DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Invention:
Applicant’s election of Invention group I (claims 1-14 and 28, drawn to a nucleic acid encoding a DUX4 antisense ribonucleic acid, a composition, i.e., a nanoparticle, an extracellular vesicle, an exosome or a vector, and a pharmaceutically acceptable carrier) in the reply filed on 04/30/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 15-19 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was considered made without traverse in the reply filed on 04/30/2026.
Species:
Applicant's election with traverse of Species A(b) (A nucleic acid comprising the nucleotide sequence of SEQ ID NOs: 1-18) in the reply filed on 04/30/2026 is acknowledged. The traversal is on the ground(s) that SEQ ID NO: 4 of option (b) is functionally linked to SEQ ID NO: 22 of claim 2, and should be examined together.
It is clear to Examiner that claim 2 is drawn to sequences in the target, and an election was not required in claim 2, since once an antisense sequence is picked in claim 1, the target sequence can be identified; one of ordinary skills in the art can reasonably determine the complementary targeted sequence claimed in claim 2.
A sequence alignment shows that SEQ ID NO: 44 is an exact match to complementary sequence SEQ ID NO: 22, as shown below (Qy = SEQ ID NO: 4; Db = SEQ ID NO: 22):
RESULT 1
US-18-038-878-22/c
Query Match 100.0%; Score 44; DB 1; Length 44;
Best Local Similarity 100.0%;
Matches 44; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AACCCCGCGTCCTAAAGCTCCTCCAGCAGAGCCCGGTATTCTTC 44
||||||||||||||||||||||||||||||||||||||||||||
Db 44 AACCCCGCGTCCTAAAGCTCCTCCAGCAGAGCCCGGTATTCTTC 1
The requirement is therefore deemed proper and is made FINAL.
Applicant’s election of Species Group B (a U7 promoter) and Species group C (a viral vector, specifically an AAV and more specifically rAAV9) in the reply filed on 04/30/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Application Status
This Application is a National entry under 35 U.S.C. § 371 of International Application PCT/US21/61109 filed 11/30/2021.
Preliminary amendments filed 12/20/2023 are hereby acknowledged. Claims 3,6, 9, 11-16, 18 and 28 are currently amended. Claims 20-27 are cancelled. Claims 1-19 and 28 are pending.
Claims 15-19 are withdrawn from consideration. Therefore, claims 1-14 and 28 are under consideration in this Office Action.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 08/23/2023 was previously acknowledged in Office Action dated 02/27/2026. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
However, the listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
The Drawings sheet filed 05/25/2023 are hereby acknowledged and are acceptable.
Specification
The abstract of the disclosure ([00186]) is objected to because the word “delaying” is somewhat illegible, and the term “said” is used.
Applicant is reminded of the proper language and format for an abstract of the disclosure. The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details.
The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided.
A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
The use of the terms “RNAscope” ([0031]-[0033], [0038], [00116], [00151], [00160]-[00162], [00164], [00166], [00170], [00173], [00182], [00184], [00186], and ref#30), “Lipofectamine” ([00153],[00155], [00161]), “Apo-ONE” , “SpectroMax” ([00155]), “Immobilon” ([00157]), “Vectashield”, “Alexa Fluor 594” ([00159]), “TRIzol”, “NanoDrop”, “Taqman” ([00164]), “GraphPad Prism 5” ([00166]), which are trade names or marks used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. §102 and §103 (or as subject to pre-AIA 35 U.S.C. §102 and §103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. §103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. §103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. §102(b)(2)(C) for any potential 35 U.S.C. §102(a)(2) prior art against the later invention.
Claims 1-14 and 28 are rejected under 35 U.S.C. §103 as being unpatentable over Harper (Harper,S.Q. WO 2017/147467 A1, published August 31, 2017; cited on IDS filed 08/23/2023) in view of Bradley (Bradley, R. et al. WO 2020/028134 A1, published February 06, 2020, with priority dates of July 30, 2018 and June 05, 2019, from US Provisional Applications 62/711,662 and 62/857,632 respectively; cited on IDS filed 08/23/2023).
Regarding claims 1 and 2, Harper teaches a nucleic acid encoding a DUX4 antisense ribonucleic acid (sequence 779), the nucleic acid comprising at least 90% sequence identity (local similarity) to sequence in SEQ ID NO: 4 (see [0054]-[0055]), and complementary to the sequence set forth in SEQ ID NO: 22. See alignment below (Qy = instant SEQ ID NO: 4; Db = Harper’s SEQ ID NO: 5(1540-1571) antisense sequence 779):
RESULT 1
NASEQ2_05162026_090247
Query Match 65.9%; Score 29; DB 1; Length 32;
Best Local Similarity 100.0%;
Matches 29; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 16 AGCTCCTCCAGCAGAGCCCGGTATTCTTC 44
|||||||||||||||||||||||||||||
Db 1 AGCTCCTCCAGCAGAGCCCGGTATTCTTC 29
Harper also teaches another sequence, sequence 778 (antisense to nucleotide 1573-1607 of DUX4 SEQ ID NO: 5) which is also 100% identical (in local similarity) to instant Application’s SEQ ID NO: 4. See alignment below (Qy = instant SEQ ID NO: 4; Db = Harper’s SEQ ID NO: 5(1573-1607) antisense sequence 778):
Query Match 31.8%; Score 14; DB 1; Length 35;
Best Local Similarity 100.0%;
Matches 14; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AACCCCGCGTCCTA 14
||||||||||||||
Db 22 AACCCCGCGTCCTA 35
Harper teaches that both sequences 778 and 779 are antisense sequences to binding sites necessary for splicing in DUX4 mRNA (see [0051]). Harper teaches that these antisense sequences were designed to block the naturally occurring splicing leading to a toxic DUX4 isoform, therefore producing a shorter, non-toxic isoform after splicing blockade (see Figure 2B, and below).
PNG
media_image1.png
307
555
media_image1.png
Greyscale
Harper does not teach a 44 base pair long oligonucleotide as set forth in SEQ ID NO: 4, and in its target sequence SEQ ID NO: 22.
However, Bradley teaches methods and compositions for treating cancer, using inhibitors of DUX4, and administering them to patients (see abstract).
Bradley teaches that the DUX4 inhibitor can be a nucleic acid inhibitor, an antisense oligonucleotide, small interfering (siRNA), short hairpin RNA (shRNA), double-stranded RNA, an antisense oligonucleotide, a ribozyme or combinations thereof (see [0007], and claim 69). Bradley teaches that the inhibitor nucleic acid can be used to treat sarcomas (see [0172]).
Bradley teaches a sequence that comprises SEQ ID NO: 22, i.e., a sequence that is part of the target DUX4 mRNA (see [0082], page 23, lines 20 and 25). Bradley teaches that in certain embodiments, the DUX4 inhibitory compounds targeted the D4Z4 and adjacent sequences that encompass the DUX4 transcript as well as regions centromeric and telomeric to the DUX4 transcript (in SEQ ID NO: 3) (see [0082]). Bradley also teaches that in some embodiments, the nucleic acid inhibitor comprises one that targets the following sequence (set forth in SEQ ID NO: 71) wherein the target sequence identical to instant application’s SEQ ID NO: 22 is shown in page 26, line 32 (see [0083]). Bradley also teaches that the nucleic acid inhibitor is complementary to or comprises at least, at most, or exactly, 5-150, or 200 contiguous nucleotides from Bradley’s SEQ ID NO: 1, 2, or 3. Bradley also teaches that in some embodiments, the nucleic acid inhibitor may be a nucleic acid that is at least, at most, or exactly 75-100% identical to a nucleic acid complementary to, or comprises at least, at most, or exactly, 5-150, or 200 contiguous nucleotides from SEQ ID NO: 1, 2, 3 or 71 (see [0084]).
Therefore, Bradley teaches that the inhibitory nucleic acid can be as long as 44 base pairs in length or longer.
It would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention, to have combined the oligonucleotides sequences 778 and 779 taught by Harper, and designed an inhibitor oligonucleotide that is 40-50 base pairs in length, as taught by Bradley. One with ordinary skills in the art, concerned that using a mixed batch of two oligonucleotides independently targeting each splicing/binding site, with overlapping sequences could interfere with each other, could have performed this modification, and used a single longer oligonucleotide covering both sites simultaneously. One with ordinary skills in the art motivated in trying different length of oligonucleotides, as taught by Bradley, capable of binding both sites simultaneously and blocking splicing, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Regarding claims 3, 4 and 5, Harper teaches promoters that can be used in a construct expressing the antisense oligonucleotides, such as U7 promoter (see [0053]) and tissue-targeting using gene cassettes using control elements derived from actin and myosin gene families, cardiac actin gene, muscle creatine kinase sequence elements (see [0038]).
Regarding claims 6-9, Harper teaches using an AAV vector comprising the nucleic acid (see [0010], [0013]-[0029].
Regarding claim 10, Harper teaches using an AAV vector that lacks rep and cap genes (see [0017], [0020]).
Regarding claims 11, 12 and 13, Harper teaches using an AAV vector that is a recombinant AAV vector, including an rAAV-9 vector (see [0017], [0020]-[0021]).
Regarding claim 14, Harper teaches a composition comprising the nucleic acid of claim 1, and a pharmaceutically acceptable carrier (see [0027]). Bradley also teaches a composition comprising a nucleic acid inhibitor to DUX4 mRNA, and a pharmaceutically acceptable excipient (see claim 78, and [0154]-[0155]).
Regarding claim 28, Harper teaches that the pharmaceutical compositions can be prepared as injectable formulations for intramuscular injections, or as topical formulation to be delivered to the muscles by transdermal transport (see [0032], page 11). Bradley also teaches that the composition can be formulated as injectable liquid solutions or suspensions, or composition can be administered via orthotopic, intradermal subcutaneous, intramuscular, or intravenous injections (see [0157]-[0159]).
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention, to have designed a long antisense oligonucleotides to overlap both binding/splicing sites at positions 1540-1607 of Harper’s SEQ ID NO: 5, as taught by Harper and suggested by Bradley, and formulated the oligonucleotide within a recombinant AAV construct, to be delivered with a pharmaceutically acceptable carrier by intramuscular injection for direct effects on muscular tissue of patients in need thereof. One with ordinary skills in the art, motivated in designing a medicament for blocking splicing and production of aberrant/toxic DUX4 isoform in a patient, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636