DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on July 28, 2026 has been entered.
Status of Claims / Response to Amendment
This office action is in response to an amendment filed on July 28, 2026.
Claims 1-2, 4-5 and 7-19 were previously pending. Applicant amended claims 1, 4, 7, and 9; claim 20 is newly added.
Claims 1-2, 4-5 and 7-20 are currently pending, with claims 2, 4, and 10-19 withdrawn.
Claims 1, 5, 7-9 and 20 are under consideration.
All of the previously presented rejections have been withdrawn as being obviated by the amendment of the claims, which introduces new limitations that were not previously considered in the prior rejection (e.g., claim 1 has been amended to recite:” wherein the linker comprises an aromatic group that interacts with the surface of the rGO via π–π interactions and a functional group that binds to the biological probe”).
Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
This office action contains new grounds for rejection necessitated by amendment.
Priority -- Updated
The earliest priority date of the instant claims 1, 5, 7-9 and 20 is November 24, 2020, filling date of the REPUBLIC OF KOREA Patent Application Number 10-2020-0159099, to which the present application claims priority.
Claim Interpretation -- Updated
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
For the purpose of applying prior art, claim 1 recites the term "biosensor." The specification defines the term on page 2 as follows:
"The term “biosensor” as used herein is configured to measure the presence or absence and amount of a specific biological material, and is a device that converts a physical or chemical change caused by a selective interaction between a biological element and an analyte into a recognizable optical or electrical signal."
Accordingly, under this definition, the term “biosensor” encompasses any device having structures capable of performing these functions, namely measuring a biological material by converting a physical or chemical change resulting from a selective interaction into an optical or electrical signal.
For the purpose of applying prior art, claim 1 recites:
A biosensor comprising
a reaction unit in which an interaction occurs physically or chemically with a target material in a sample,
wherein the reaction unit comprises reduced graphene oxide (rGO) and a biological probe that specifically binds to the target material, and
wherein the reaction unit comprises a linker to immobilize the biological probe on a surface of the rGO.
MPEP 2114 addresses recitations of the manner in which an apparatus is intended to be employed:
“[A]pparatus claims cover what a device is, not what a device does.” Hewlett-Packard Co. v. Bausch & Lomb Inc., 909 F.2d 1464, 1469, 15 USPQ2d 1525, 1528 (Fed. Cir. 1990)”
This means that the manner of operating the device does not differentiate apparatus claims from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The MPEP further states:
“A claim containing a “recitation with respect to the manner in which a claimed apparatus is intended to be employed does not differentiate the claimed apparatus from a prior art apparatus” if the prior art apparatus teaches all the structural limitations of the claim. Ex parte Masham, 2 USPQ2d 1647 (Bd. Pat. App. & Inter. 1987)”
This guidance emphasizes that the focus should be on the structural limitations of the apparatus claim, rather than its intended use.
Therefore, the phrase "in which an interaction occurs physically or chemically with a target material in a sample" is interpreted under BRI as intended use that does not further distinguish the claimed device from prior art devices with the same structure.
For the purpose of applying prior art, claim 1 recites the term “biological probe,” which is defined in the specification at page 5 as follows:
"The term “biological probe” as used herein refers to a material capable of imparting functionalization to the reaction unit or a material specifically binding to the target material. The biological probe may include DNA, RNA, PNA, a nucleotide, a nucleoside, a protein, a polypeptide, a peptide, an amino acid, a carbohydrate, an enzyme, an antibody, an antigen, a receptor, a virus, a substrate, a ligand, a membrane, or a combination thereof."
According to this definition, the term "biological probe" encompasses any material capable of performing these functions, regardless of whether the material is biological or synthetic in origin.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 5, 7-9 and 20 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Jahanbani (Jahanbani S, Benvidi A. A novel electrochemical DNA biosensor based on a modified magnetic bar carbon paste electrode with Fe3O4NPs-reduced graphene oxide/PANHS nanocomposite. Mater Sci Eng C Mater Biol Appl. 2016 Nov 1;68:1-8. doi: 10.1016/j.msec.2016.05.056. Epub 2016 May 16. PMID: 27523989).
Regarding claim 1, Jahanbani teaches a biosensor comprising
a reaction unit in which an interaction occurs physically or chemically with a target material in a sample, wherein the reaction unit comprises
reduced graphene oxide (rGO) (Scheme 1) and
a biological probe that specifically binds to the target material (Scheme 1, DNA probe),
wherein the reaction unit comprises a linker to immobilize the biological probe on a surface of the rGO (Scheme 1; Abstract, “1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS) as a linker for detection of DNA sequences.”), and
wherein the linker comprises an aromatic group that interacts with the surface of the rGO via π–π interactions (p.1, right-hand col., lines 9-14, PANHS, “contains an anchor group and a terminal group with hydrophobic π system group (a scaffold molecule) which has strong attachment to the base plane of the carbon sheets through π-stacking ”) and a functional group that binds to the biological probe (Scheme 1, PANHS comprises succinimide ester group, which binds to the amine group on DNA probe; see also p.1, right-hand col., lines 15-17).
Regarding claim 5, it recites: "wherein the biological probe is for detecting one or more miRNAs selected from the group consisting of miRNA21, miRNA1246, and let7b."
This claim is anticipated by Jahanbani because it does not recite any structural features applicable to the claimed device.
Here, claim 5 recites language describing the intended use of the biological probe for detecting miRNAs but does not specify any structural feature that directly supports or relates to this application. The claim lacks any defined structural characteristics or clear functional relationship between the biological probe and the miRNA.
Therefore, the intended use language does not distinguish the claimed device from the prior art 1.
Regarding claim 7, Jahanbani teaches a succinimide group (p.1, right-hand col., lines 15-17, PANHS comprises succinimide ester group)
Regarding claim 8, Jahanbani teaches target material is a nucleic acid capable of participating in a sequence- specific hybridization reaction with a complementary sequence (scheme 1).
Regarding claim 9, Jahanbani teaches the biosensor is configured to detect the target material in a urine sample (Scheme 1).
Jahanbani teaches an electrode surface-modified with reduced graphene oxide (Scheme 1).
Accordingly to the specification, an electrode modified with reduced graphene oxide is the structural feature that enables the biosensor to detect target material in a urine sample.
“In an embodiment, in the case of the biosensor having the electrode surface modified with reduced graphene oxide nanosheet (rGON), the stability is significantly excellent in the urine environment as compared to the case where the electrode surface is not modified. In detail, it was confirmed that the shift of current signals is significantly reduced (see FIGS. 7A to 7B)” (page 4, para 7).
Therefore, Jahanbani’s teaching meets the limitation “the biosensor is configured to detect the target material in a urine sample. ”
Regarding claim 20, Jahanbani teaches the linker is pyrenebutyric acid N-hydroxy succinimide ester (PANHS) (Scheme 1).
Prior Art
For the purpose of compact prosecution, the examiner has reviewed the application's entire disclosure, but has not readily identified any subject matter that is not taught or suggested by the prior art, or combined in a non-obvious way.
Below are relevant prior art not used in rejection but pertinent to the claims or disclosure.
Immobilizing probes onto graphene surface through π–π interaction via a linker is well – known in the art:
Xu et al. Electrophoretic and field-effect graphene for all-electrical DNA array technology. Nat Commun 5, 4866 (2014). doi.org/10.1038/ncomms5866, in Figure 5, discloses immobilization of probe DNA via a BSA linker.
Liu et al., Biological and chemical sensors based on graphene materials. Chem. Soc. Rev. 2012; 41 (6): 2283–2307. doi.org/10.1039/c1cs15270j , teaches:
“Functional molecules can be immobilized onto graphene through linker molecules, for instance, 1-pyrenebutanoic acid succinimidyl ester whose pyrene group at one end noncovalently binds to the graphene surface through strong π–π interaction while the succinimidyl ester group at the other end is reactive to amines on biomolecules. Other bifunctional molecules with an aromatic tail and a reactive end (e.g.perylene tetracarboxylic acid, thionine and many porphyrin derivatives) can also be employed as linker molecules” (page 2286)
“Most proteins bear charges or dipoles under physiological conditions. This provides possibilities for electronic detection through the field-effect or scattering effect. And many proteins possess aromatic-ring-containing amino acids on the surface. Therefore, they can firmly bind to graphene via π–π interaction and therefore may be detected through the doping effect.” (Page 2294).
Kim et al., Emerging Approaches for Graphene Oxide Biosensor. Anal Chem. 2017 Jan 3;89(1):232-248. doi: 10.1021/acs.analchem.6b04248. Epub 2016 Nov 30. PMID: 28105836., discloses a system using aptamer conjugated AuNPs that were immobilized on GO (AptMUC1-AuNP/GO) via π–π interactions between aptamer and GO. (p. 240).
Krishnan et al., A review on graphene-based nanocomposites for electrochemical and fluorescent biosensors. RSC Adv. 2019 Mar 18;9(16):8778-8881. doi: 10.1039/c8ra09577a. PMID: 35517682; PMCID: PMC9062009, in Figure 27, discloses a graphene biosensor, comprising antibody probes immobilized to the graphene via a PASE linker.
Liu et al., "The Expression of miR-21 in Brain Glioma Cells and its Effect of PI3K/AKT Signal Pathway Running." Journal of Psychiatry and Brain Science 1.1 (2016), discloses an anti-sense miR-21 oligonucleotide probe (5’- TCAACATCAGTCTGATAAGCTA -3’), comprising identical sequence to the probe sequence in the present disclosure (SEQ ID NO: 1).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681
1 Also, rGO biosensors are well-known in the art as being suitable for sensing miRNAs.
See page 8809 in Krishnan et al.. A review on graphene-based nanocomposites for electrochemical and fluorescent biosensors. RSC Adv. 2019 Mar 18;9(16):8778-8881. doi: 10.1039/c8ra09577a. PMID: 35517682; PMCID: PMC9062009.
“GO and rGO exhibit strong affinity for single-stranded nucleic acids (ssNAs) via hydrogen bonding or π–π interactions.444 Hence, GO and rGO have been extensively used for sensing miRNAs.”
Therefore, without reciting any structural feature of the probe, the phrase “for detecting one or more miRNAs… ” does not distinguish the claimed probe from a probe in a rGO biosensor, as taught by the prior art.
Prosecution Insights