DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s amendment filed July 2, 2026, amending claims 1-2, 5-6, 11-12, 14-16 and 24, and canceling claims 4, 7, 13 and 23 is acknowledged. Claims 1-3, 5-6, 8-12, 14-16, 24 and 38 are pending and under examination.
The amendment to claims 2, 11 and 14 overcome the §112(b) rejections. The cancelation of claim 4 renders the §112(d) rejection moot. The incorporation of the limitations from canceled claim 23 and the addition of the administration route limitations into claims 14-16 overcomes the §112(a) rejection. The deletion of SEQ ID NO 57 from claim 1 overcomes the §101 rejection. The deletion of SEQ ID NOs 49, 51 and 69 from claims 1, 2 and 6 overcomes the §103 rejection over Kraemer in view of others.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant's amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 1-3, 5-6, 8-12, 14-16, 24 and 38 are rejected under 35 U.S.C. 103 as being unpatentable over Kraemer (US 20190328766 A1, published October 31, 2019; of record) in view of Wigington (Wigington et al., Journal of Biological Chemistry (2016), 291: 22442-22459; of record), Kulisch (Dicer Substrate siRNA Technology, BioRadiations (2006), 120, page 1-8; of record) and Genbank (NM_024824.5, Homo sapiens zinc finger CCCH-type containing 14 (ZC3H14), transcript variant 1, mRNA, https://www.ncbi.nlm.nih.gov/nuccore/NM_024824.5, [retrieved January 8, 2026] ; of record). Claims 3-4 are evidenced by Invitrogen (Stealth™ RNAi Collections, Version E, published March 2006; of record). This is a new rejection necessitated by amendment.
Regarding claims 1-2 and 5-6, Kraemer teaches MSUT2 is also known as ZC3H14 ([0026]). Kraemer teaches MSUT2 inhibitors can be small interfering RNAs (siRNAs) ([0122]). Kraemer teaches knocking down MSUT2 expression using siRNAs treatment ([0164], FIG 7A). Kraemer teaches the MSUT2 mRNA-targeted sequences of five siRNAs (0128]), with are aligned below with the MSUT2 mRNA sense strand from Genbank, nucleotides 2019-2061 (see Genbank’s teaching below)
AUGAUGCAAAGUGUACUAAACCAG (24-mer)
AUGAUGCAAAGUGUACUAAACCAGAUU (27-mer)
AUGAUGCAAAGUGUACUAAACCAGAU (26-mer)
AUGAUGCAAAGUGUACUAAACCA (23-mer)
AUAUGAUGCAAAGUGUACUAAACCAG (26-mer)
UAUGAUGCAAAGUGUACUAAACCAG (25-mer)
Sense mRNA:2019-GUAAAUAUGAUGCAAAGUGUACUAAACCAGAUUGUGGG-2061
Regarding claims 8-12, Kraemer teaches pharmaceutical compositions with siRNAs ([0138]), which can include lipid-based and polymer-based colloids, including liposomes carriers ([0139]). Kraemer teaches the pharmaceutical compositions can be formulated for intravenous, intramuscular, subcutaneous or intrathecal administration ([0141]).
Regarding claim 14-16, 24 and 38, Kraemer teaches MSUT2 knockout mice exhibit fewer Alzheimer’s symptoms including decreased learning and memory deficits (i.e., a treatment for Alzheimer’s disease) ([0153]) and have dramatically reduced number of hippocampal neurofibrillary tangles (NFTs) and phosphorylated tau protein (pTau) ([0156]). Kraemer teaches treating HEK293/tau cells (i.e., cell lines with constitutively expressing human tau protein) with MSUT2-targeted siRNAs inhibited the expression of MSUT2 and reduced the amount of pTau and oligomerized/aggregated human Tau ([0164]; FIG. 7-8). Kraemer teaches methods for treating AD and reducing the level of phosphorylated and aggregated Tau and inhibition of MSUT2 expression in AD patients (Abstract; [0114]-[0118]). Kraemer teaches the compositions disclosed herein (i.e., pharmaceutical compositions with MUST2-targeting siRNAs) can be administered with cholinesterase inhibitors, including galantamine, rivastigmine or donepezil ([0135]).
Kraemer does not teach the overall structures of siRNAs such that the siRNA molecule is double stranded and having blunt ends. Kraemer does not teach siRNAs comprising a sequence that is 90% identical to SEQ ID NOs 6-47, 52-67 or 70-73.
Wigington teaches knocking down expression of ZC3H14 (i.e., MSUT2) with siRNAs (page 22445, ¶5; Fig 1B). Wigington teaches designing siRNAs such that they target the (CCCH)5 region that is present in all three mRNA/protein isoforms (Fig 1A). Wigington teaches the sequences targeted by the ZC3H14-targeting siRNAs including TGTTTGTTTGTTCACCCAAATTGTA, which were “pre-designed Stealth siRNAs available from Invitrogen” (page 22443, ¶5). Invitrogen teaches that Stealth RNAi are blunt end double-stranded RNA having a sense and an antisense strand (page 3, ¶1). Thus, the sequence of the antisense portion of the siRNA must have inherently been UACAAUUUGGGUGAACAAACAAACA (25-mer). Wigington’s sense strand is aligned below with the MSUT2 mRNA sense strand from Genbank, nucleotides 1970-2020 (see Genbank’s teaching below) and SEQ ID NO 46 (claimed sense siRNA strand):
Wigington: UGUUUGUUUGUUCACCCAAAUUGUA
SEQ ID NO 46: CCAAUUGUAAAUUUGCUGAAAAAUGUUU
Sense mRNA: 1970-uccccaauuguaaauuugcugaaaaauguuuguuuguucacccaaauuguaaaua
Kulisch teaches Dicer substrate siRNA Technology (title). Kulisch teaches longer dsRNAs are Dicer substrates which can facilitate loading the siRNA into the RISC complex (Fig 1; page 2, ¶3). Kulisch teaches the mechanism of Dicer-substrate siRNA mRNA targeting requires a double-stranded RNA comprising a guide strand that is 100% complementary to the target mRNA (i.e., an antisense strand), and a passenger strand that has the same sequence as the target mRNA (sense strand) (Fig 2). Kulisch teaches using blunt-ended double-stranded RNA molecules (dsRNAs) from 25-30 base-pairs are up to 100-fold more potent than 21-mer siRNAs targeting the same sequence (page 2, ¶3). Kulisch teaches siRNAs that are less than 30-nt in length does not activate the interferon-mediated inflammation pathway (page 3, ¶3).
Genbank teaches MSUT2 is a synonym for ZC3H14 (page 2). Genbank teaches the mRNA sequence of ZC3H14/MSUT2 transcript variant 1 (pages 6-10). Genbank teaches the mRNA sequence has 100% identity to the sequence that Kraemer’s siRNAs target (positions 2025-2051), Wigington’s siRNA target sequences, and SEQ ID NO 46 (positions 1974-2001) (page 6).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have designed an MSUT2-targeting dsRNA having a sense/passenger strand with SEQ ID NO 46 and complexed it with the complementary RNA strand having SEQ ID NO 47 and then used the siRNAs in Kraemer’s methods of treating Alzheimer’s patients and reducing pTau and aggregated human Tau through inhibition of MSUT2 expression. It would have amounted to using known Dicer-substrate siRNA design principles and the known MSUT2 mRNA sequence to guide the design of a finite number of 27-29-mers with 100% complementarity to the MSUT2 mRNA at Wigington’s targeted (CCCH)5 domain protein-coding region. As shown above Wigington’s siRNAs differ from the claimed SEQ ID NOs 46/47 by being 25-mers instead of 28-mers and being shifted 5’ by 23 nucleotides. Kraemer’s target MSUT2 sequence is adjacent to the claimed SEQ ID NO 46 siRNA sense strand sequences. The skilled artisan would have predicted that double-stranded siRNAs having SEQ ID NOs 47 as the guide strand and SEQ ID NO 46 as the passenger strand could be designed using Wigington’s and Kraemer’s siRNAs and the Genbank MSUT2 transcript sequence because 1) Kraemer teaches designing the guide strand of siRNAs targeting the same mRNA target region that are between 24 and 27 nucleotides in length and shifted relative to each other, and 2) the claimed guide/passenger strands of the siRNAs have 100% complementary/identity to a known MSUT2 isoform mRNA, which is also a known design principle for siRNAs taught by Kulisch and Kraemer, and 3) the target sequence is in between the targeted sequences of Kraemer and Wigington. The skilled artisan would have been motivated to increase the length of Wigington’s and Kraemer’s siRNAs because Kulisch teaches 27-30-mers have higher repression efficiencies than shorter siRNAs. The skilled artisan would have been motivated to try siRNAs with SEQ ID NOs 46/47 because there are a finite number of 27-29-mers with 100% complementarity/identity to the MSUT2 mRNA that targets the coding region for the (CCCH)5 domain that is present in all MSUT2 isoforms.
Regarding the method claims, it would have been entirely predictable that the double-stranded siRNAs comprising a guide strand with SEQ ID NOs 47, and a passenger strand with SEQ ID NOs 46 could be administered to cells and Alzheimer’s patients for knock down of MSUT2 expression, with concomitant reduction in pTau and aggregated Tau since 1) Kraemer and Wigington teach very similar siRNAs having such an effect and 2) Kulisch teaches the longer 28-mers should be more potent than the shorter 25-26-mers.
Regarding claims 3-4, Invitrogen teaches that Stealth RNAi duplexes are chemically modified in a manner that prevents sense strand activity (page 3, ¶1). Because the Stealth siRNAs consist of only RNA nucleotides, the chemical modifications must have been placed on at least one nucleotide of the sense, antisense, or both strands of the siRNAs. Invitrogen teaches the Stealth RNAi duplexes show effective knockdown and exhibits enhanced stability (page 3, ¶1).
It would have been obvious to one skilled in the art before the effective filing date to have included the chemical modifications of the Stealth siRNAs because Invitrogen teaches that the siRNAs with the chemical modifications demonstrate effective stability and knockdown of the target gene.
Response to Arguments - §103
Applicant argues that the rejection does not render obvious the siRNA sequences of the amended claims (Remarks, page 14-17). This argument has been fully considered but is moot as it pertains to the withdrawn rejection. The new §103 rejection, necessitated by amendment, provides a prima facie case of obviousness of designing and using an siRNA with SEQ ID NOs 46/47.
Non-statutory Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-3, 5-6, and 8-12 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2 of U.S. Patent No. 11439658 in view of Kraemer (US 20190328766 A1, published October 31, 2019; of record), Wigington (Wigington et al., Journal of Biological Chemistry (2016), 291: 22442-22459; of record), Kulisch (Dicer Substrate siRNA Technology, BioRadiations (2006), 120, page 1-8; of record) and Genbank (NM_024824.5, Homo sapiens zinc finger CCCH-type containing 14 (ZC3H14), transcript variant 1, mRNA, https://www.ncbi.nlm.nih.gov/nuccore/NM_024824.5, [retrieved January 8, 2026]; of record) and Invitrogen (Stealth™ RNAi Collections, Version E, published March 2006; of record). This is a new rejection necessitated by amendment.
Patented claim 1 recites “A method of inhibiting expression of a MSUT2 polynucleotide in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally. Patented claim 2 recites the same administering step as patented claim 1, but for a “A method of reducing phosphorylated and aggregated human tau protein in a subject in need thereof”.
The patented claims do not recite sequence with the SEQ ID NOs recited in the examined claims or the siRNAs are blunt-ended. The patented claims do not recite administering the siRNAs in a pharmaceutical composition (claims 7-13), chemically modifications in the siRNAs (claims 3-4).
The teachings of Kraemer, Wigington, Kulisch, Genbank and Invitrogen are recited above in paragraphs 8-10, 12-17 and 14 and incorporated here.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the dsRNA siRNAs in the patented method with blunt-ended dsRNA siRNAs comprising sense/antisense strands with SEQ ID NOs 46/47. The obviousness of having designed such siRNAs, including chemically modified siRNAs, and used in methods for inhibiting expression of MSUT2 or reducing levels of phosphorylated and aggregated human Tau is recited above in paragraphs 15, 16 and 18 and incorporated here.
Response to Arguments – NSDP
Applicant’s request to hold the nonstatutory double patenting rejections in abeyance is denied (see Remarks, page 18). The rejection will remain in place until it is overcome by amendment, terminal disclaimer, or otherwise.
Conclusion
No claims are allowable.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights