy 475 GCCCGAATTTGCCCTAGAGAAATGTTCATCGACCGATCTGTGCGAACCGGCCGATTCACC 534 || | ||| | ||||| ||| | | ||| | |||| Db 334 ATCCACAAGTGCGACCGCCGCCGCTTCATGGACACCATCCGCGGCATGGGCACCTACACC 393 Qy 535 GAAGAAAACCTGGCTTTTCAGAAGAAGATCGTGGAGCGATCTGGCCTGGGCCAGAAAACT 594 || || ||| | | || ||| ||| | ||||||| || ||| | ||| || | Db 394 GAGGAGAACATCGAGTTCCAGCGCAAGGTGCTGGAGCGCTCCGGCATCGGCGAGTCCTCC 453 Qy 595 TATCTGCCCGAAGCCGTGCTGCGAATCCCCCCTAATCCTTGTATGGCCGAAGCTATGAAG 654 || |||||| ||||| | |||||||| | ||||| | Db 454 TACCTGCCCCCCACCGTGTTCAAGATCCCCCCCCGCGTGTACGACGCCGAGGAGCGCGCC 513 Qy 655 GAGGCCGAAATGGTGATGTTCGGCGCCATCGACGAACTGCTGGAGAAGACCGGAGTGCGA 714 |||||||| ||| |||||||||||||| | |||| ||| | ||||||| | ||| Db 514 GAGGCCGAGATGCTGATGTTCGGCGCCGTGGACGGCCTGTTCGAGAAGATCTCCGTGAAG 573 Qy 715 GTGAGAGAGATTGGCATGCTGCTGGTGAACTGCTCTCTGTTCAACCCCACCCCCTCTCAC 774 | |||| ||| ||||| ||||||||||| ||||||||||||| |||||| | Db 574 CCCAACCAGATCGGCGTGCTGGTGGTGAACTGCGGCCTGTTCAACCCCATCCCCTCCCTG 633 Qy 775 TGCGCCACTATTATGAATCACTACAAGATGAAGGGCAACCTGCTGTGCTACAACCTGGGC 834 | | ||| || |||| | |||||||||| |||||| || | | ||||||||||||| Db 634 TCCTCCATGATCGTGAACCGCTACAAGATGCGCGGCAACGTGTTCTCCTACAACCTGGGC 693 Qy 835 GGCATGGGCTGTTCTGCCGGACCTATCATGATCGACCTGGCCAAACACCTGCTGCAGGTG 894 ||||||||||| || ||||| ||| |||||||||||||| |||||||||||||| Db 694 GGCATGGGCTGCTCCGCCGGCGTGATCTCCATCGACCTGGCCAAGGACCTGCTGCAGGTG 753 Qy 895 CACCCTAATTCTTACGCCCTGATTGTGACCATGGAGAACATCACCCTGAACTGGTACCTG 954 | ||| || || ||||||||| | ||| || ||||| |||| || |||| ||||||| Db 754 CGCCCCAACTCCTACGCCCTGGTGGTGTCCCTGGAGTGCATCTCCAAGAACCTGTACCTG 813 Qy 955 GGCAACAACCGATCTATGCTGGTGTCTAACTGCCTGTTCCGAATGGGCGGCGCCGCTGTG 1014 ||| | | || || ||||||||||| |||||||||||||| |||||||||||||| | Db 814 GGCGAGCAGCGCTCCATGCTGGTGTCCAACTGCCTGTTCCGCATGGGCGGCGCCGCCATC 873 Qy 1015 TTACTTTCTAATAGATTTTCTGACCGACGACGATCTAAGTACCAGCTGATGCACACCGTG 1074 | || || || | | || ||||| | || || ||||||| ||| ||||||||||| Db 874 CTGCTGTCCAACAAGATGTCCGACCGCTGGCGCTCCAAGTACCGCCTGGTGCACACCGTG 933 Qy 1075 CGAACCCACAAGGGCGCTGATGATTCTTGCTACGACTGCGTGTTCCAGAAGGAGGACGAG 1134 || |||||||||||| | || || |||| | ||||||| || ||||||||| Db 934 CGCACCCACAAGGGCACCGAGGACAACTGCTTCTCCTGCGTGACCCGCAAGGAGGACTCC 993 Qy 1135 AAGGACGAGATCGGCGTGTCTCTGTCTAAGGACCTGATGATGGTGGCCCGAGAGGCCCTT 1194 | | | |||||||| | || ||||| ||| |||||||| |||||| | || ||||| Db 994 GACGGCAAGATCGGCATCTCCCTGTCCAAGAACCTGATGGCCGTGGCCGGCGACGCCCTG 1053 Qy 1195 AGAACTAATATTACTACCCTGGGCCCCCTGGTGCTGCCCATTACTGAACAACTGCTGTTC 1254 | || || || || |||||||||||||||||||||||||| | || || ||||||||| Db 1054 AAGACCAACATCACCACCCTGGGCCCCCTGGTGCTGCCCATGTCCGAGCAGCTGCTGTTC 1113 Qy 1255 TTCGCCTCTTTCCTGGGCCGAAAGATCCTGAAGATGAACATGAAGCAGTACCTGCCCAAC 1314 |||||| | | ||||| ||| | | |||||||| || ||| ||| | ||| || Db 1114 TTCGCCACCCTGGTGGGCAAGAAGGTGTTCAAGATGAAGCTGCAGCCCTACATCCCCGAC 1173 Qy 1315 TTCAAGCTGGCCTTCAAGCACTTCTGCATCCACGCCGGCGGACGAGCTGTGCTGGATGAA 1374 ||||||||||||||| ||||||||||||||||||||||||| || || |||||||| || Db 1174 TTCAAGCTGGCCTTCGAGCACTTCTGCATCCACGCCGGCGGCCGCGCCGTGCTGGACGAG 1233 Qy 1375 CTGCAAAAAAACCTGGAGCTGTCTGAGTGGCACATGGAGCCCTCTCGAATGACCCTGTAC 1434 ||| | || |||||| ||||||| ||||||||||||||||| || ||| |||||||| Db 1234 CTGGAGAAGAACCTGAAGCTGTCCTCCTGGCACATGGAGCCCTCCCGCATGTCCCTGTAC 1293 Qy 1435 CGATTCGGCAACACCTCTTCTTCTTCTCTGTGGTACGAGCTGGCCTACTCTGAGGCCAAA 1494 || |||||||||||||| || || || ||||||||||||||||||||||| |||||||| Db 1294 CGCTTCGGCAACACCTCCTCCTCCTCCCTGTGGTACGAGCTGGCCTACTCCGAGGCCAAG 1353 Qy 1495 GGCCGAATTAAGAAGGGCGACCGACTGTGGCAGATCGCCTTTGGATCTGGATTCAAGTGC 1554 ||||| || |||||||||||||| |||||||||||||||| || || || ||||||||| Db 1354 GGCCGCATCAAGAAGGGCGACCGCGTGTGGCAGATCGCCTTCGGCTCCGGCTTCAAGTGC 1413 Qy 1555 AACTCTGCCGTGTGGCACGCCCTGAAAACCATCGATCCCGCCAGAGAAAAAAACCCCTGG 1614 ||||| ||||||||| | |||||| | | | | |||||| || || ||||||||| Db 1414 AACTCCGCCGTGTGGAAGGCCCTGCGCAACGTGAACCCCGCCGAGGAGAAGAACCCCTGG 1473 Qy 1615 ATGGACGAGATTGACGAGTTCCCCGTGGACGTGCCC 1650 ||||||||||| || |||||||||||| |||||| Db 1474 ATGGACGAGATCCACCTGTTCCCCGTGGAGGTGCCC 1509 Thus Franklin et al. (US Patent No. 9,945,908) teach an engineered strain for the production of nervonic acid and/or oils, the engineered strain having a gene expression cassette integrated in the genome, the gene expression cassette expressing a protein encoded by a 3-ketoacyl-CoA synthase (KCS) gene, wherein the KCS gene has a sequence as shown in SEQ ID NO. 2. Thus, claim(s) 1 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Franklin et al. (US Patent No. 9,945,908). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 1-4 is/are rejected under 35 U.S.C. 103 as being unpatentable over Franklin et al. (US Patent No. 9,945,908). As stated above, Franklin et al. (US Patent No. 9,945,908) teach a high oil producing strain of Prototheca moriformis (Strain Z) transformed with a plasmid pSZ3067 (TmFAE SEQ ID NO:105) which encodes a Tropaeolum majus fatty acid elongase. While the sequence of SEQ ID NO:105 has a query match of 49.4% to instant SEQ ID NO:2, it “has a sequence as shown in instant SEQ ID NO:2. Franklin et al. further teach that the plasmid comprising the exogenous gene can be integrated into the genome of the oil producing strain. Franklin et al. further teach the high oil producing strain can also be transformed with an acyl-ACP-thioesterase gene. Franklin et al. further teach that the transformed strains can be Yarrowia lipoolytica (see Example 31). Before the effective filing date one of skill in the art would have been motivated to transform high oil producing strain of Prototheca moriformis (Strain Z) transformed with a plasmid pSZ3067 (TmFAE SEQ ID NO:105) which encodes a Tropaeolum majus fatty acid elongase and an acyl-ACP-thioesterase gene, such that the plasmid becomes integrated into the genome of the high oil producing strain, such as Yarrowia lipolytica, so that the strain could more stably produce the encoded fatty acid elongase and. The expectation of success is high based upon the high level of skill in the art of recombinant gene expression and bacterial engineering as exemplified by Franklin et al. Thus claim(s) 1-4 is/are rejected under 35 U.S.C. 103 as being unpatentable over Franklin et al. (US Patent No. 9,945,908). Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp. Claims 1-4 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 11,603,545. Although the claims at issue are not identical, they are not patentably distinct from each other because claims 1-20 of U.S. Patent No. 11,603,545 drawn to an recombinant yeast strain overexpressing of at least one gene encoding fatty acid elongase wherein the fatty acid elongase is (i) cardamine mustard CgKCS gene, the nucleotide sequence of which is shown in SEQ ID NO: 96; and/or (ii) goat fatty acid elongase 6 gELOVL6 gene, the nucleotide sequence of which is shown in SEQ ID NO: 99; and the recombinant yeast strain is a recombinant Yarrowia yeast strain which produces nervonic acid anticipate/make obvious instant claims 1-4 drawn to an engineered strain for the production of nervonic acid and/or oils, the engineered strain having a gene expression cassette integrated in the genome, the gene expression cassette expressing a protein encoded by a 3-ketoacyl-CoA synthase (KCS) gene, wherein the KCS gene has a sequence as shown in SEQ ID NO. 2. Remarks No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RICHARD G HUTSON whose telephone number is (571)272-0930. The examiner can normally be reached 6-3 EST Mon-Fri. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached at (408) 918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. rgh 7/8/2026 /RICHARD G HUTSON/Primary Examiner, Art Unit 1652
Read full office action

Prosecution Timeline

Nov 17, 2023
Application Filed
Jul 10, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12716078
METHODS OF USING SYNTROPHUS ACIDITROPHICUS TO PRODUCE CYCLOHEXANE-1-CARBOXYLATE (CHC)
1y 7m to grant Granted Aug 25, 2026
Patent 12698481
Omega-Hydroxylase-Related Fusion Polypeptides With Improved Properties
3y 12m to grant Granted Aug 04, 2026
Patent 12686878
MICROORGANISM FOR PRODUCING PANTOIC ACID, AND CONSTRUCTION METHOD THEREFOR AND APPLICATION THEREOF
3y 0m to grant Granted Jul 21, 2026
Patent 12686858
RECOMBINANT HUMAN SIALIDASES, SIALIDASE FUSION PROTEINS, AND METHODS OF USING THE SAME
2y 4m to grant Granted Jul 21, 2026
Patent 12662668
RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX
3y 11m to grant Granted Jun 23, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
65%
Grant Probability
99%
With Interview (+53.1%)
3y 6m (~8m remaining)
Median Time to Grant
Low
PTA Risk
Based on 905 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month