DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
The preliminary amendment filed November 2, 2023 is acknowledged. Claims 1-16, 23-24 and 38 are pending and under examination.
Specification
The use of the term RNAiMAX®, Lipofectoamine®, and ProteinSimple®, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2-7, 11-16, 23-24, and 38 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 2 and 14 recite “A siRNA molecule, wherein the siRNA molecule specifically targets at least one sequence selected form the group consisting of SEQ ID NO 1-5, 77 or 78… wherein the siRNA molecule comprises at least one sequence having at least 90% sequence identity selected form the group consisting of SEQ ID NO 6-73.” Including both the specific target sequences and the siRNA structure sequences renders the claim indefinite because most the target sequences (SEQ ID NOs 6-73) don’t target any of the target sequences (SEQ ID NOs 1-5, 77 or 78). According to the Specification, SEQ ID NOs 1-5 are CRISPR guide RNA target sequences and SEQ ID NOs 77-78 are “standard” MSUT2 RNAi sequences and form an siRNA duplex. Examiner mapped each of the SEQ ID NOs recited in claim 2 to the MSUT2 transcript variant 1 (Genbank accession NM_024824.5). The coordinates in MSUT2 mRNA of each SEQ ID NO is provided in the OA Appendix. SEQ ID NOs 1-5 and 77-78 target nucleotides 736-756, 1904-1928, 2261-2280, 2441-2460 (non-coding strand), and 2025-2048. Only the siRNA of SEQ ID NO: 41 (targets coordinates 1901-1927) would “specifically target at least one sequence selected from SEQ ID NOs 1-5, 77 and 78”. It is confusing to list 34 possible sequences for the siRNA, when only one of the choices fits the functional limitations in the claim. It is not clear if out of the 34 sequences, the claim actually only encompasses one siRNA sequence, or alternatively, if the functional limitations should be ignored.
Claims 3-7, 11-13, 15-16, 23-24 and 38 are rejected for depending from claim 2 or claim 14 and not remedying the indefiniteness. Although claim 6 recites specific sequences for the sense and antisense strand, it is still confusing because only one pair SEQ ID NOs 40-41 form a duplex that would target one of SEQ ID NOs 1-5, 77 and 78.
Claim 11 recites “the siRNA molecule of claim 2, further comprising a pharmaceutically acceptable carrier.” Claim 11 is indefinite because it is not clear how an siRNA, which is a discreet molecule entity that is an oligonucleotide, can also comprise a pharmaceutically acceptable carrier. The Specification defines “pharmaceutically acceptable carrier” as referring to solvents, dispersion media, coatings, antibacterial, isotonic and absorptions delaying agents, buffers, excipients, binder lubricants gels, and surfactants (page 50). The Specification continues described the carriers on pages 50-51. None of the examples in the Specification state to conjugate or otherwise covalently link the carrier to the siRNA so that siRNA “comprises” the carrier. As such, it is not clear what the structure of the siRNA comprising the carrier would be.
Claim 12 is rejected for further depending from claim 11 and not remedying the indefiniteness.
To remedy the indefiniteness, Applicant could amend claim 11 to recite a composition comprising the siRNA and a pharmaceutically acceptable carrier. However, the claim would then be identical to claim 7. Therefore, it is suggested that claims 11-12 be cancelled.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 4 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 4 depends from claim 3, which recites “The siRNA molecule of claim 2, wherein at least one nucleotide of the siRNA molecule comprises a chemical modification.” Claim 2 is directed to “An siRNA molecule… [comprising] a 25- to 28-nucleotide blunt-ended double-stranded structure… [having] at least one sequence [that has] at least 90% identity [to] SEQ ID NOs 6-73.” Thus claims 2-4 encompass double-stranded blunt-ended RNA duplexes. Claim 4 recites “The siRNA molecule of claim 3, wherein the chemical modification is on the sense strand, the antisense strand or on both strands of the siRNA molecule.” However, claim 3 must be double stranded, and therefore only has a sense strand and an antisense strand. As such, the chemical modification of claim 3 must be a nucleotide on the sense strand, the antisense strand or on both strands. There is nowhere else the chemical modification could be placed in the siRNA of claim 3. Therefore, claim 4 does not further limit the subject matter of claim 3.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(a) – Scope of Enablement
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 14-16, 23-24 and 38 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for treating Alzheimer’s disease and related tauopothies with siRNAs in combination with a cholinesterase inhibitor, and methods of inhibiting expression of MSUT2 and reducing phosphorylated tau in a subject by intravenous or intrathecal administration, does not reasonably provide enablement for treating Alzheimer’s with only the claimed siRNAs, providing siRNAs by any other route than intravenous or intrathecal administration, or treating dementias other than tauopathies. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims.
Exemplary factors to be considered in determining whether undue experimentation is required are summarized in In re Wands, 858 F.2d 731, 737, 8 U.S.P.Q.2d 1400, 1404 (Fed. Cir. 1988) (a) the breadth of the claims; (b) the nature of the invention; (c) the state of the prior art; (d) the level of one of ordinary skill; (e) the level of predictability in the art; (f) the amount of direction provided by the inventor; (g) the existence of working examples; and (h) the quantity of experimentation needed to make or use the invention based on the content of the disclosure. See MPEP 2164.01(a). All of these factors were considered, along with others, and a sufficient number are addressed below so as to create a prima facie case.
Claims 14-16, 23-24 and 38 are indefinite for the reasons described above in paragraph 6. For the purposes of examination, the claims are interpreted as requiring a blunt-ended double-stranded siRNA molecule comprising at least one sequence having at least 90% identity to SEQ ID NOs 6-73 and must be capable of reducing expression of the MSUT2 gene.
Methods of treating Alzheimer’s Disease or dementia with only siRNAs
Claim 14 recites a method of treating Alzheimer's disease (AD) or dementia using a therapeutically effective amount of an siRNA that targets MSUT2 for reduced expression and thus requires a therapeutic effect on AD or dementia. The scope of diseases for therapy is considered to be broad as it embraces any type of dementia (e.g. Parkinson’s-related dementia, Huntington’s-related dementia, Lewy body dementia, frontotemporal dementia, vascular dementia, and others.
State of the art and Predictability
The therapeutic treatment of Alzheimer’s disease (AD) and/or dementia is considered to be an extremely difficult endeavor. Cummings et al. (Alzheimer's Research & Therapy, 2014, 6:37) reviewed AD treatment and indicated that of 244 unique compounds in 413 clinical trials between 2002 and 2012, only one drug was approved and the drug candidate failure rate was 99.6% (Abstract; ¶ bridging pages 2 and 3). As of 2019, there were four FDA-approved compounds for treating symptoms of AD. Three of these (donepezil, galantamine and rivastigmine) are cholinesterase inhibitors, and the fourth (memantine) is an NMDA receptor antagonist. Blanco-Silvente et al. (International Journal of Neuropsychopharmacology (2017), 20(7): 519–528) investigated the effect of cholinesterase inhibitors (ChEIs) on all-cause discontinuation, efficacy and safety, and the effects of study design-, intervention-, and patient-related covariates on the risk-benefit of cholinesterase inhibitors for Alzheimer’s disease in a meta-analysis of 43 randomized clinical trials enrolling 16106 patients. Cholinesterase inhibitors showed a poor risk-benefit relationship as indicated by mild symptom improvement and a higher than placebo all-cause discontinuation, although a reduction of mortality was suggested by the analysis (Abstract). However, the clinical relevance of the reduction in mortality accompanied by only a small improvement in symptoms was characterized as “uncertain” (see Significance Statement on page 520). Cappa (Front. Neurol. 9: 108, doi:10.3389/fneur.2018.00108) reviewed the “quest” for an AD therapy, and taught that there was no effective treatment for AD, and the goal of identifying one by the year 2025 was considered to be ambitious (Abstract). Crook et al (Journal of Huntington's Disease 2 (2013) 405-436) indicated that despite 20 years having passed since the cloning of the huntingtin gene, "there remains no treatment for Huntington's Disease (HD) that alters the course of disease or lifespan of patients." This is due to the diversity of cellular pathways disrupted by mutant HTT (mHTT) protein expression (Abstract). This is relevant to the state of the art of treatment of dementia related to Huntington’s disease. A search of the art revealed no publications of RNA interference-mediated therapies of any disease in human brain at the time the application was filed.
A study in 2019 that included the Inventors of the claimed invention disclosed extensive research into the role of MSUT2 in tauopathies (Wheeler et al., Science Translational Medicine (2019), 11: eaao6454, pages 1-15 and Supplemental Material). Wheeler used MSUT2 knock out mice to probe the role of MSUT2 in tauopathies. Transgenic mice were constructed lacking the MSUT2 CCCH finger domain which binds both poly(A) RNA and the poly(A) binding protein PABPN1. These mice were bred with the PS19 mouse tauopathy model to provide PS19 mice homozygous for the MSUT2 mutation. The PS19 tauopathy model mice express an aggregate-prone allele approximately 5-fold greater than the wild type mouse tau allele. The PS19 tauopathy model mice develop widespread neurofibrillary tangle (NFT)-like inclusions accompanied by microgliosis and astrocytosis, but not amyloid plaques and display signs of age-associated cognitive impairment. However, the MSUT2 knockout P19 mice showed-reduced numbers of hippocampal neurofibrillary tangles (NFTs) Fig 2A and Fig. 1F), reduction in both phosphorylated tau (pTau) and mis-folded tau Figs. 2B-C; S2A-B); a lack of neuronal loss in the CA1 region of the hippocampus that is observed in PS19 mice with intact MSUT2 (Fig. 2D); improved performance in Barnes maze assay of hippocampal dependent learning and memory (Fig. 2E); decreased astrocytosis (Fig. 10e and 11B); a “trend toward decreased microgliosis” (Fig. 12A-C); the mice showed no resistance to neuroinflammatory changes induced by an exogenous chemical trigger (Fig. 13).
Wheeler also discloses that MSUT2 overexpression in hippocampus of Tau4RTg2652 transgenic mice, which have “mild and non-progressive tauopathy”, led to exacerbation of tau neuropathology, e.g. accumulation of pTau+ lesions in CA1 with evidence of neuronal loss in associated projection regions. Increased microgliosis (IBA1 staining) was also observed, as was increased astrocytosis (GFAP staining) (Figs 10A, 9F, 10D and 11A) indicating increased neuroinflammation. Although Wheeler tested MSUT2 siRNA treatment of cultured HEK293/tau cells that overexpress human tau, led to decreased amounts of pTau and tau oligomeric species accumulation (Figs. 7B and 7E and page 55), Wheeler did not administer any siRNAs to subjects having Alzheimer’s, dementia or genetic models. Wheeler also showed MSUT2 expression in human postmortem brains was diminished in approximately half of the AD cases (Table 4). Thus, although Wheeler showed that MSUT2KO mice had improved performance in a hippocampal dependent learning and memory, the relevance of this result to obtaining therapeutic outcomes in AD or dementia is unclear because it is not clear that such results have relevance to human disease. For example, Wilcock et al (J. Neurosci. 26(20):5340-5346, 2005) reported that treatment of a mouse model of AD with anti-amyloid antibodies eliminated cognitive deficits while reducing parenchymal amyloid; however, 15 clinical trials with anti-amyloid antibodies have failed to provide any therapeutic outcome in humans (van Dyk et al., Biological Psychiatry (2018); 83:311–319; Table 2) and a search of the art did not reveal any other therapeutic success with this approach in humans. Therefore, it is unpredictable as to whether or not the results of animal models of AD/dementia can be extrapolated to humans.
Guidance in the Specification
The Specification screens 34 siRNA duplexes in HEK293 cells for their effect on MSUT2 expression in the cell lines (Table 3). The MSUT2 knockdown efficiency was compared to “standard MSUT2 RNAi” which is the RNAi species in Wheeler (Table 1). Wheeler’s siRNA has 75% knockdown, while the knockdown efficiency to the claimed siRNAs ranged from as low as 13% and as high as 83%. The Specification does not test the siRNAs in the HEK/Tau cell line, so it is unknown if the siRNAs are also capable of decreasing phosphorylated pTau in those cell lines. However, it is likely that at least the claimed siRNAs with similar or higher MSUT2-knockdown efficiency as Wheeler’s siRNA, would have a similar effect when tested in an HEK/Tau cell line.
The Specification fails to administer any of the siRNAs to animal brains or to humans altogether, so the guidance in the Specification gives the skilled artisan no more predictability as to the therapeutic efficacy of MSUT2-targeted siRNAs for the treatment of AD as Wheeler and the rest of the prior art.
Thus, while Wheeler and the knockdown studies in cell culture by the claimed siRNAs as a whole presents valuable contributions to the study of the role of MSUT2 in the biology of NFTs and the biology of tau, one of skill in the art would have to perform undue experimentation to use the invention to provide therapeutic outcomes for AD and dementia without cholinesterase inhibitors in view of the extremely difficult state of the art of AD and dementia therapies, and the unpredictable nature of extrapolating the outcomes of mouse models of neurodegenerative disease to humans.
Methods of delivering siRNAs for inhibiting expression of MSUT2 and reducing pTau in AD patients
Nature of the invention and Breadth of the claims
The rejected claims are drawn to methods of obtaining reduced MSUT2 expression, reduced pTau levels and aggregation, and/or treatment of AD by administration of siRNA molecules directed to MSUT2 mRNA. Wheeler, cited above, together with the Specification reveals that each of these outcomes is achieved in brain of the subject to which MSUT2 is knocked out and culture cells to which the siRNA is administered. Thus, it follows that these methods require delivery of the recited siRNAs to brain tissue. The specification discloses that delivery means of siRNAs are intravenous, oral, intramuscular, intraperitoneal, intravenously, subcutaneously and intrathecal routes (page 34).
State of the art and Level of predictability
Juliano reviews delivery of therapeutic oligonucleotides, such as siRNAs, addressing delivery to brain (Nucleic Acids Research, 2016, 44(14): 6518-6548; pages 6521-6522). Juliano teaches that the blood brain barrier (BBB) is largely impervious to oligonucleotides (page 6521, right column), therefore delivery to brain by systemic administration is very difficult. Consequently, the most promising results in addressing CNS diseases have come through direct administration of oligonucleotides, usually by intrathecal injection. Approaches to achieving brain delivery by systemic administration include conjugation of cell-penetrating peptides (CPPs) to oligonucleotides and also formulation of oligonucleotides in nanoparticles that recognize cell surface ligand such as the transferrin receptor. However, Juliano taught that CPP approaches raised concerns about the possible systemic and CNS toxicities of these polycationic entities, and that although there had been many studies using various nanoparticles seeking to deliver drugs, peptides or oligonucleotides across the BBB, these usually showed only limited success. For example, Juliano taught that a potentially interesting approach was to link nanoparticles to transferrin receptor ligands or to anti-receptor antibodies, thus making use of a transferrin receptor-mediated transcytotic route across the vascular endothelium. However, as of 2016 there were no reports of functional in vivo delivery of oligonucleotides by this approach. Juliano noted that a further consideration is that even if nanoparticles cross the brain endothelium their relatively large size will restrict their diffusion through the extracellular matrix of brain parenchyma, and that while there were a number of reports in the literature purporting to achieve delivery across the BBB with nanoparticles, it was important to ask whether the BBB was intact in these studies or was it comprised by infection, cancer, inflammation or the toxic properties of the delivery vehicle itself. Juliano concluded that systemic delivery of oligonucleotides to the CNS remains a challenge that is largely unresolved (page 5622, left column).
Ghosh et al (Alzheimer's Research & Therapy (2017) 9(82): 13 pages) taught that “[b]ecause unmodified siRNAs do not readily cross the blood–brain barrier (BBB), or the plasma membrane of cells, researchers have used viral vectors to enable stable expression of shRNAs and artificial miRNAs within desirable brain regions (page 6, ¶1). AAV serotype 9 (AAV9) crosses the BBB and transduces neurons and glia in the brain, as well as a variety of peripheral tissues, following a systemic, intravascular injection (page 6, ¶3). It is noted that the instant claims do not allow for virus-mediated expression, and require administration of siRNAs themselves. Ghosh taught that antisense oligonucleotides (similar in size, charge, and structure to siRNAs) do not cross the BBB, but can be delivered into the cerebrospinal fluid (CSF), either through intrathecal or intra-ventricular injection, as they are soluble in artificial CSF (¶1 of right column on page 6).
In 2018, Zheng et al (Trends in Biotechnology (2018) 36(5): 562-575) reviewed the state of the art of siRNA delivery to brain, relying on prior art references. Zheng taught that effective and safe systemic delivery of siRNA into the brain remains challenging because of biological barriers such as enzymatic degradation, short circulation lifetime, the blood–brain barrier (BBB), insufficient tissue penetration, cell endocytosis, and cytosolic transport. These issues had been partially addressed prior to the time of filing of the instant application through the use of nanotechnological modalities (Abstract). However, although the most widely used approach (receptor-mediated transport) can enhance BBB penetration of siRNA nanomedicines, the efficiency is still too low to meet the requirements of clinical trials, and further research is necessary to improve this and other approaches (page 572, ¶2 of Concluding Remarks and Future Perspectives). Zheng writes
“The first challenges faced by siRNA after systemic administration lie in the circulatory system. Naked siRNA is susceptible to nucleases and thus can be rapidly degraded by RNase in the blood. Degradation stimulates the innate immune system, triggering inflammatory and other immune responses. Through chemical modifications such as incorporating 2’-O-methylor 2’-fluoro groups into ribose, or phosphorothioate linkages by sulfur substitution, siRNA drugs can be protected from nuclease degradation. However, in most cases such protection is insufficient to completely protect naked siRNA from nucleases. Thus, more effective strategies need to be explored for siRNA protection in the circulation. Kidney filtration presents another challenge to siRNA in its journey through the blood. Given that siRNA is a double- stranded RNA molecule, with typically 21–23 nt in each strand and low molecular weight (about 14 kDa), naked siRNA can be easily excreted by the kidney, where glomerular filtration typically removes molecules <50 kDa. Systemically administered naked siRNAs preferentially accumulate in the kidney (40-fold faster than in other organs) and are excreted into the urine within 1 hour.
Of all the obstacles faced by systemic siRNA delivery to brain, the blood–brain barrier (BBB) is considered to be the most intractable. This layer of brain capillary endothelial cells (BCECs) acts as a physical and transport barrier to tightly regulate the import and export of substances into and out of the nervous system. BCECs have a complex system of pathways that allow transport of molecules across tight junctions (TJs), including extracellular membrane-bound transporters that deliver selective cargoes (transport fluid, ions, some peptides, nutrients, proteins, as well as immune cells) into the nervous system, as well as vesicular transport and influx/efflux pumps. The BBB is thought to inhibit transport of nearly 98% of molecules, allowing only lipid-soluble small molecules with a molecular weight <400 Da to cross. Therefore, hydrophilic siRNA, with a molecular weight of about 14 kDa, is incapable of reaching the brain easily. In fact, the BBB is widely considered to be the biggest obstacle to siRNA drugs in clinical trials for brain disease therapy. The BBB has presented an unyielding challenge to translational scientists and clinicians for years, and is one of the main reasons at the brain disease pharmaceutical market is so under penetrated. Most studies of drug delivery for brain disease therapy concentrate their efforts on helping drugs cross the BBB. However, another type of RNA therapeutic, antisense oligonucleotides (ASOs), are also unable to cross the BBB, but demonstrated broad distribution throughout the brain parenchyma after intrathecal administration into the cerebrospinal fluid (CSF). The mechanism of crossing from the CSF into the brain parenchyma remains entirely unknown. Further efforts to elucidate the ASO uptake mechanism may provide very useful hints for enhancing the application of siRNA in the CNS.
After crossing the BBB and reaching the brain tissue, there are still considerable challenges to siRNA-based brain therapy in the area of diseased tissue/cell targeting. Given that naked siRNA has no specificity for particular brain cell/tissues, more therapeutic doses are normally delivered to the diseased tissue to meet the minimum dose requirement for effective therapy, which creates negative side effects in normal brain tissue. Furthermore, the poor endocytosis of naked siRNA across lipid bilayer-based cell membranes remains another problem to solve. Cell membranes only allow small, neutral, slightly hydrophobic molecules <1000 Da to passively diffuse across them, while hydrophilic and highly negatively charged naked siRNA, not surprisingly, has no ability to enter cells. Lastly, even if siRNA manages to enter a cell, it cannot easily escape from the endosomes to engage the cytoplasmic RNAi machinery. All these barriers combine to severely limit the application of siRNA drugs for brain disease therapy.” (pages 563-566).
Zheng taught that although the BBB largely remains intractable, studying its architecture and function has led to a few effective methodologies allowing NPs to pass (Figure 3), such as the opening of TJs, receptor-mediated transcytosis (RMT), cell-mediated transport, carrier-mediated transport, and adsorptive-mediated transcytosis. Zheng notes that a review of the recent literature on siRNA nanomedicines for brain disease treatment reveals that most, if not all, researchers use an RMT strategy to help siRNAs to traverse the BBB (page 568, ¶2). However, although the RMT approach has demonstrated great potential for delivery of siRNA into the brain, the intrinsic limits of transcellular transport may limit the overall success of RMT-based siRNA brain delivery (paragraph bridging pages 569-570). Despite the numerous ligands that can mediate siRNA NP traversal of the BBB by RMT approaches, one drawback is their low efficiency. Most studies have exhibited several-fold improvement of siRNA brain accumulation relative to the non-RMT approach. However, because the BBB is extremely efficient at preventing NPs from penetrating into the brain, even several-fold enhancement in brain accumulation may still not meet the required therapeutic dosage of siRNA nanomedicines for brain disease treatment. Thus, more effective strategies should be explored to aid siRNA nanoformulations in traversing the BBB (page 570, ¶2).
The oral, intramuscular, intraperitoneal, or subcutaneous routes recited in Specification add complexity to the claimed methods because they inherently require that the administered siRNAs must gain access to the vascular compartment in order to eventually arrive at the BBB. The specification as filed provides no guidance as to how to obtain this access while still maintaining the ability to cross the BBB for access to the brain. In view of the high degree of unpredictability of those routes of administration, the art recognized issues with siRNA stability in vivo, and the challenges associated with inducing charged molecules of the size of siRNA to traverse tissue and cellular barriers in vivo, it is highly unpredictable as to whether any of the recited routes other than intrathecal or intravenous administration can provide delivery of sufficient siRNA to brain to achieve the outcomes recited by the rejected claims.
Guidance and Examples in the specification
The specification as filed provides no working example of siRNA delivery to brain by any route. Guidance is limited to generic direction to formulate siRNAs with appropriate excipients and carriers, and does not address the issues set forth above.
Finding of a requirement for undue experimentation
In view of the nature of the invention, breadth of the claims, state and predictability of the art, the lack of working examples, and the lack of any guidance to overcome the issues inherent in delivery of siRNA to brain by oral, intramuscular, intraperitoneal, or subcutaneous routes, one of skill could not practice the invention commensurate in scope with the claims without undue experimentation.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1 and 8-10 rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. The claim(s) recite a composition comprising a nucleic acid sequence (i.e., a natural product). However, the claims do not include elements, when considered separately and in combination, that are sufficient to amount to significantly more than the judicial exceptions as outlined below.
Subject Matter Eligibility Test for Products and Processes – Claim 1
Step 1 - Is the Claim to a Process, Machine, Manufacture or Composition of Matter? YES
Claim 1 is directed to a composition comprising a nucleic acid sequence or molecule. Thus, the claims are directed to a statutory category (e.g., a product).
Step 2A, Prong One - Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES
Natural phenomena have been identified by the courts by way of example, including natural products and natural correlations. The claims recite 1 judicial exception: a composition comprising a nucleic acid sequence or molecule comprising a sequence having at least 90% identity to the sequence set forth in… SEQ ID NO 57. For natural products, products that are not “markedly different” than their naturally occurring counterpart are judicial exceptions. See MPEP 2016.04((b). MPEP 2106.04(c) outlines the markedly different analysis. The claim recites a composition comprising a nucleic acid with a sequence having at least 90% identity to SEQ ID NO 57. SEQ ID NO 57 is an RNA molecule by virtue of its uracil nucleotides. An mRNA encoding Cpr47Ef from Bactrocera oleae has a sequence that is 92% identical to SEQ ID NO 57 (NCBI Reference Sequence: XM_036362666.2, https://www.ncbi.nlm.nih.gov/nucleotide/XM_036362666.2, [retrieved January 8, 2026], nucleotides 1851-1878). A Bactrocera oleae cell that expresses the Cpr47Ef-encoding mRNA is encompassed by “a composition comprising” the nucleic acid, and is the closest naturally occurring counterpart. Because the Bactrocera oleae cell is entirely encompassed by the genus of the claimed composition, the claimed composition is not markedly different than its naturally occurring counterpart and constitutes a judicial exception.
Step 2A, Prong Two - Does the Claim Recite an Additional Elements that Integrate the Judicial Exception into a Practical Application? NO
The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception. In this case, there are no additional elements in the claim that integrated the judicial exception into a practical application.
Step 2B - Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO
The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim (MPEP 2106.05). However, there are no additional recited elements recited in the claim, and therefore the claim does not amount to "significantly more" than the judicial exception.
Subject Matter Eligibility Test for Products and Processes – Dependent claims
Claims 8-10 recites the composition further comprising a pharmaceutical acceptable carrier, which can be lipid-based and comprise a liposome. The Specification defines “pharmaceutical acceptable carrier” as referring to solvents, dispersion media, coatings, antibacterial, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants that can be used as media for a pharmaceutically acceptable substance, and provides examples including liposomes, hydrogels, microparticles, nanoparticles, micelles (page 50). The cells of Bactrocera oleae, a species of fruit fly, also comprise vesicles, which are a natural type of liposome. Thus, the claimed composition in claims 8-10 are not markedly different than its naturally-occurring counterpart, a Bactrocera oleae cell. The claims do not recite any additional element that would integrate the judicial exception into a practical application or would amount to “significantly more" than the judicial exception.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 1-16, 23-24 and 38 are rejected under 35 U.S.C. 103 as being unpatentable over Kraemer (US 20190328766 A1, published October 31, 2019) in view of Wigington (Wigington et al., Journal of Biological Chemistry (2016), 291: 22442-22459), Kulisch (Diver Substrate siRNA Technology, BioRadiations (2006), 120, page 1-8) and Genbank (NM_024824.5, Homo sapiens zinc finger CCCH-type containing 14 (ZC3H14), transcript variant 1, mRNA, https://www.ncbi.nlm.nih.gov/nuccore/NM_024824.5, [retrieved January 8, 2026]). Claims 3-4 are evidenced by Invitrogen (Stealth™ RNAi Collections, Version E, published March 2006).
Claims 2 and 14 and their dependent claims are indefinite for the reasons described above in paragraph 6. For the purposes of examination, claims 2 and 14 are interpreted as requiring a blunt-ended double-stranded siRNA molecule comprising at least one sequence having at least 90% identity to SEQ ID NOs 6-73 and must be capable of reducing expression of the MSUT2 gene.
Regarding claims 1-2 and 5-6, Kraemer teaches MSUT2 is also known as ZC3H14 ([0026]). Kraemer teaches MSUT2 inhibitors can be small interfering RNAs (siRNAs) ([0122]). Kraemer teaches knocking down MSUT2 expression using siRNAs treatment ([0164], FIG 7A). Kraemer teaches the MSUT2 mRNA-targeted sequences of five siRNAs (0128]), which overlaps with SEQ ID NO 52 of the examined application, and which are all shown aligned below with the MSUT2 mRNA sense strand from Genbank (see below)
AUGAUGCAAAGUGUACUAAACCAG (24-mer)
AUGAUGCAAAGUGUACUAAACCAGAUU (27-mer)
AUGAUGCAAAGUGUACUAAACCAGAU (26-mer)
AUGAUGCAAAGUGUACUAAACCA (23-mer)
AUAUGAUGCAAAGUGUACUAAACCAG (26-mer)
UAUGAUGCAAAGUGUACUAAACCAG (25-mer)
SEQ ID NO 50: AAUAUGAUGCAAAGUGUACUAAACCAGA
Sense mRNA: GUAAAUAUGAUGCAAAGUGUACUAAACCAGAUUGUGGG
Regarding claims 7-13, Kraemer teaches pharmaceutical compositions with siRNAs ([0138]), which can include lipid-based and polymer-based colloids, including liposomes carriers ([0139]). Kraemer teaches the pharmaceutical compositions can be formulated for intravenous, intramuscular, subcutaneous or intrathecal administration ([0141]).
Regarding claim 14-16 and 38, Kraemer teaches MSUT2 knockout mice exhibit fewer Alzheimer’s symptoms including decreased learning and memory deficits (i.e., a treatment for Alzheimer’s disease) ([0153]) and have dramatically reduced number of hippocampal neurofibrillary tangles (NFTs) and phosphorylated tau protein (pTau) ([0156]). Kraemer teaches treating HEK293/tau cells (i.e., cell lines with constitutively expressing human tau protein) with MSUT2-targeted siRNAs inhibited the expression of MSUT2 and reduced the amount of pTau and oligomerized/aggregated human Tau ([0164]; FIG. 7-8). Kraemer teaches methods for treating AD and reducing the level of phosphorylated and aggregated Tau and inhibition of MSUT2 expression in AD patients (Abstract; [0114]-[0118]).
Regarding claims 23-24, Kraemer teaches the compositions disclosed herein (i.e., pharmaceutical compositions with MUST2-targeting siRNAs) can be administered with cholinesterase inhibitors, including galantamine, rivastigmine or donepezil ([0135]).
Kraemer does not teach the overall structures of siRNAs such that the siRNA molecule is double stranded and having blunt ends. Kraemer does not teach siRNAs comprising a sequence that is 90% identical to SEQ ID NOs 6-73.
Wigington teaches knocking down expression of ZC3H14 (i.e., MSUT2) with siRNAs (page 22445, ¶5; Fig 1B). Wigington teaches designing siRNAs such that they target the (CCCH)5 region that is present in all three mRNA/protein isoforms (Fig 1A). Wigington teaches the sequences targeted by the ZC3H14-targeting siRNAs are CACATTCTACCATCCCACCATTAAT and TGTTTGTTTGTTCACCCAAATTGTA, which were “pre-designed Stealth siRNAs available from Invitrogen” (page 22443, ¶5). Invitrogen teaches that Stealth RNAi are blunt end double-stranded RNA having a sense and an antisense strand (page 3, ¶1). Thus, the sequence of the antisense portion of the siRNAs must have inherently been AUUAAUGGUGGGAUGGUAGAAUGUG (25-mer) and UACAAUUUGGGUGAACAAACAAACA (25-mer), which overlap with SEQ ID NOs 49 and 69 of the examined application as follows (also included is the MSUT2 mRNA complementary strand deduced from Genbank – see below):
Wigington #1: AUUAAUGGUGGGAUGGUAGAAUGUG
SEQ ID NO 69: UGGUGGGACAUUAAUGGUGGGAUGGUAG
Antisense mRNA: UGUCGUGGUGGGACAUUAAUGGUGGGAUGGUAGAAUGUGCAGU
Wigington #2: UACAAUUUGGGUGAACAAACAAACA
SEQ ID NO 49: UAUUUACAAUUUGGGUGAACAAACAAAC
Antisense mRNA: AUCAUAUUUACAAUUUGGGUGAACAAACAAACAUUUU
Kulisch teaches Dicer substrate siRNA Technology (title). Kulisch teaches longer dsRNAs are Dicer substrates which can facilitate loading the siRNA into the RISC complex (Fig 1; page 2, ¶3). Kulisch teaches the mechanism of Dicer-substrate siRNA mRNA targeting requires a double-stranded RNA comprising a guide strand that is 100% complementary to the target mRNA (i.e., an antisense strand), and a passenger strand that has the same sequence as the target mRNA (sense strand) (Fig 2). Kulisch teaches using blunt-ended double-stranded RNA molecules (dsRNAs) from 25-30 base-pairs are up to 100-fold more potent than 21-mer siRNAs targeting the same sequence (page 2, ¶3). Kulisch teaches siRNAs that are less than 30-nt in length does not activate the interferon-mediated inflammation pathway (page 3, ¶3).
Genbank teaches MSUT2 is a synonym for ZC3H14 (page 2). Genbank teaches the mRNA sequence of ZC3H14/MSUT2 transcript variant 1 (pages 6-10). Genbank teaches the mRNA sequence has 100% identity to the sequence that Kraemer’s siRNAs target (positions 2025-2051) (page 6). Genbank teaches MSUT2 mRNA sequence has a complementary sequence with 100% identity to Wigington’s siRNA sequences and to SEQ ID NO 49 (positions 1998-2025) and SEQ ID NO 69 (positions 2239-2266) (page 6).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have designed an MSUT2-targeting dsRNA having a guide sequence with SEQ ID NO 49 or 69 or a sense/passenger strand with SEQ ID NO 50 and complexed it with the complementary RNA strand (i.e., SEQ ID NOs 48, 68 and 51, respectively) and then used the siRNAs in Kraemer’s methods of treating Alzheimer’s patients and reducing pTau and aggregated human Tau through inhibition of MSUT2 expression. It would have amounted to using known Dicer-substrate siRNA design principles and the known MSUT2 mRNA sequence to guide the design of a finite number of 27-29-mers with 100% complementarity to the MSUT2 mRNA at Wigington’s targeted (CCCH)5 domain protein-coding region. As shown above Wigington’s siRNAs differ from the claimed SEQ ID NOs 49 and 69 by being 25-mers instead of 28-mers and being shifted 3’ by 4 or 9 nucleotides. Likewise, Kraemer’s target MSUT2 sequence differs from claimed siRNA sense strand sequences by two nucleotides. The skilled artisan would have predicted that double-stranded siRNAs having SEQ ID NOs 49 and 69 as the guide strand or SEQ ID NO 50 as the passenger strand could be designed from Wigington’s and Kraemer’s siRNAs because 1) Kraemer teaches designing the guide strand of siRNAs targeting the same mRNA target region that are between 24 and 27 nucleotides in length and shifted relative to each other, and 2) the claimed guide/passenger strands of the siRNAs have 100% complementary/identity to a known MSUT2 isoform mRNA, which is also a known design principle for siRNAs taught by Kulisch and Kraemer. The skilled artisan would have been motivated to increase the length of Wigington’s and Kraemer’s siRNAs because Kulisch teaches 27-30-mers have higher repression efficiencies than shorter siRNAs. The skilled artisan would have been motivated to try siRNAs with SEQ ID NOs 49, 50 and 69 because there are a finite number of 27-29-mers with 100% complementarity/identity to the MSUT2 mRNA that targets the coding region for the (CCCH)5 domain that is present in all MSUT2 isoforms.
Regarding the method claims, it would have been entirely predictable that the double-stranded siRNAs comprising a guide strand with SEQ ID NOs 49, 51 or 69, and a passenger strand with SEQ ID NOs 48, 50 or 68 could be administered to cells and Alzheimer’s patients for knock down of MSUT2 expression, with concomitant reduction in pTau and aggregated Tau since 1) Kraemer and Wigington teach very similar siRNAs having such an effect and 2) Kulisch teaches the longer 28-mers should be more potent than the shorter 25-26-mers.
Regarding claims 3-4, Invitrogen teaches that Stealth RNAi duplexes are chemically modified in a manner that prevents sense strand activity (page 3, ¶1). Because the Stealth siRNAs consist of only RNA nucleotides, the chemical modifications must have been placed on at least one nucleotide of the sense, antisense, or both strands of the siRNAs. Invitrogen teaches the Stealth RNAi duplexes show effective knockdown and exhibits enhanced stability (page 3, ¶1).
It would have been obvious to one skilled in the art before the effective filing date to have included the chemical modifications of the Stealth siRNAs because Invitrogen teaches that the siRNAs with the chemical modifications demonstrate effective stability and knockdown of the target gene.
Non-statutory Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-13, 15-16 and 38 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2 of U.S. Patent No. 11439658 in view of Kraemer (US 20190328766 A1, published October 31, 2019), Wigington (Wigington et al., Journal of Biological Chemistry (2016), 291: 22442-22459), Kulisch (Diver Substrate siRNA Technology, BioRadiations (2006), 120, page 1-8) and Genbank (NM_024824.5, Homo sapiens zinc finger CCCH-type containing 14 (ZC3H14), transcript variant 1, mRNA, https://www.ncbi.nlm.nih.gov/nuccore/NM_024824.5, [retrieved January 8, 2026]) and Invitrogen (Stealth™ RNAi Collections, Version E, published March 2006).
Patented claim 1 recites “A method of inhibiting expression of a MSUT2 polynucleotide in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally. Patented claim 2 recites the same administering step as patented claim 1, but for a “A method of reducing phosphorylated and aggregated human tau protein in a subject in need thereof”.
The patented claims do not recite sequence with the SEQ ID NOs recited in the examined claims or the siRNAs are blunt-ended. The patented claims do not recite administering the siRNAs in a pharmaceutical composition (claims 7-13), chemically modifications in the siRNAs (claims 3-4).
The teachings of Kraemer, Wigington, Kulisch, Genbank and Invitrogen are recited above in paragraphs 47-50, 52-57 and 54 and incorporated here.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the dsRNA siRNAs in the patented method with blunt-ended dsRNA siRNAs comprising sense/antisense strands with SEQ ID NOs 48/49, 50/51 or 68/69. The obviousness of having designed such siRNAs, including chemically modified siRNAs, and used in methods for inhibiting expression of MSUT2 or reducing levels of phosphorylated and aggregated human Tau is recited above in paragraphs 55, 56 and 58 and incorporated here.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635